1 chr15 40685850 40685850 1 + A C rs11541643 40685835 + 40685815 40685855 41 AGATGGCTCCCTCTTGGGCATAAAATCTCAGAGGAAGCTAC AGATGGCTCCCTCTTGGGCATAAAATCTCAGAGGACGCTAC < 41bp 1 0.0721879303455353 Functional Loss -0.927812069654465 KNSTRN ENSG00000128944 UTR3 Human protein_coding chr15:40685835 chr15:40685850 . . 0 36 hPsi_associated_SNPs_51 0 17463246 Multiple continuous traits in DGI samples 2.89e-05 Johnson and O'Donnell TagSNP rs11541643 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
2 chr1 2491205 2491205 1 + C T rs2234161 2491205 + 2491185 2491225 41 CTGTGGATGCTGTCCTGGCCCGTGGATGGTGTCCCGGCCTC CTGTGGATGCTGTCCTGGCCTGTGGATGGTGTCCCGGCCTC Direct Gain 0 0.63308709859848 Functional Gain 0.63308709859848 TNFRSF14 ENSG00000157873 intronic Human protein_coding chr1:2491205 chr1:2491205 . . 0 21 hPsi_associated_SNPs_326 1 26974007 Chronic inflammatory diseases (ankylosing spondylitis, Crohn's disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy) 2e-11 GWAS_Catalog TagSNP rs2234161 GCST005537 Analysis of five chronic inflammatory diseases identifies 27 new associations and highlights disease-specific patterns at shared loci.
3 chr1 3651031 3651031 1 + C T rs12562437 3651031 + 3651011 3651051 41 CCAATGGGAGCCCTCACCCACGCAAGCCGAGACACCACCCA CCAATGGGAGCCCTCACCCATGCAAGCCGAGACACCACCCA Direct Gain 0 0.995553016662598 Functional Gain 0.995553016662598 TP73 ENSG00000078900 UTR3 Human protein_coding chr1:3651031 chr1:3651031 . . 0 21 hPsi_associated_SNPs_371 0 22589738 Visceral adipose tissue/subcutaneous adipose tissue ratio 2e-06 GWAS_Catalog TagSNP rs12562437 GCST001524 Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women.
4 chr1 9789150 9789150 1 + C T rs14271 9789150 + 9789130 9789170 41 ATCATGAGTATACACATCTGCGAAGGGAAACCGCGCGGCGA ATCATGAGTATACACATCTGTGAAGGGAAACCGCGCGGCGA Direct Gain 0 0.994776546955109 Functional Gain 0.994776546955109 CLSTN1 ENSG00000171603;ENSG00000171608 UTR3 Human other chr1:9789150 chr1:9789150 . . 0 21 hPsi_associated_SNPs_504 0 25918132 Diisocyanate-induced asthma 1e-06 GWAS_Catalog TagSNP rs14271 GCST002875 Genome-Wide Association Study Identifies Novel Loci Associated With Diisocyanate-Induced Occupational Asthma.
5 chr1 17601165 17601165 1 + C T rs11585357 17601165 + 17601145 17601185 41 TACGTGACTCGGGAACCACGCGACAGGTCTGTGAGTGGCCT TACGTGACTCGGGAACCACGTGACAGGTCTGTGAGTGGCCT Direct Gain 0 0.980342030525208 Functional Gain 0.980342030525208 PADI3 ENSG00000142619 CDS Human protein_coding chr1:17601165 chr1:17601165 synonymous SNV . 0 21 hPsi_associated_SNPs_772 0 29220522 Hair shape 4e-18 GWAS_Catalog TagSNP rs11585357 GCST005191 Meta-analysis of genome-wide association studies identifies 8 novel loci involved in shape variation of human head hair.
6 chr1 28598287 28598287 1 + C T rs74896528 28598287 + 28598267 28598307 41 CAGTGGTGATGGGCCTGCACCCTGACTACTTTACCAGCTTC CAGTGGTGATGGGCCTGCACTCTGACTACTTTACCAGCTTC Direct Gain 0 0.792188048362732 Functional Gain 0.792188048362732 SESN2 ENSG00000130766 CDS Human protein_coding chr1:28598287 chr1:28598287 nonsynonymous SNV 0.998 3 21 hPsi_associated_SNPs_1055 0 30993211 Serum uric acid levels 8e-09 GWAS_Catalog TagSNP rs74896528 GCST007725 Genome-wide meta-analysis identifies multiple novel loci associated with serum uric acid levels in Japanese individuals.
7 chr1 28661074 28661074 1 + C T rs139242087 28661074 + 28661054 28661094 41 CATTTGTTCTCAGGGCCCGACGCTCTATGGACAGGGCAGGG CATTTGTTCTCAGGGCCCGATGCTCTATGGACAGGGCAGGG Direct Gain 0 0.671482086181641 Functional Gain 0.671482086181641 MED18 ENSG00000130772 CDS Human protein_coding chr1:28661074 chr1:28661074 nonsynonymous SNV 0.972 4 21 hPsi_associated_SNPs_1057 0 28090653 Alanine aminotransferase (ALT) levels after remission induction therapy in actute lymphoblastic leukemia (ALL) 3e-06 GWAS_Catalog TagSNP rs139242087 GCST004250 Genome-Wide Study Links PNPLA3 Variant With Elevated Hepatic Transaminase After Acute Lymphoblastic Leukemia Therapy.
8 chr1 40219065 40219065 1 + C T rs1046988 40219065 + 40219045 40219085 41 TTCCCCCTCCGCTCTTGACCCTGCATATCCAGGAAGGAACT TTCCCCCTCCGCTCTTGACCTTGCATATCCAGGAAGGAACT Direct Gain 0 0.975826382637024 Functional Gain 0.975826382637024 PPIE ENSG00000084072 UTR3 Human protein_coding chr1:40219065 chr1:40219065 . . 0 21 hPsi_associated_SNPs_1272 0 30072576 Blood protein levels 4e-25 GWAS_Catalog TagSNP rs1046988 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
9 chr1 46084383 46084383 1 + G T rs1053941 46084383 + 46084363 46084403 41 GGAAAACGGTCTGCATTTGAGCTCTGGTTTGAAAGTAGCCA GGAAAACGGTCTGCATTTGATCTCTGGTTTGAAAGTAGCCA Direct Gain 0 0.565781235694885 Functional Gain 0.565781235694885 NASP ENSG00000132780 UTR3 Human protein_coding chr1:46084383 chr1:46084383 . . 0 21 hPsi_associated_SNPs_1432 0 24816252 Blood metabolite levels 5e-11 GWAS_Catalog TagSNP rs1053941 GCST002443 An atlas of genetic influences on human blood metabolites.
10 chr1 53550640 53550640 1 + C T rs41294750 53550640 + 53550620 53550660 41 TTGCCCCAGCCAGAATCAGCCATAGCAGCTCGCCGTCTGCC TTGCCCCAGCCAGAATCAGCTATAGCAGCTCGCCGTCTGCC Direct Gain 0 0.999809443950653 Functional Gain 0.999809443950653 PODN ENSG00000232993 ncRNA_intronic Human antisense chr1:53550640 chr1:53550640 . . 0 21 hPsi_associated_SNPs_1526 0 27989323 Interleukin-9 levels 2e-06 GWAS_Catalog TagSNP rs41294750 GCST004450 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
11 chr1 64097432 64097432 1 + C T rs1126728 64097432 + 64097412 64097452 41 GGCCAAACCGACTGAAGATCCGTATTGATGCTATGCATGGA GGCCAAACCGACTGAAGATCTGTATTGATGCTATGCATGGA Direct Gain 0 0.65189790725708 Functional Gain 0.65189790725708 PGM1 ENSG00000079739 CDS Human protein_coding chr1:64097432 chr1:64097432 nonsynonymous SNV 0.997 1 21 hPsi_associated_SNPs_1640 3 29875488 Blood protein levels 3e-23 GWAS_Catalog TagSNP rs1126728 GCST005806 Genomic atlas of the human plasma proteome.
12 chr1 68668292 68668292 1 + C T rs2149823 68668292 + 68668272 68668312 41 ATCAGTGGCTCATCTGTTGACGCTATTGCTCATTGCTCGGC ATCAGTGGCTCATCTGTTGATGCTATTGCTCATTGCTCGGC Direct Gain 0 0.938642382621765 Functional Gain 0.938642382621765 GNG12-AS1 ENSG00000232284 ncRNA_exonic Human antisense chr1:68668292 chr1:68668292 . . 0 21 hPsi_associated_SNPs_1690 0 17554300 Multiple complex diseases 0.00050177 Johnson and O'Donnell TagSNP rs2149823 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
13 chr1 113236681 113236681 1 + C T rs3748656 113236681 + 113236661 113236701 41 CGCCCCTCAGTGCTACGGGGCGACCACCTGTTTGCCCTTTT CGCCCCTCAGTGCTACGGGGTGACCACCTGTTTGCCCTTTT Direct Gain 0 0.871866703033447 Functional Gain 0.871866703033447 MOV10 ENSG00000155363 CDS Human protein_coding chr1:113236681 chr1:113236681 synonymous SNV . 0 21 hPsi_associated_SNPs_2000 0 25673412 Hip circumference adjusted for BMI 6e-09 GWAS_Catalog TagSNP rs3748656 GCST004067 New genetic loci link adipose and insulin biology to body fat distribution.
14 chr1 114448389 114448389 1 + C T rs11552449 114448389 + 114448369 114448409 41 CAGCCCACCTCTTGCATCGTCACCTACAGGTATGGGGCTGG CAGCCCACCTCTTGCATCGTTACCTACAGGTATGGGGCTGG Direct Gain 0 0.919219195842743 Functional Gain 0.919219195842743 DCLRE1B ENSG00000118655 CDS Human protein_coding chr1:114448389 chr1:114448389 nonsynonymous SNV 0.233 0 21 hPsi_associated_SNPs_2011 0 23535729 Breast cancer 2e-08 GWAS_Catalog TagSNP rs11552449 GCST001937 Large-scale genotyping identifies 41 new loci associated with breast cancer risk.
15 chr1 152734390 152734390 1 + C T rs2297487 152734390 + 152734370 152734410 41 GAGTCGGAGAATCTCTAAATCTCAGTGTCTATCCTGGGGCT GAGTCGGAGAATCTCTAAATTTCAGTGTCTATCCTGGGGCT Direct Gain 0 0.744068622589111 Functional Gain 0.744068622589111 KPRP ENSG00000203786 UTR3 Human protein_coding chr1:152734390 chr1:152734390 . . 0 21 hPsi_associated_SNPs_2251 0 17554300 Multiple complex diseases 0.000186813 Johnson and O'Donnell TagSNP rs2297487 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
16 chr1 155178782 155178782 1 + A T rs760077 155178782 + 155178762 155178802 41 CTTGGACGAGGCGCCGTGACACTCCGAGGCGCGCCGGGCCG CTTGGACGAGGCGCCGTGACTCTCCGAGGCGCGCCGGGCCG Direct Gain 0 0.74355673789978 Functional Gain 0.74355673789978 MTX1 ENSG00000173171 CDS Human protein_coding chr1:155178782 chr1:155178782 nonsynonymous SNV . 0 21 hPsi_associated_SNPs_2337 0 27863252 Hematocrit 2e-23 GWAS_Catalog TagSNP rs760077 GCST004604 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
17 chr1 164816726 164816726 1 + C T rs6426881 164816726 + 164816706 164816746 41 CACAGTCTTTGGAGACCATTCAGCACTGAGAAAGCAATATT CACAGTCTTTGGAGACCATTTAGCACTGAGAAAGCAATATT Direct Gain 0 0.554908275604248 Functional Gain 0.554908275604248 PBX1 ENSG00000185630 UTR3 Human protein_coding chr1:164816726 chr1:164816726 . . 0 21 hPsi_associated_SNPs_2547 0 27126917 Night sleep phenotypes 8e-06 GWAS_Catalog TagSNP rs6426881 GCST003542 Genome-wide association analysis of actigraphic sleep phenotypes in the LIFE Adult Study.
18 chr1 176809368 176809368 1 + C T rs12118034 176809368 + 176809348 176809388 41 CGAGCCTACTGCCACTATGACGGGGGAGACTGCTGCTCTTC CGAGCCTACTGCCACTATGATGGGGGAGACTGCTGCTCTTC Direct Gain 0 0.832006692886353 Functional Gain 0.832006692886353 PAPPA2 ENSG00000116183 CDS Human protein_coding chr1:176809368 chr1:176809368 synonymous SNV . 0 21 hPsi_associated_SNPs_2692 0 17463246 Multiple continuous traits in DGI samples 0.000733 Johnson and O'Donnell TagSNP rs12118034 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
19 chr1 196659237 196659237 1 + C T rs1061170 196659237 + 196659217 196659257 41 AAAATGGATATAATCAAAATCATGGAAGAAAGTTTGTACAG AAAATGGATATAATCAAAATTATGGAAGAAAGTTTGTACAG Direct Gain 0 0.520250082015991 Functional Gain 0.520250082015991 CFH ENSG00000000971 CDS Human protein_coding chr1:196659237 chr1:196659237 nonsynonymous SNV 0.000 0 21 hPsi_associated_SNPs_2889 6 22705344 Age-related macular degeneration (choroidal neovascularisation) 1e-108 GWAS_Catalog TagSNP rs1061170 GCST001579 Heritability and genome-wide association study to assess genetic differences between advanced age-related macular degeneration subtypes.
20 chr2 3642756 3642756 1 + C T rs77246730 3642756 + 3642736 3642776 41 CCGTTCGCCTAGCGCGTGCTCAGGTAGGAGACTCTGCCCGG CCGTTCGCCTAGCGCGTGCTTAGGTAGGAGACTCTGCCCGG Direct Gain 0 0.998889327049255 Functional Gain 0.998889327049255 COLEC11 ENSG00000118004 UTR5 Human protein_coding chr2:3642756 chr2:3642756 . . 0 21 hPsi_associated_SNPs_3783 0 29875488 Blood protein levels 3e-42 GWAS_Catalog TagSNP rs77246730 GCST005806 Genomic atlas of the human plasma proteome.
21 chr2 25369040 25369040 1 + C T rs1561289 25369040 + 25369020 25369060 41 GTGGGACCGGGACAGAAAGACTTACATGGTCCTCAGGCATG GTGGGACCGGGACAGAAAGATTTACATGGTCCTCAGGCATG Direct Gain 0 0.78546267747879 Functional Gain 0.78546267747879 EFR3B ENSG00000084710 UTR3 Human protein_coding chr2:25369040 chr2:25369040 . . 0 21 hPsi_associated_SNPs_3955 0 17052657 Parkinson's disease 0.000876599 Johnson and O'Donnell TagSNP rs1561289 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
22 chr2 26930411 26930411 1 + C T rs1731243 26930411 + 26930391 26930431 41 GGATCTTCTCAGGGTCAGGGCTTAGCCCTGGGGGTCTCCAC GGATCTTCTCAGGGTCAGGGTTTAGCCCTGGGGGTCTCCAC Direct Gain 0 0.961795449256897 Functional Gain 0.961795449256897 KCNK3 ENSG00000171303 intronic Human protein_coding chr2:26930411 chr2:26930411 . . 0 21 hPsi_associated_SNPs_3979 0 29912962 Diastolic blood pressure x alcohol consumption interaction (2df test) 1e-23 GWAS_Catalog TagSNP rs1731243 GCST006166 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
23 chr2 38916970 38916970 1 + A T rs6741892 38916970 + 38916950 38916990 41 CCCAGGCTTCCCCAAATATAAATGACCATGAAGTCACCATA CCCAGGCTTCCCCAAATATATATGACCATGAAGTCACCATA Direct Gain 0 0.989128828048706 Functional Gain 0.989128828048706 GALM ENSG00000143891 CDS Human protein_coding chr2:38916970 chr2:38916970 nonsynonymous SNV 0.997 0 21 hPsi_associated_SNPs_4122 0 21339755 5-HTT brain serotonin transporter levels 5e-06 GWAS_Catalog TagSNP rs6741892 GCST000983 A non-synonymous polymorphism in galactose mutarotase (GALM) is associated with serotonin transporter binding potential in the human thalamus: results of a genome-wide association study.
24 chr2 54684398 54684398 1 + C T rs76070960 54684398 + 54684378 54684418 41 TTCAGCTCCTGCCACCCTCTCTTCAACAGGTTTGTCTCAGC TTCAGCTCCTGCCACCCTCTTTTCAACAGGTTTGTCTCAGC Direct Gain 0 0.99400007724762 Functional Gain 0.99400007724762 SPTBN1 ENSG00000115306 UTR5 Human protein_coding chr2:54684398 chr2:54684398 . . 0 21 hPsi_associated_SNPs_4219 0 29617998 Intraocular pressure 1e-09 GWAS_Catalog TagSNP rs76070960 GCST005580 Genome-Wide Association Analyses Identify New Loci Influencing Intraocular Pressure.
25 chr2 73829372 73829372 1 + C T rs1052162 73829372 + 73829352 73829392 41 CTGGGGAGCGGATAAAGCGCCTGAAGTTAATAGTCCAGGAG CTGGGGAGCGGATAAAGCGCTTGAAGTTAATAGTCCAGGAG Direct Gain 0 0.844889163970947 Functional Gain 0.844889163970947 ALMS1 ENSG00000116127 CDS Human protein_coding chr2:73829372 chr2:73829372 synonymous SNV . 0 21 hPsi_associated_SNPs_4376 1 23093944 Serum metabolite levels 1e-54 GWAS_Catalog TagSNP rs1052162 GCST006249 Mining the unknown: a systems approach to metabolite identification combining genetic and metabolic information.
26 chr2 111886332 111886332 1 + C T rs13429049 111886332 + 111886312 111886352 41 ACAAGGATTTCTCATGATACCTTTTTATAGCCACAGCCACC ACAAGGATTTCTCATGATACTTTTTTATAGCCACAGCCACC Direct Gain 0 0.983828783035278 Functional Gain 0.983828783035278 BCL2L11 ENSG00000153094 UTR3 Human protein_coding chr2:111886332 chr2:111886332 . . 0 21 hPsi_associated_SNPs_4703 0 30598549 Heel bone mineral density 2e-13 GWAS_Catalog TagSNP rs13429049 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
27 chr2 120848049 120848049 1 + C T rs28930677 120848049 + 120848029 120848069 41 GCCCCGTCCAAAAGAGTTCTCATCGATCAGGATTTATTCGA GCCCCGTCCAAAAGAGTTCTTATCGATCAGGATTTATTCGA Direct Gain 0 0.814307272434235 Functional Gain 0.814307272434235 EPB41L5 ENSG00000115109 CDS Human protein_coding chr2:120848049 chr2:120848049 nonsynonymous SNV 0.998 1 21 hPsi_associated_SNPs_4804 0 30595370 Red blood cell count 1e-15 GWAS_Catalog TagSNP rs28930677 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
28 chr2 128176040 128176040 1 + A T rs1799810 128176040 + 128176020 128176060 41 GTCATGGCGGCAGGACGGCGAACTTGCAGTATCTCCACGAC GTCATGGCGGCAGGACGGCGTACTTGCAGTATCTCCACGAC Direct Gain 0 0.831786632537842 Functional Gain 0.831786632537842 PROC ENSG00000115718 CDS Human protein_coding chr2:128176040 chr2:128176040 synonymous SNV . 0 21 hPsi_associated_SNPs_4831 2 20707712 Self-rated health 9e-06 GWAS_Catalog TagSNP rs1799810 GCST000747 A genome-wide association study of self-rated health.
29 chr2 139655616 139655616 1 + C T rs11886636 139655616 + 139655596 139655636 41 AGAGAAGCTGTTTCAGTTCACGTTTGAAGACCGTGGGAAAT AGAGAAGCTGTTTCAGTTCATGTTTGAAGACCGTGGGAAAT Direct Gain 0 0.791314840316772 Functional Gain 0.791314840316772 YY1P2 ENSG00000229104 ncRNA_exonic Human processed_pseudogene chr2:139655616 chr2:139655616 . . 0 21 hPsi_associated_SNPs_4968 0 17463246 Multiple continuous traits in DGI samples 0.0007827 Johnson and O'Donnell TagSNP rs11886636 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
30 chr2 145833813 145833813 1 + C T rs1852682 145833813 + 145833793 145833833 41 TGATCCAGCAACGGAAAGATCATATCAGCACAGCAGGGAGA TGATCCAGCAACGGAAAGATTATATCAGCACAGCAGGGAGA Direct Gain 0 0.74157440662384 Functional Gain 0.74157440662384 TEX41 ENSG00000226674 ncRNA_exonic Human lincRNA chr2:145833813 chr2:145833813 . . 0 21 hPsi_associated_SNPs_4973 0 17554300 Multiple complex diseases 0.000434936 Johnson and O'Donnell TagSNP rs1852682 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
31 chr2 159954175 159954175 1 + C T rs34588551 159954175 + 159954155 159954195 41 ACTTTGGTCCAGAGACTTCTCCAGTCCTGCACCTTGACCAC ACTTTGGTCCAGAGACTTCTTCAGTCCTGCACCTTGACCAC Direct Gain 0 0.716756045818329 Functional Gain 0.716756045818329 TANC1 ENSG00000115183 CDS Human protein_coding chr2:159954175 chr2:159954175 nonsynonymous SNV 0.959 0 21 hPsi_associated_SNPs_5014 0 28869591 Heel bone mineral density 8e-06 GWAS_Catalog TagSNP rs34588551 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
32 chr2 182781419 182781419 1 + C T rs13419647 182781419 + 182781399 182781439 41 GATTTTTCTCGTTAAGTATCCTCCCATTTTTAGTCTATCAT GATTTTTCTCGTTAAGTATCTTCCCATTTTTAGTCTATCAT Direct Gain 0 0.999881029129028 Functional Gain 0.999881029129028 SSFA2 ENSG00000138434 UTR3 Human protein_coding chr2:182781419 chr2:182781419 . . 0 21 hPsi_associated_SNPs_5201 0 17554300 Multiple complex diseases 0.000415605 Johnson and O'Donnell TagSNP rs13419647 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
33 chr2 203777226 203777226 1 + C T rs149163995 203777226 + 203777206 203777246 41 CTCCTGCCTCCTCCTCCTCCCGTCACCTCCTGACCCGCCGG CTCCTGCCTCCTCCTCCTCCTGTCACCTCCTGACCCGCCGG Direct Gain 0 0.703608572483063 Functional Gain 0.703608572483063 CARF ENSG00000138380 UTR5 Human protein_coding chr2:203777226 chr2:203777226 . . 0 21 hPsi_associated_SNPs_5347 0 27182965 Migraine 4e-10 GWAS_Catalog TagSNP rs149163995 GCST003986 Detection and interpretation of shared genetic influences on 42 human traits.
34 chr2 234679384 234679384 1 + C T rs11563251 234679384 + 234679364 234679404 41 AGATGATATTTAACATGATTCATGGCCAAGTACTAATATTA AGATGATATTTAACATGATTTATGGCCAAGTACTAATATTA Direct Gain 0 0.973976314067841 Functional Gain 0.973976314067841 UGT1A1;UGT1A10;UGT1A3;UGT1A4;UGT1A5;UGT1A6;UGT1A7;UGT1A8;UGT1A9 ENSG00000241635 UTR3 Human protein_coding chr2:234679384 chr2:234679384 . . 0 21 hPsi_associated_SNPs_5764 0 24097068 LDL cholesterol 5e-08 GWAS_Catalog TagSNP rs11563251 GCST002222 Discovery and refinement of loci associated with lipid levels.
35 chr3 12624070 12624070 1 + C T rs15997 12624070 + 12624050 12624090 41 AAAAACAAACCTGGCTCTTACCTTTGATCTTTTCTTCCCCA AAAAACAAACCTGGCTCTTATCTTTGATCTTTTCTTCCCCA Direct Gain 0 0.97773265838623 Functional Gain 0.97773265838623 MKRN2 ENSG00000075975 UTR3 Human protein_coding chr3:12624070 chr3:12624070 . . 0 21 hPsi_associated_SNPs_6051 0 17554300 Multiple complex diseases 0.000554059 Johnson and O'Donnell TagSNP rs15997 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
36 chr3 14803109 14803109 1 + G T rs141708090 14803109 + 14803089 14803129 41 TGGGCTACTTCCTGCCGGATGACTACAAATTCAGGTAAAAC TGGGCTACTTCCTGCCGGATTACTACAAATTCAGGTAAAAC Direct Gain 0 0.913555324077606 Functional Gain 0.913555324077606 C3orf20 ENSG00000131379 CDS Human protein_coding chr3:14803109 chr3:14803109 nonsynonymous SNV 0.503 1 21 hPsi_associated_SNPs_6094 0 27114598 Asparaginase-induced acute pancreatitis in acute lymphoblastic leukemia (onset time) 6e-07 GWAS_Catalog TagSNP rs141708090 GCST003501 Clinical and Genetic Risk Factors for Acute Pancreatitis in Patients With Acute Lymphoblastic Leukemia.
37 chr3 32937596 32937596 1 + C T rs4909017 32937596 + 32937576 32937616 41 TGTTCAGTATTATGAAACTACTGGTTAATCTGACCTATTGG TGTTCAGTATTATGAAACTATTGGTTAATCTGACCTATTGG Direct Gain 0 0.857848048210144 Functional Gain 0.857848048210144 TRIM71 ENSG00000206557 UTR3 Human protein_coding chr3:32937596 chr3:32937596 . . 0 21 hPsi_associated_SNPs_6189 0 30048462 Heel bone mineral density 1e-16 GWAS_Catalog TagSNP rs4909017 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
38 chr3 38271881 38271881 1 + C T rs6599079 38271881 + 38271861 38271901 41 AGAATTTCTTCAAGAAAAAACATTGCAGAGAGCACCAACCA AGAATTTCTTCAAGAAAAAATATTGCAGAGAGCACCAACCA Direct Gain 0 0.974390864372253 Functional Gain 0.974390864372253 OXSR1 ENSG00000172939 CDS Human protein_coding chr3:38271881 chr3:38271881 nonsynonymous SNV 0.996 0 21 hPsi_associated_SNPs_6233 0 30595370 Red cell distribution width 1e-13 GWAS_Catalog TagSNP rs6599079 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
39 chr3 49453834 49453834 1 + C T rs6997 49453834 + 49453814 49453854 41 CCCTGGCCCACCCACTAATACTACTGCACAGAGTCAGGATC CCCTGGCCCACCCACTAATATTACTGCACAGAGTCAGGATC Direct Gain 0 0.978832244873047 Functional Gain 0.978832244873047 TCTA ENSG00000145022 UTR3 Human protein_coding chr3:49453834 chr3:49453834 . . 0 21 hPsi_associated_SNPs_6481 0 25644384 Cognitive function 8e-06 GWAS_Catalog TagSNP rs6997 GCST002774 Genetic contributions to variation in general cognitive function: a meta-analysis of genome-wide association studies in the CHARGE consortium (N=53949).
40 chr3 49570200 49570200 1 + C T rs1801143 49570200 + 49570180 49570220 41 GAGGATGATGTCTACCTGCACACAGTCATTCCGGCCGTGGT GAGGATGATGTCTACCTGCATACAGTCATTCCGGCCGTGGT Direct Gain 0 0.509784281253815 Functional Gain 0.509784281253815 DAG1 ENSG00000173402 CDS Human protein_coding chr3:49570200 chr3:49570200 synonymous SNV . 0 21 hPsi_associated_SNPs_6484 2 17554300 Multiple complex diseases 2.21e-07 Johnson and O'Donnell TagSNP rs1801143 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
41 chr3 108097009 108097009 1 + A T rs113421805 108097009 + 108096989 108097029 41 GCCCACAAAACATTGCTCTTAACTTCACCGCCTAACCCAAA GCCCACAAAACATTGCTCTTTACTTCACCGCCTAACCCAAA Direct Gain 0 0.97833514213562 Functional Gain 0.97833514213562 HHLA2 ENSG00000114455 UTR3 Human protein_coding chr3:108097009 chr3:108097009 . . 0 21 hPsi_associated_SNPs_6878 0 30038396 Self-reported math ability 8e-14 GWAS_Catalog TagSNP rs113421805 GCST006573 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
42 chr3 133475722 133475722 1 + C T rs1799852 133475722 + 133475702 133475742 41 ACCAGTATGAGCTGCTTTGCCTGGACAACACCCGGAAGCCG ACCAGTATGAGCTGCTTTGCTTGGACAACACCCGGAAGCCG Direct Gain 0 0.743762254714966 Functional Gain 0.743762254714966 TF ENSG00000091513 CDS Human protein_coding chr3:133475722 chr3:133475722 synonymous SNV . 0 21 hPsi_associated_SNPs_7199 1 19084217 Iron status biomarkers 5e-06 GWAS_Catalog TagSNP rs1799852 GCST000301 Variants in TF and HFE explain approximately 40% of genetic variation in serum-transferrin levels.
43 chr3 138668509 138668509 1 + C T rs142253798 138668509 + 138668489 138668529 41 AATGCGGGCGGGAAAGCTGGCAGAATGATTACTTTCAGGTC AATGCGGGCGGGAAAGCTGGTAGAATGATTACTTTCAGGTC Direct Gain 0 0.986974000930786 Functional Gain 0.986974000930786 FOXL2NB ENSG00000206262 intronic Human protein_coding chr3:138668509 chr3:138668509 . . 0 21 hPsi_associated_SNPs_7250 0 29059683 Breast cancer 8e-06 GWAS_Catalog TagSNP rs142253798 GCST004988 Association analysis identifies 65 new breast cancer risk loci.
44 chr3 184020542 184020542 1 + G T rs11545169 184020542 + 184020522 184020562 41 CTGAGTGAAGATGTCGAGGAGTATGAGGACCTGACAGAGAT CTGAGTGAAGATGTCGAGGATTATGAGGACCTGACAGAGAT Direct Gain 0 0.513861000537872 Functional Gain 0.513861000537872 PSMD2 ENSG00000175166 CDS Human protein_coding chr3:184020542 chr3:184020542 nonsynonymous SNV 0.997 1 21 hPsi_associated_SNPs_7526 0 30038396 Self-reported math ability 2e-08 GWAS_Catalog TagSNP rs11545169 GCST006573 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
45 chr3 186390627 186390627 1 + C T rs9898 186390627 + 186390607 186390647 41 ACTTCTCTGTGCGGAACTGCCCCAGACACCATTTCCCCAGA ACTTCTCTGTGCGGAACTGCTCCAGACACCATTTCCCCAGA Direct Gain 0 0.8190838098526 Functional Gain 0.8190838098526 HRG ENSG00000113905 CDS Human protein_coding chr3:186390627 chr3:186390627 nonsynonymous SNV 0.219 0 21 hPsi_associated_SNPs_7571 0 22703881 Activated partial thromboplastin time 1e-111 GWAS_Catalog TagSNP rs9898 GCST001574 Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease.
46 chr4 3241845 3241845 1 + C T rs362307 3241845 + 3241825 3241865 41 CCGGAGCCTTTGGAAGTCTGCGCCCTTGTGCCCTGCCTCCA CCGGAGCCTTTGGAAGTCTGTGCCCTTGTGCCCTGCCTCCA Direct Gain 0 0.909675598144531 Functional Gain 0.909675598144531 HTT ENSG00000197386 UTR3 Human protein_coding chr4:3241845 chr4:3241845 . . 0 21 hPsi_associated_SNPs_7928 0 30038396 Educational attainment (years of education) 2e-17 GWAS_Catalog TagSNP rs362307 GCST006442 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
47 chr4 15482360 15482360 1 + C T rs1861050 15482360 + 15482340 15482380 41 GTCCCCAAGGAAATGGTGTCCGAAAAATCCCACCTTGGCAA GTCCCCAAGGAAATGGTGTCTGAAAAATCCCACCTTGGCAA Direct Gain 0 0.84551203250885 Functional Gain 0.84551203250885 CC2D2A ENSG00000048342 CDS Human protein_coding chr4:15482360 chr4:15482360 stopgain 0.005 0 21 hPsi_associated_SNPs_8115 3 20585324 Conduct disorder 8e-06 GWAS_Catalog TagSNP rs1861050 GCST000714 Genome-wide association study of conduct disorder symptomatology.
48 chr4 38698924 38698924 1 + C T rs36023504 38698924 + 38698904 38698944 41 CAGCGTGACTCCCCACTCACCTGGCTCTCTCTCTGTCCTGC CAGCGTGACTCCCCACTCACTTGGCTCTCTCTCTGTCCTGC Direct Gain 0 0.843046188354492 Functional Gain 0.843046188354492 KLF3 ENSG00000109787 UTR3 Human protein_coding chr4:38698924 chr4:38698924 . . 0 21 hPsi_associated_SNPs_8207 0 30595370 Red cell distribution width 3e-11 GWAS_Catalog TagSNP rs36023504 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
49 chr4 71008910 71008910 1 + C T rs3775758 71008910 + 71008890 71008930 41 AGATTCTTGAATTAACTGCTCCTACTTTACTTTGGTAAGTG AGATTCTTGAATTAACTGCTTCTACTTTACTTTGGTAAGTG Direct Gain 0 0.916000604629517 Functional Gain 0.916000604629517 CSN1S2BP ENSG00000234124;ENSG00000187533 intergenic Human other chr4:71008910 chr4:71008910 . . 0 21 hPsi_associated_SNPs_8363 0 17554300 Multiple complex diseases 0.000179571 Johnson and O'Donnell TagSNP rs3775758 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
50 chr4 80435046 80435046 1 + C T rs58777020 80435046 + 80435026 80435066 41 AAGATAATTTCTTTTCTAAACACACAGAAAGGTAATAATTC AAGATAATTTCTTTTCTAAATACACAGAAAGGTAATAATTC Direct Gain 0 0.979372501373291 Functional Gain 0.979372501373291 LINC00989 ENSG00000250334 ncRNA_exonic Human lincRNA chr4:80435046 chr4:80435046 . . 0 21 hPsi_associated_SNPs_8494 0 29520036 Insomnia 6e-07 GWAS_Catalog TagSNP rs58777020 GCST005566 Genome-wide analysis of insomnia disorder.
51 chr4 95496882 95496882 1 + C T rs2452600 95496882 + 95496862 95496902 41 ACGGCCTTTTGGTTCTGTGTCTTCACCAAAAGTCACATCCA ACGGCCTTTTGGTTCTGTGTTTTCACCAAAAGTCACATCCA Direct Gain 0 0.995519518852234 Functional Gain 0.995519518852234 PDLIM5 ENSG00000163110 CDS Human protein_coding chr4:95496882 chr4:95496882 nonsynonymous SNV 1.000 1 21 hPsi_associated_SNPs_8577 0 29212778 Coronary artery disease 1e-07 GWAS_Catalog TagSNP rs2452600 GCST005196 Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease.
52 chr4 102751276 102751276 1 + C T rs10516486 102751276 + 102751256 102751296 41 CAGATCAGCTCTATGAATTACTAAATATCTCTCAAAGCAGA CAGATCAGCTCTATGAATTATTAAATATCTCTCAAAGCAGA Direct Gain 0 0.922820150852203 Functional Gain 0.922820150852203 BANK1 ENSG00000153064 CDS Human protein_coding chr4:102751276 chr4:102751276 synonymous SNV . 0 21 hPsi_associated_SNPs_8614 0 18204447 Systemic lupus erythematosus 0.00162181 Johnson and O'Donnell TagSNP rs10516486 . Functional variants in the B-cell gene BANK1 are associated with systemic lupus erythematosus.
53 chr4 155486381 155486381 1 + C T rs2227401 155486381 + 155486361 155486401 41 AAGCAACTTGCCCAAGGTCTCATAGCTGTAAGTCAACCCTA AAGCAACTTGCCCAAGGTCTTATAGCTGTAAGTCAACCCTA Direct Gain 0 0.999900639057159 Functional Gain 0.999900639057159 FGB ENSG00000171564 UTR3 Human protein_coding chr4:155486381 chr4:155486381 . . 0 21 hPsi_associated_SNPs_8909 0 28107422 Fibrinogen levels 5e-134 GWAS_Catalog TagSNP rs2227401 GCST004122 Comparison of HapMap and 1000 Genomes Reference Panels in a Large-Scale Genome-Wide Association Study.
54 chr4 155488821 155488821 1 + C T rs6056 155488821 + 155488801 155488841 41 ATAGATGAGACTGTGAATAGCAATATCCCAACTAACCTTCG ATAGATGAGACTGTGAATAGTAATATCCCAACTAACCTTCG Direct Gain 0 0.866344153881073 Functional Gain 0.866344153881073 FGB ENSG00000171564 CDS Human protein_coding chr4:155488821 chr4:155488821 synonymous SNV . 0 21 hPsi_associated_SNPs_8910 2 20031577 Fibrinogen 8e-39 GWAS_Catalog TagSNP rs6056 GCST000368 Novel loci, including those related to Crohn disease, psoriasis, and inflammation, identified in a genome-wide association study of fibrinogen in 17 686 women: the Women's Genome Health Study.
55 chr4 155493352 155493352 1 + C T rs1044291 155493352 + 155493332 155493372 41 TGTCACATTAAGTTTTTCCCCATTCCAGGACAGGTCAGGCC TGTCACATTAAGTTTTTCCCTATTCCAGGACAGGTCAGGCC Direct Gain 0 0.954220175743103 Functional Gain 0.954220175743103 FGB ENSG00000171564;ENSG00000171560 intergenic Human other chr4:155493352 chr4:155493352 . . 0 21 hPsi_associated_SNPs_8912 1 17554300 Multiple complex diseases 0.000318544 Johnson and O'Donnell TagSNP rs1044291 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
56 chr5 7520881 7520881 1 + G T rs13166360 7520881 + 7520861 7520901 41 TCCTCTTCATCATCTTCGTGGTGTACACCATGCTGCCCTTC TCCTCTTCATCATCTTCGTGTTGTACACCATGCTGCCCTTC Direct Gain 0 0.992751121520996 Functional Gain 0.992751121520996 ADCY2 ENSG00000078295 CDS Human protein_coding chr5:7520881 chr5:7520881 nonsynonymous SNV 1.000 2 21 hPsi_associated_SNPs_9208 0 30595370 Lung function (FEV1/FVC) 7e-09 GWAS_Catalog TagSNP rs13166360 GCST007080 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
57 chr5 35879156 35879156 1 + G T rs6881706 35879156 + 35879136 35879176 41 TAAGATTACTAATTGGTTCTGCCCAATCTCCTTTCAGATTT TAAGATTACTAATTGGTTCTTCCCAATCTCCTTTCAGATTT Direct Gain 0 0.896400570869446 Functional Gain 0.896400570869446 IL7R ENSG00000168685 UTR3 Human protein_coding chr5:35879156 chr5:35879156 . . 0 21 hPsi_associated_SNPs_9367 0 24076602 Multiple sclerosis 4e-17 GWAS_Catalog TagSNP rs6881706 GCST005531 Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis.
58 chr5 56168712 56168712 1 + C T rs2229882 56168712 + 56168692 56168732 41 AGAGCTGCACAGCAGCAAACCGTACAGCAGCAGCCTTTGGC AGAGCTGCACAGCAGCAAACTGTACAGCAGCAGCCTTTGGC Direct Gain 0 0.643840253353119 Functional Gain 0.643840253353119 MAP3K1 ENSG00000095015 CDS Human protein_coding chr5:56168712 chr5:56168712 synonymous SNV . 0 21 hPsi_associated_SNPs_9457 0 24493630 Breast cancer (early onset) 1e-14 GWAS_Catalog TagSNP rs2229882 GCST002346 A genome-wide association study of early-onset breast cancer identifies PFKM as a novel breast cancer gene and supports a common genetic spectrum for breast cancer at any age.
59 chr5 75964507 75964507 1 + C T rs34950321 75964507 + 75964487 75964527 41 TTTCCTTCTTTCCTTCTAGACCAACCCTTTATACTTGGCTA TTTCCTTCTTTCCTTCTAGATCAACCCTTTATACTTGGCTA Direct Gain 0 0.665571570396423 Functional Gain 0.665571570396423 IQGAP2 ENSG00000145703 CDS Human protein_coding chr5:75964507 chr5:75964507 nonsynonymous SNV 0.974 5 21 hPsi_associated_SNPs_9615 0 27863252 Mean platelet volume 5e-54 GWAS_Catalog TagSNP rs34950321 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
60 chr5 79029311 79029311 1 + A T rs74935252 79029311 + 79029291 79029331 41 GTTCATCTCCTGAGTTGGAAAATTTAGCATCAGGTTTAGCC GTTCATCTCCTGAGTTGGAATATTTAGCATCAGGTTTAGCC Direct Gain 0 0.936258792877197 Functional Gain 0.936258792877197 CMYA5 ENSG00000164309 CDS Human protein_coding chr5:79029311 chr5:79029311 nonsynonymous SNV 0.110 1 21 hPsi_associated_SNPs_9652 0 25918132 Diisocyanate-induced asthma 1e-06 GWAS_Catalog TagSNP rs74935252 GCST002875 Genome-Wide Association Study Identifies Novel Loci Associated With Diisocyanate-Induced Occupational Asthma.
61 chr5 109221026 109221026 1 + C T rs112724034 109221026 + 109221006 109221046 41 TGAGGCTCGGCCGCGTGCCCCACGCCCAGGCCGGCGCCTCG TGAGGCTCGGCCGCGTGCCCTACGCCCAGGCCGGCGCCTCG Direct Gain 0 0.998572647571564 Functional Gain 0.998572647571564 LINC01848 ENSG00000253224 ncRNA_exonic Human processed_pseudogene chr5:109221026 chr5:109221026 . . 0 21 hPsi_associated_SNPs_9791 0 23535033 Alzheimer's disease (cognitive decline) 9e-13 GWAS_Catalog TagSNP rs112724034 GCST001915 Genome-wide association study of the rate of cognitive decline in Alzheimer's disease.
62 chr5 126161690 126161690 1 + C T rs36105360 126161690 + 126161670 126161710 41 TTTTTTACAGATTTGGGCTGCAAACGCTGGTGTCACAGCCA TTTTTTACAGATTTGGGCTGTAAACGCTGGTGTCACAGCCA Direct Gain 0 0.994585990905762 Functional Gain 0.994585990905762 LMNB1 ENSG00000113368 CDS Human protein_coding chr5:126161690 chr5:126161690 nonsynonymous SNV 1.000 3 21 hPsi_associated_SNPs_9881 2 29875488 Blood protein levels 2e-24 GWAS_Catalog TagSNP rs36105360 GCST005806 Genomic atlas of the human plasma proteome.
63 chr5 131607721 131607721 1 + C T rs10479001 131607721 + 131607701 131607741 41 CTCGTTCCCCCCATCAGGGGCACCATCGTCAAGGCACGGGA CTCGTTCCCCCCATCAGGGGTACCATCGTCAAGGCACGGGA Direct Gain 0 0.986825346946716 Functional Gain 0.986825346946716 PDLIM4 ENSG00000131435 CDS Human protein_coding chr5:131607721 chr5:131607721 nonsynonymous SNV 0.989 0 21 hPsi_associated_SNPs_9919 0 28957414 Red cell distribution width 1e-08 GWAS_Catalog TagSNP rs10479001 GCST006804 Red blood cell distribution width: Genetic evidence for aging pathways in 116,666 volunteers.
64 chr5 151184701 151184701 1 + C T rs1062177 151184701 + 151184681 151184721 41 TTGTATTTTTATTCTGGTATCTAATCAGATTCCTAATCATA TTGTATTTTTATTCTGGTATTTAATCAGATTCCTAATCATA Direct Gain 0 0.99971866607666 Functional Gain 0.99971866607666 G3BP1 ENSG00000145907 UTR3 Human protein_coding chr5:151184701 chr5:151184701 . . 0 21 hPsi_associated_SNPs_10432 0 24839885 Preschool internalizing problems 8e-06 GWAS_Catalog TagSNP rs1062177 GCST002362 A genome-wide association meta-analysis of preschool internalizing problems.
65 chr5 153837106 153837106 1 + C T rs148763909 153837106 + 153837086 153837126 41 AAACCCCCTACTGAGCAGGGCGGCGGAGTGTCCAAAGGTCT AAACCCCCTACTGAGCAGGGTGGCGGAGTGTCCAAAGGTCT Direct Gain 0 0.877063512802124 Functional Gain 0.877063512802124 SAP30L ENSG00000164576 UTR3 Human protein_coding chr5:153837106 chr5:153837106 . . 0 21 hPsi_associated_SNPs_10457 0 23535033 Alzheimer's disease (cognitive decline) 1e-08 GWAS_Catalog TagSNP rs148763909 GCST001915 Genome-wide association study of the rate of cognitive decline in Alzheimer's disease.
66 chr5 180432564 180432564 1 + G T rs73815153 180432564 + 180432544 180432584 41 GTCGGGATGACGTAGACAGGGGGAAGAACAATGTGACTTTG GTCGGGATGACGTAGACAGGTGGAAGAACAATGTGACTTTG Direct Gain 0 0.999076008796692 Functional Gain 0.999076008796692 BTNL3 ENSG00000168903 CDS Human protein_coding chr5:180432564 chr5:180432564 nonsynonymous SNV 0.000 0 21 hPsi_associated_SNPs_10737 0 29093273 GIP levels in response to oral glucose tolerance test (120 minutes) 3e-06 GWAS_Catalog TagSNP rs73815153 GCST005166 Genetic determinants of circulating GIP and GLP-1 concentrations.
67 chr6 20599628 20599628 1 + C T rs9366357 20599628 + 20599608 20599648 41 GGTTGAGTGTACGTTTGCTTCGTCTTCAAAGTAGAAAGTTC GGTTGAGTGTACGTTTGCTTTGTCTTCAAAGTAGAAAGTTC Direct Gain 0 0.852985382080078 Functional Gain 0.852985382080078 CDKAL1 ENSG00000145996 intronic Human protein_coding chr6:20599628 chr6:20599628 . . 0 21 hPsi_associated_SNPs_10974 0 17554300 Multiple complex diseases 8.97276e-05 Johnson and O'Donnell TagSNP rs9366357 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
68 chr6 24146454 24146454 1 + C T rs16888718 24146454 + 24146434 24146474 41 TCCTCTTTCATAGATCGTGACTTTGTGTTATTTTCCGTGTT TCCTCTTTCATAGATCGTGATTTTGTGTTATTTTCCGTGTT Direct Gain 0 0.691004157066345 Functional Gain 0.691004157066345 NRSN1 ENSG00000152954 UTR3 Human protein_coding chr6:24146454 chr6:24146454 . . 0 21 hPsi_associated_SNPs_10994 0 17634449 Coronary Artery Disease 0.0005882 Johnson and O'Donnell TagSNP rs16888718 . Genomewide association analysis of coronary artery disease.
69 chr6 28117331 28117331 1 + C T rs62620225 28117331 + 28117311 28117351 41 TTCAGCATCTGCACCAGAGCCTCCAAATACTCAGCTCCAAT TTCAGCATCTGCACCAGAGCTTCCAAATACTCAGCTCCAAT Direct Gain 0 0.948958992958069 Functional Gain 0.948958992958069 ZKSCAN8 ENSG00000198315 CDS Human protein_coding chr6:28117331 chr6:28117331 nonsynonymous SNV 0.522 0 21 hPsi_associated_SNPs_11122 0 30643256 Life satisfaction 6e-12 GWAS_Catalog TagSNP rs62620225 GCST007337 Multivariate genome-wide analyses of the well-being spectrum.
70 chr6 28912399 28912399 1 + C T rs140736187 28912399 + 28912379 28912419 41 CAGTCTCATAATCTGAAGGTCCTGAGTTCGAACCTCAGAGG CAGTCTCATAATCTGAAGGTTCTGAGTTCGAACCTCAGAGG Direct Gain 0 0.820109128952026 Functional Gain 0.820109128952026 LINC01556 ENSG00000204709 downstream Human lincRNA chr6:28912399 chr6:28912399 . . 0 21 hPsi_associated_SNPs_11146 0 28928442 Tonsillectomy 2e-07 GWAS_Catalog TagSNP rs140736187 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
71 chr6 29911030 29911030 1 + C T rs9260151 29911030 + 29911010 29911050 41 TCGGGGGACTGGGCTGACCGCGGGGTCGGGGCCAGGTTCTC TCGGGGGACTGGGCTGACCGTGGGGTCGGGGCCAGGTTCTC Direct Gain 0 0.993092179298401 Functional Gain 0.993092179298401 HLA-A ENSG00000206503 intronic Human protein_coding chr6:29911030 chr6:29911030 . . 0 21 hPsi_associated_SNPs_11209 0 29404672 C-peptide levels in type I diabetes 8e-08 GWAS_Catalog TagSNP rs9260151 GCST005436 Meta-genome-wide association studies identify a locus on chromosome 1 and multiple variants in the MHC region for serum C-peptide in type 1 diabetes.
72 chr6 29913298 29913298 1 + A T rs1061235 29913298 + 29913278 29913318 41 CTTCCCTTTGTGACTTGAAGAACCCTGACTTTGTTTCTGCA CTTCCCTTTGTGACTTGAAGTACCCTGACTTTGTTTCTGCA Direct Gain 0 0.982171535491943 Functional Gain 0.982171535491943 HLA-A ENSG00000206503 UTR3 Human protein_coding chr6:29913298 chr6:29913298 . . 0 21 hPsi_associated_SNPs_11217 1 21428769 Adverse response to carbamazepine 1e-07 GWAS_Catalog TagSNP rs1061235 GCST001014 HLA-A*3101 and carbamazepine-induced hypersensitivity reactions in Europeans.
73 chr6 30234152 30234152 1 + C T rs3130405 30234152 + 30234132 30234172 41 TCTGATACCCTGATGGCCGACACTGGGCCCTGTGGCAAAGA TCTGATACCCTGATGGCCGATACTGGGCCCTGTGGCAAAGA Direct Gain 0 0.784204721450806 Functional Gain 0.784204721450806 HLA-L ENSG00000243753 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr6:30234152 chr6:30234152 . . 0 21 hPsi_associated_SNPs_11234 0 17554300 Multiple complex diseases 1.42e-10 Johnson and O'Donnell TagSNP rs3130405 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
74 chr6 30692539 30692539 1 + C T rs1061397 30692539 + 30692519 30692559 41 AAACACATGTAGATAATGGCCATCATCCTAAGCCCAAAGTA AAACACATGTAGATAATGGCTATCATCCTAAGCCCAAAGTA Direct Gain 0 0.826831042766571 Functional Gain 0.826831042766571 TUBB ENSG00000196230 UTR3 Human protein_coding chr6:30692539 chr6:30692539 . . 0 21 hPsi_associated_SNPs_11244 0 17554300 Multiple complex diseases 0.000988676 Johnson and O'Donnell TagSNP rs1061397 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
75 chr6 30882634 30882634 1 + C T rs1264302 30882634 + 30882614 30882654 41 ATGCCTCATTTGCCTCTCGCCTCTTTTCGACCACCATTTTG ATGCCTCATTTGCCTCTCGCTTCTTTTCGACCACCATTTTG Direct Gain 0 0.971260905265808 Functional Gain 0.971260905265808 VARS2 ENSG00000137411 CDS Human protein_coding chr6:30882634 chr6:30882634 synonymous SNV . 0 21 hPsi_associated_SNPs_11255 1 17804836 Rheumatoid Arthritis 1.15e-10 Johnson and O'Donnell TagSNP rs1264302 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
76 chr6 31129707 31129707 1 + C T rs2073724 31129707 + 31129687 31129727 41 GGATGATGAGAGTGAGCCTCCTGAGAACCCGCCACCGGTCC GGATGATGAGAGTGAGCCTCTTGAGAACCCGCCACCGGTCC Direct Gain 0 0.998979210853577 Functional Gain 0.998979210853577 TCF19 ENSG00000137310 CDS Human protein_coding chr6:31129707 chr6:31129707 nonsynonymous SNV 0.002 0 21 hPsi_associated_SNPs_11303 0 17554300 Multiple complex diseases 2.05e-09 Johnson and O'Donnell TagSNP rs2073724 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
77 chr6 31727897 31727897 1 + C T rs3115672 31727897 + 31727877 31727917 41 ATGGAACTCTGTGCCCGAACCTTTGTGCCCAACTCCACAGA ATGGAACTCTGTGCCCGAACTTTTGTGCCCAACTCCACAGA Direct Gain 0 0.946577310562134 Functional Gain 0.946577310562134 MSH5 ENSG00000204410;ENSG00000255152 CDS Human other chr6:31727897 chr6:31727897 synonymous SNV . 0 21 hPsi_associated_SNPs_11344 1 30643256 Positive affect 4e-15 GWAS_Catalog TagSNP rs3115672 GCST007338 Multivariate genome-wide analyses of the well-being spectrum.
78 chr6 31929808 31929808 1 + C T rs35664695 31929808 + 31929788 31929828 41 GTGGCTGAATATGCCATTGCCCTGGCCCAGAAACACATGAC GTGGCTGAATATGCCATTGCTCTGGCCCAGAAACACATGAC Direct Gain 0 0.867765784263611 Functional Gain 0.867765784263611 SKIV2L ENSG00000204351 CDS Human protein_coding chr6:31929808 chr6:31929808 synonymous SNV . 0 21 hPsi_associated_SNPs_11356 1 28928442 Tonsillectomy 6e-17 GWAS_Catalog TagSNP rs35664695 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
79 chr6 31994782 31994782 1 + C T rs451637 31994782 + 31994762 31994802 41 CTATGTGTGGCCACCCCAGTCCAGCTCCGGGTGTTCCGCGA CTATGTGTGGCCACCCCAGTTCAGCTCCGGGTGTTCCGCGA Direct Gain 0 0.9985431432724 Functional Gain 0.9985431432724 C4B;C4B_2 ENSG00000224389 CDS Human protein_coding chr6:31994782 chr6:31994782 synonymous SNV . 0 21 hPsi_associated_SNPs_11362 0 29875488 Blood protein levels 2e-22 GWAS_Catalog TagSNP rs451637 GCST005806 Genomic atlas of the human plasma proteome.
80 chr6 32151443 32151443 1 + C T rs2070600 32151443 + 32151423 32151463 41 AGCCGGAAGGAAGAGGGAGCCGTTGGGAAGGACACGAGCCA AGCCGGAAGGAAGAGGGAGCTGTTGGGAAGGACACGAGCCA Direct Gain 0 0.999821901321411 Functional Gain 0.999821901321411 AGER ENSG00000204305 CDS Human protein_coding chr6:32151443 chr6:32151443 nonsynonymous SNV 0.998 3 21 hPsi_associated_SNPs_11367 0 20010834 Pulmonary function 3e-15 GWAS_Catalog TagSNP rs2070600 GCST000544 Genome-wide association study identifies five loci associated with lung function.
81 chr6 33055538 33055538 1 + C T rs9277554 33055538 + 33055518 33055558 41 AGGAGAGGTGGGGCTGAAGGCACAGACTTGGGCGTCACTGG AGGAGAGGTGGGGCTGAAGGTACAGACTTGGGCGTCACTGG Direct Gain 0 0.999980092048645 Functional Gain 0.999980092048645 HLA-DPB1 ENSG00000223865 downstream Human protein_coding chr6:33055538 chr6:33055538 . . 0 21 hPsi_associated_SNPs_11449 0 23740775 Wegener's granulomatosis 2e-50 GWAS_Catalog TagSNP rs9277554 GCST002160 Association of granulomatosis with polyangiitis (Wegener's) with HLA-DPB1*04 and SEMA6A gene variants: evidence from genome-wide analysis.
82 chr6 33056897 33056897 1 + C T rs9277565 33056897 + 33056877 33056917 41 AGGAGGTGGGAGTTGGGCATCGGGTGTGAAGATGCTCTTGA AGGAGGTGGGAGTTGGGCATTGGGTGTGAAGATGCTCTTGA Direct Gain 0 0.798649787902832 Functional Gain 0.798649787902832 HLA-DPB1 ENSG00000223865;ENSG00000231461 intergenic Human other chr6:33056897 chr6:33056897 . . 0 21 hPsi_associated_SNPs_11453 0 17804836 Rheumatoid Arthritis 2.26e-06 Johnson and O'Donnell TagSNP rs9277565 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
83 chr6 34840515 34840515 1 + C T rs3822923 34840515 + 34840495 34840535 41 ACTAGGTGGAATCTTCTCAACACTGTAGGGCCATTTCACCT ACTAGGTGGAATCTTCTCAATACTGTAGGGCCATTTCACCT Direct Gain 0 0.721725106239319 Functional Gain 0.721725106239319 UHRF1BP1 ENSG00000065060 UTR3 Human protein_coding chr6:34840515 chr6:34840515 . . 0 21 hPsi_associated_SNPs_11519 0 17554300 Multiple complex diseases 0.000791774 Johnson and O'Donnell TagSNP rs3822923 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
84 chr6 118030238 118030238 1 + G T rs2498589 118030238 + 118030218 118030258 41 GGCAAACTACAAACTACTAGGATTCTGATTTCAGATGTAGT GGCAAACTACAAACTACTAGTATTCTGATTTCAGATGTAGT Direct Gain 0 0.587444007396698 Functional Gain 0.587444007396698 NUS1 ENSG00000153989 UTR3 Human protein_coding chr6:118030238 chr6:118030238 . . 0 21 hPsi_associated_SNPs_12156 0 29875488 Blood protein levels 2e-16 GWAS_Catalog TagSNP rs2498589 GCST005806 Genomic atlas of the human plasma proteome.
85 chr6 134824211 134824211 1 + C T rs10872424 134824211 + 134824191 134824231 41 CTCCGGGTGTGCCCAGAAGTCAAAGTCCAGCAGGGGCAAAG CTCCGGGTGTGCCCAGAAGTTAAAGTCCAGCAGGGGCAAAG Direct Gain 0 0.975832641124725 Functional Gain 0.975832641124725 LINC01010 ENSG00000236700 ncRNA_exonic Human lincRNA chr6:134824211 chr6:134824211 . . 0 21 hPsi_associated_SNPs_12254 0 26420894 Glomerular filtration rate in chronic kidney disease 4e-06 GWAS_Catalog TagSNP rs10872424 GCST003139 Genetic loci associated with renal function measures and chronic kidney disease in children: the Pediatric Investigation for Genetic Factors Linked with Renal Progression Consortium.
86 chr6 147887569 147887569 1 + C T rs702347 147887569 + 147887549 147887589 41 TCATTTCCAGGTGTCGCATCCGTGGCTGATTTATTTCACAG TCATTTCCAGGTGTCGCATCTGTGGCTGATTTATTTCACAG Direct Gain 0 0.98657214641571 Functional Gain 0.98657214641571 SAMD5 ENSG00000203727 UTR3 Human protein_coding chr6:147887569 chr6:147887569 . . 0 21 hPsi_associated_SNPs_12339 0 17554300 Multiple complex diseases 0.000370435 Johnson and O'Donnell TagSNP rs702347 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
87 chr6 159621087 159621087 1 + C T rs62432291 159621087 + 159621067 159621107 41 ACCACAGTGGAGTGAGCCGTCCTGTTTACAGAGCTGAAAGC ACCACAGTGGAGTGAGCCGTTCTGTTTACAGAGCTGAAAGC Direct Gain 0 0.998295664787292 Functional Gain 0.998295664787292 FNDC1 ENSG00000164694 CDS Human protein_coding chr6:159621087 chr6:159621087 nonsynonymous SNV 0.996 2 21 hPsi_associated_SNPs_12477 0 27182965 Joint mobility (Beighton score) 1e-12 GWAS_Catalog TagSNP rs62432291 GCST003998 Detection and interpretation of shared genetic influences on 42 human traits.
88 chr6 160769811 160769811 1 + C T rs668871 160769811 + 160769791 160769831 41 CTCGCCGCCTTCCCCAACCGCTCGGCTCCCCTTGTGCCGTG CTCGCCGCCTTCCCCAACCGTTCGGCTCCCCTTGTGCCGTG Direct Gain 0 0.99755471944809 Functional Gain 0.99755471944809 SLC22A3 ENSG00000146477 CDS Human protein_coding chr6:160769811 chr6:160769811 synonymous SNV . 0 21 hPsi_associated_SNPs_12510 0 30595370 Waist-hip ratio 8e-30 GWAS_Catalog TagSNP rs668871 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
89 chr6 167754975 167754975 1 + G T rs12528714 167754975 + 167754955 167754995 41 CCCTACGCGTCCCTCTTCCAGTCGCACTCCTGCAAGACCAA CCCTACGCGTCCCTCTTCCATTCGCACTCCTGCAAGACCAA Direct Gain 0 0.995739817619324 Functional Gain 0.995739817619324 TTLL2 ENSG00000120440 CDS Human protein_coding chr6:167754975 chr6:167754975 nonsynonymous SNV 0.000 2 21 hPsi_associated_SNPs_12537 0 23382691 IgG glycosylation 8e-06 GWAS_Catalog TagSNP rs12528714 GCST001848 Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers.
90 chr7 1885178 1885178 1 + C T rs140364877 1885178 + 1885158 1885198 41 GGACGTGCTCCACGCAGACACGCGTCCGGCTCTGGTTCACG GGACGTGCTCCACGCAGACATGCGTCCGGCTCTGGTTCACG Direct Gain 0 0.992115676403046 Functional Gain 0.992115676403046 MAD1L1 ENSG00000002822;ENSG00000176349 intronic Human other chr7:1885178 chr7:1885178 . . 0 21 hPsi_associated_SNPs_12675 0 28540026 Autism spectrum disorder or schizophrenia 2e-11 GWAS_Catalog TagSNP rs140364877 GCST004521 Meta-analysis of GWAS of over 16,000 individuals with autism spectrum disorder highlights a novel locus at 10q24.32 and a significant overlap with schizophrenia.
91 chr7 12613252 12613252 1 + C T rs1034856 12613252 + 12613232 12613272 41 CATTTCAGCTTTGCACCTAGCAGTTTAAATGCATCCATTCA CATTTCAGCTTTGCACCTAGTAGTTTAAATGCATCCATTCA Direct Gain 0 0.751941561698914 Functional Gain 0.751941561698914 SCIN ENSG00000006747 intronic Human protein_coding chr7:12613252 chr7:12613252 . . 0 21 hPsi_associated_SNPs_12885 0 17554300 Multiple complex diseases 0.000558434 Johnson and O'Donnell TagSNP rs1034856 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
92 chr7 21582917 21582917 1 + C T rs2285942 21582917 + 21582897 21582937 41 GACTTCAGAGAAGCCCCGACCCTTCGCCTAACCTCGGGGGC GACTTCAGAGAAGCCCCGACTCTTCGCCTAACCTCGGGGGC Direct Gain 0 0.976857304573059 Functional Gain 0.976857304573059 DNAH11 ENSG00000105877 CDS Human protein_coding chr7:21582917 chr7:21582917 synonymous SNV . 0 21 hPsi_associated_SNPs_12918 2 29507422 Total cholesterol levels 4e-07 GWAS_Catalog TagSNP rs2285942 GCST007143 A large electronic-health-record-based genome-wide study of serum lipids.
93 chr7 22612164 22612164 1 + C T rs2023718 22612164 + 22612144 22612184 41 TGGGTGGCTTCAAAACTGGACGGCTTCAACAGAAAGTTATT TGGGTGGCTTCAAAACTGGATGGCTTCAACAGAAAGTTATT Direct Gain 0 0.617247998714447 Functional Gain 0.617247998714447 LOC100506178 ENSG00000225541;ENSG00000232759 ncRNA_exonic Human other chr7:22612164 chr7:22612164 . . 0 21 hPsi_associated_SNPs_12932 0 17554300 Multiple complex diseases 0.000588953 Johnson and O'Donnell TagSNP rs2023718 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
94 chr7 23314547 23314547 1 + C T rs5850 23314547 + 23314527 23314567 41 TATATTTCCAAATTTTTGTACAGTCGCTGCACATATTTGAA TATATTTCCAAATTTTTGTATAGTCGCTGCACATATTTGAA Direct Gain 0 0.9835604429245 Functional Gain 0.9835604429245 GPNMB ENSG00000136235 UTR3 Human protein_coding chr7:23314547 chr7:23314547 . . 0 21 hPsi_associated_SNPs_12948 0 28240269 Blood protein levels 8e-14 GWAS_Catalog TagSNP rs5850 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
95 chr7 50610613 50610613 1 + C T rs3807553 50610613 + 50610593 50610633 41 CATGATCAGTGGACTGTAACCTTGTCTGACCTTATGCCTTC CATGATCAGTGGACTGTAACTTTGTCTGACCTTATGCCTTC Direct Gain 0 0.924556136131287 Functional Gain 0.924556136131287 DDC-AS1 ENSG00000226122 ncRNA_exonic Human antisense chr7:50610613 chr7:50610613 . . 0 21 hPsi_associated_SNPs_13281 0 29594489 Clostridium difficile infection in multiple myeloma 2e-06 GWAS_Catalog TagSNP rs3807553 GCST005686 Host genetic susceptibility to Clostridium difficile infections in patients undergoing autologous stem cell transplantation: a genome-wide association study.
96 chr7 64075993 64075993 1 + C T rs985668 64075993 + 64075973 64076013 41 GGTATGACTGTCCTCCACTACTTAGACTCTGCCCAAGAAGC GGTATGACTGTCCTCCACTATTTAGACTCTGCCCAAGAAGC Direct Gain 0 0.984422445297241 Functional Gain 0.984422445297241 LOC100128885 ENSG00000224669;ENSG00000196247 intergenic Human other chr7:64075993 chr7:64075993 . . 0 21 hPsi_associated_SNPs_13322 0 17998437 Alzheimer's disease 3.3e-05 Johnson and O'Donnell TagSNP rs985668 . Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.
97 chr7 72395789 72395789 1 + C T rs141884613 72395789 + 72395769 72395809 41 TGGGCCTGTCGCTGGTTGGCCTCTTACTGTACCTCGTGCCG TGGGCCTGTCGCTGGTTGGCTTCTTACTGTACCTCGTGCCG Direct Gain 0 0.999723076820374 Functional Gain 0.999723076820374 POM121 ENSG00000196313 CDS Human protein_coding chr7:72395789 chr7:72395789 nonsynonymous SNV 0.054 3 21 hPsi_associated_SNPs_13387 0 30595370 Body mass index 8e-09 GWAS_Catalog TagSNP rs141884613 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
98 chr7 100862768 100862768 1 + C T rs10215699 100862768 + 100862748 100862788 41 CCCAGGCTGGAGTGCAGTGGCGCAATCTCGGTTCACTGCAA CCCAGGCTGGAGTGCAGTGGTGCAATCTCGGTTCACTGCAA Direct Gain 0 0.539190769195557 Functional Gain 0.539190769195557 ZNHIT1 ENSG00000106400 intronic Human protein_coding chr7:100862768 chr7:100862768 . . 0 21 hPsi_associated_SNPs_13759 0 30072576 Blood protein levels 7e-06 GWAS_Catalog TagSNP rs10215699 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
99 chr7 123610348 123610348 1 + C T rs11975640 123610348 + 123610328 123610368 41 AGGCCTCTTCCCTTGGCTTACAGGTGACTATCTTCTCCTTG AGGCCTCTTCCCTTGGCTTATAGGTGACTATCTTCTCCTTG Direct Gain 0 0.996331095695496 Functional Gain 0.996331095695496 SPAM1 ENSG00000106304 UTR3 Human protein_coding chr7:123610348 chr7:123610348 . . 0 21 hPsi_associated_SNPs_13930 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 9e-06 Johnson and O'Donnell TagSNP rs11975640 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
100 chr7 129962414 129962414 1 + C T rs2306848 129962414 + 129962394 129962434 41 GAGTTGAGAGATACCGGGACCTATGGCTTCCTCCTGCCAGC GAGTTGAGAGATACCGGGACTTATGGCTTCCTCCTGCCAGC Direct Gain 0 0.998964905738831 Functional Gain 0.998964905738831 CPA4 ENSG00000128510 CDS Human protein_coding chr7:129962414 chr7:129962414 synonymous SNV . 0 21 hPsi_associated_SNPs_14003 0 30891314 Rheumatoid arthritis 6e-12 GWAS_Catalog TagSNP rs2306848 GCST007843 Studying the effects of haplotype partitioning methods on the RA-associated genomic results from the North American Rheumatoid Arthritis Consortium (NARAC) dataset.
101 chr7 142479940 142479940 1 + C T rs58649169 142479940 + 142479920 142479960 41 TTTGATGATGATGACAAGATCGTTGGGGGCTACACCTGTGA TTTGATGATGATGACAAGATTGTTGGGGGCTACACCTGTGA Direct Gain 0 0.892401218414307 Functional Gain 0.892401218414307 PRSS3P2 ENSG00000250606 ncRNA_exonic Human other chr7:142479940 chr7:142479940 . . 0 21 hPsi_associated_SNPs_14131 0 28754779 Alcoholic chronic pancreatitis 3e-15 GWAS_Catalog TagSNP rs58649169 GCST004860 Genome-wide association study identifies inversion in the CTRB1-CTRB2 locus to modify risk for alcoholic and non-alcoholic chronic pancreatitis.
102 chr8 1719494 1719494 1 + C T rs34030778 1719494 + 1719474 1719514 41 TGCTGGGGGACCCTGTGCTGCATGCCGACAAGGCGCGTGGC TGCTGGGGGACCCTGTGCTGTATGCCGACAAGGCGCGTGGC Direct Gain 0 0.999997735023499 Functional Gain 0.999997735023499 CLN8 ENSG00000182372 CDS Human protein_coding chr8:1719494 chr8:1719494 nonsynonymous SNV 0.002 1 21 hPsi_associated_SNPs_14489 3 28736931 Total cholesterol change in response to fenofibrate in statin-treated type 2 diabetes 4e-08 GWAS_Catalog TagSNP rs34030778 GCST004765 Genetic Variants in HSD17B3, SMAD3, and IPO11 Impact Circulating Lipids in Response to Fenofibrate in Individuals With Type 2 Diabetes.
103 chr8 11351912 11351912 1 + C T rs922483 11351912 + 11351892 11351932 41 TCGCAGACCGGGGGTGCTGCCACCTCTGTCTGCTGCCGGCA TCGCAGACCGGGGGTGCTGCTACCTCTGTCTGCTGCCGGCA Direct Gain 0 0.545978128910065 Functional Gain 0.545978128910065 BLK ENSG00000136573 UTR5 Human protein_coding chr8:11351912 chr8:11351912 . . 0 21 hPsi_associated_SNPs_14583 1 24532676 Rheumatoid arthritis (ACPA-positive) 2e-07 GWAS_Catalog TagSNP rs922483 GCST006048 High-density genotyping of immune loci in Koreans and Europeans identifies eight new rheumatoid arthritis risk loci.
104 chr8 19824667 19824667 1 + C T rs15285 19824667 + 19824647 19824687 41 ATGGTCTCACAGAGCCAACTCACTCTTATGAAATGGGCTTT ATGGTCTCACAGAGCCAACTTACTCTTATGAAATGGGCTTT Direct Gain 0 0.781712055206299 Functional Gain 0.781712055206299 LPL ENSG00000175445 UTR3 Human protein_coding chr8:19824667 chr8:19824667 . . 0 21 hPsi_associated_SNPs_14686 1 29212778 Coronary artery disease 8e-14 GWAS_Catalog TagSNP rs15285 GCST005194 Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease.
105 chr8 26269412 26269412 1 + C T rs12165 26269412 + 26269392 26269432 41 CTAGCAATCTATAAAGTGCACCAGGTCAACTTGAATAAAAA CTAGCAATCTATAAAGTGCATCAGGTCAACTTGAATAAAAA Direct Gain 0 0.96262538433075 Functional Gain 0.96262538433075 BNIP3L ENSG00000104765 UTR3 Human protein_coding chr8:26269412 chr8:26269412 . . 0 21 hPsi_associated_SNPs_14826 0 30595370 Mean corpuscular hemoglobin 4e-24 GWAS_Catalog TagSNP rs12165 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
106 chr8 30924557 30924557 1 + C T rs1800389 30924557 + 30924537 30924577 41 CATCATTTCTAGCTGAAATGCACAGAGACCTGGAGCCTTAA CATCATTTCTAGCTGAAATGTACAGAGACCTGGAGCCTTAA Direct Gain 0 0.921985924243927 Functional Gain 0.921985924243927 WRN ENSG00000165392 CDS Human protein_coding chr8:30924557 chr8:30924557 synonymous SNV . 0 21 hPsi_associated_SNPs_14897 2 30595370 Cardiovascular disease 4e-08 GWAS_Catalog TagSNP rs1800389 GCST007072 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
107 chr8 120435812 120435812 1 + C T rs2071518 120435812 + 120435792 120435832 41 TACAACCATATATTGAGGTTCATTGGGAAGATTCTCTATTG TACAACCATATATTGAGGTTTATTGGGAAGATTCTCTATTG Direct Gain 0 0.983905673027039 Functional Gain 0.983905673027039 NOV ENSG00000253398 ncRNA_intronic Human antisense chr8:120435812 chr8:120435812 . . 0 21 hPsi_associated_SNPs_15360 0 21909110 Blood pressure 4e-09 GWAS_Catalog TagSNP rs2071518 GCST001235 Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure.
108 chr8 121384163 121384163 1 + G T rs2429 121384163 + 121384143 121384183 41 TGAACGATTTATCCAGCAGTGTGTTCCAGGGGTTGCCTCTC TGAACGATTTATCCAGCAGTTTGTTCCAGGGGTTGCCTCTC Direct Gain 0 0.997670769691467 Functional Gain 0.997670769691467 COL14A1 ENSG00000187955 UTR3 Human protein_coding chr8:121384163 chr8:121384163 . . 0 21 hPsi_associated_SNPs_15366 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0002034 Johnson and O'Donnell TagSNP rs2429 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
109 chr8 145584694 145584694 1 + C T rs34383175 145584694 + 145584674 145584714 41 GAGCCTGGGCAGGTGGGGACCCCGCTCCCCAACACCTGTCT GAGCCTGGGCAGGTGGGGACTCCGCTCCCCAACACCTGTCT Direct Gain 0 0.963790476322174 Functional Gain 0.963790476322174 SLC52A2 ENSG00000185803 UTR3 Human protein_coding chr8:145584694 chr8:145584694 . . 0 21 hPsi_associated_SNPs_15576 1 27989323 Interferon gamma-induced protein 10 levels 2e-06 GWAS_Catalog TagSNP rs34383175 GCST004440 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
110 chr9 2622134 2622134 1 + C T rs34881325 2622134 + 2622114 2622154 41 CGGAAGGACTGGTAACTTGTCGTGCGGAGCGAACGGCGGCG CGGAAGGACTGGTAACTTGTTGTGCGGAGCGAACGGCGGCG Direct Gain 0 0.996380090713501 Functional Gain 0.996380090713501 VLDLR-AS1 ENSG00000236404 ncRNA_exonic Human antisense chr9:2622134 chr9:2622134 . . 0 21 hPsi_associated_SNPs_15674 1 27989323 Vascular endothelial growth factor levels 3e-10 GWAS_Catalog TagSNP rs34881325 GCST004422 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
111 chr9 6253571 6253571 1 + C T rs10975519 6253571 + 6253551 6253591 41 GATAAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTC GATAAGGTGTTACTGAGTTATTATGAGTCTCAACACCCCTC Direct Gain 0 0.965216636657715 Functional Gain 0.965216636657715 IL33 ENSG00000137033 CDS Human protein_coding chr9:6253571 chr9:6253571 synonymous SNV . 0 21 hPsi_associated_SNPs_15707 0 23472165 Endometriosis 9e-07 GWAS_Catalog TagSNP rs10975519 GCST001894 Genome-wide association study link novel loci to endometriosis.
112 chr9 78505692 78505692 1 + C T rs76937529 78505692 + 78505672 78505712 41 GAGGGGGCGCCCGGTCGCTGCCTGTACCGCTCCCGCTGGTC GAGGGGGCGCCCGGTCGCTGTCTGTACCGCTCCCGCTGGTC Direct Gain 0 0.846211552619934 Functional Gain 0.846211552619934 PCSK5 ENSG00000099139 UTR5 Human protein_coding chr9:78505692 chr9:78505692 . . 0 21 hPsi_associated_SNPs_15992 0 30595370 Waist-hip ratio 5e-09 GWAS_Catalog TagSNP rs76937529 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
113 chr9 97062981 97062981 1 + C T rs12236219 97062981 + 97062961 97063001 41 TCCTGTGCCTTGAGTGTGGGCGTAGCTTCAGGCAGCAGTCA TCCTGTGCCTTGAGTGTGGGTGTAGCTTCAGGCAGCAGTCA Direct Gain 0 0.680384993553162 Functional Gain 0.680384993553162 ZNF169 ENSG00000175787 CDS Human protein_coding chr9:97062981 chr9:97062981 nonsynonymous SNV 0.013 3 21 hPsi_associated_SNPs_16168 0 28892062 Body mass index 3e-09 GWAS_Catalog TagSNP rs12236219 GCST004904 Genome-wide association study identifies 112 new loci for body mass index in the Japanese population.
114 chr9 115634639 115634639 1 + C T rs1324930 115634639 + 115634619 115634659 41 GTGTGACTTGGTCCTGCCATCGTTAGCTTTGAAATCACAGG GTGTGACTTGGTCCTGCCATTGTTAGCTTTGAAATCACAGG Direct Gain 0 0.999242782592773 Functional Gain 0.999242782592773 SNX30 ENSG00000148158 UTR3 Human protein_coding chr9:115634639 chr9:115634639 . . 0 21 hPsi_associated_SNPs_16342 0 17554300 Multiple complex diseases 0.000461968 Johnson and O'Donnell TagSNP rs1324930 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
115 chr9 130206762 130206762 1 + C T rs2248025 130206762 + 130206742 130206782 41 GGAAGAGCCTTCAGCCAGAACGCCAACCTCACCAAACACCA GGAAGAGCCTTCAGCCAGAATGCCAACCTCACCAAACACCA Direct Gain 0 0.995408654212952 Functional Gain 0.995408654212952 ZNF79 ENSG00000196152 CDS Human protein_coding chr9:130206762 chr9:130206762 synonymous SNV . 0 21 hPsi_associated_SNPs_16538 0 17554300 Multiple complex diseases 0.00049509 Johnson and O'Donnell TagSNP rs2248025 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
116 chr9 131186783 131186783 1 + C T rs61732491 131186783 + 131186763 131186803 41 GGTCCACTCCACCTTCCTTGCATCCCTGCGGGCTGAAGGGG GGTCCACTCCACCTTCCTTGTATCCCTGCGGGCTGAAGGGG Direct Gain 0 0.999215483665466 Functional Gain 0.999215483665466 CERCAM ENSG00000167123 CDS Human protein_coding chr9:131186783 chr9:131186783 nonsynonymous SNV 0.527 1 21 hPsi_associated_SNPs_16591 0 26606652 Systemic lupus erythematosus 2e-06 GWAS_Catalog TagSNP rs61732491 GCST003252 Genome-Wide Association Study in an Amerindian Ancestry Population Reveals Novel Systemic Lupus Erythematosus Risk Loci and the Role of European Admixture.
117 chr9 131910013 131910013 1 + C T rs11789753 131910013 + 131909993 131910033 41 CTGGGGCCTGGTCACTCGGCCACTCTCTCCTGTTTCTGGCC CTGGGGCCTGGTCACTCGGCTACTCTCTCCTGTTTCTGGCC Direct Gain 0 0.999991178512573 Functional Gain 0.999991178512573 PTPA ENSG00000119383 UTR3 Human protein_coding chr9:131910013 chr9:131910013 . . 0 21 hPsi_associated_SNPs_16644 0 26401656 Blood metabolite levels 5e-12 GWAS_Catalog TagSNP rs11789753 GCST006879 Integration of Genome-Wide SNP Data and Gene-Expression Profiles Reveals Six Novel Loci and Regulatory Mechanisms for Amino Acids and Acylcarnitines in Whole Blood.
118 chr9 136243324 136243324 1 + C T rs3739893 136243324 + 136243304 136243344 41 GCCAGGGGTGGACGCTCGCCCGTACGCGGTCGCTACTGATC GCCAGGGGTGGACGCTCGCCTGTACGCGGTCGCTACTGATC Direct Gain 0 0.611778438091278 Functional Gain 0.611778438091278 STKLD1 ENSG00000198870 UTR5 Human protein_coding chr9:136243324 chr9:136243324 . . 0 21 hPsi_associated_SNPs_16783 0 29296746 ADAMTS13 levels 1e-30 GWAS_Catalog TagSNP rs3739893 GCST005945 Genetic variants in ADAMTS13 as well as smoking are major determinants of plasma ADAMTS13 levels.
119 chr10 11299735 11299735 1 + A T rs2277212 11299735 + 11299715 11299755 41 AAATTGTTCATAGGAATGGTATCGAAGAAATGTAATGAGAA AAATTGTTCATAGGAATGGTTTCGAAGAAATGTAATGAGAA Direct Gain 0 0.999878585338593 Functional Gain 0.999878585338593 CELF2 ENSG00000048740 CDS Human protein_coding chr10:11299735 chr10:11299735 synonymous SNV . 0 21 hPsi_associated_SNPs_17230 0 25475840 Breastfeeding duration 9e-06 GWAS_Catalog TagSNP rs2277212 GCST002715 A twin study of breastfeeding with a preliminary genome-wide association scan.
120 chr10 62551890 62551890 1 + A T rs2456778 62551890 + 62551870 62551910 41 TATGCTTTAAGAAATTTTTAATTTCCTGTTTTTTAGAGCTT TATGCTTTAAGAAATTTTTATTTTCCTGTTTTTTAGAGCTT Direct Gain 0 0.742004156112671 Functional Gain 0.742004156112671 CDK1 ENSG00000170312 intronic Human protein_coding chr10:62551890 chr10:62551890 . 0.003 0 21 hPsi_associated_SNPs_17586 0 23958962 Cocaine dependence 3e-06 GWAS_Catalog TagSNP rs2456778 GCST002142 Genome-wide association study of cocaine dependence and related traits: FAM53B identified as a risk gene.
121 chr10 71392557 71392557 1 + C T rs12020 71392557 + 71392537 71392577 41 ACATTCCAGAGCTTCTTCAACAGGGGCCATGGTGCTCCCCC ACATTCCAGAGCTTCTTCAATAGGGGCCATGGTGCTCCCCC Direct Gain 0 0.860492825508118 Functional Gain 0.860492825508118 C10orf35 ENSG00000171224 CDS Human protein_coding chr10:71392557 chr10:71392557 synonymous SNV . 0 21 hPsi_associated_SNPs_17659 0 17434096 Ischemic stroke 7.44e-05 Johnson and O'Donnell TagSNP rs12020 . A genome-wide genotyping study in patients with ischaemic stroke: initial analysis and data release.
122 chr10 80159210 80159210 1 + C T rs7900379 80159210 + 80159190 80159230 41 TTTTGTAGCAGCCAAAGGAACTCTGACTAATCTGTGGATCT TTTTGTAGCAGCCAAAGGAATTCTGACTAATCTGTGGATCT Direct Gain 0 0.540294766426086 Functional Gain 0.540294766426086 LINC00595;ZMIZ1-AS1 ENSG00000201393;ENSG00000230417 intergenic Human other chr10:80159210 chr10:80159210 . . 0 21 hPsi_associated_SNPs_17846 0 17554300 Multiple complex diseases 0.000494925 Johnson and O'Donnell TagSNP rs7900379 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
123 chr10 85974880 85974880 1 + C T rs7908753 85974880 + 85974860 85974900 41 GGCTGGAGGTCAGCGAACCTCGTGGGCTGTAGGAAAGCAAA GGCTGGAGGTCAGCGAACCTTGTGGGCTGTAGGAAAGCAAA Direct Gain 0 0.569024980068207 Functional Gain 0.569024980068207 CDHR1 ENSG00000148600 UTR3 Human protein_coding chr10:85974880 chr10:85974880 . . 0 21 hPsi_associated_SNPs_17918 1 17554300 Multiple complex diseases 0.000907519 Johnson and O'Donnell TagSNP rs7908753 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
124 chr10 96058298 96058298 1 + C T rs3765524 96058298 + 96058278 96058318 41 CAGGTATTCTCAGAAACTGACCCAGCACACCGCCTGTCAGC CAGGTATTCTCAGAAACTGATCCAGCACACCGCCTGTCAGC Direct Gain 0 0.728065013885498 Functional Gain 0.728065013885498 PLCE1 ENSG00000138193 CDS Human protein_coding chr10:96058298 chr10:96058298 nonsynonymous SNV 1.000 0 21 hPsi_associated_SNPs_18076 2 22001756 Dengue shock syndrome 3e-10 GWAS_Catalog TagSNP rs3765524 GCST001278 Genome-wide association study identifies susceptibility loci for dengue shock syndrome at MICB and PLCE1.
125 chr10 96702047 96702047 1 + C T rs1799853 96702047 + 96702027 96702067 41 GGAAGAGGAGCATTGAGGACCGTGTTCAAGAGGAAGCCCGC GGAAGAGGAGCATTGAGGACTGTGTTCAAGAGGAAGCCCGC Direct Gain 0 0.999899387359619 Functional Gain 0.999899387359619 CYP2C9 ENSG00000138109 CDS Human protein_coding chr10:96702047 chr10:96702047 nonsynonymous SNV 0.002 3 21 hPsi_associated_SNPs_18090 6 19300499 Warfarin maintenance dose 1e-31 GWAS_Catalog TagSNP rs1799853 GCST000360 A genome-wide association study confirms VKORC1, CYP2C9, and CYP4F2 as principal genetic determinants of warfarin dose.
126 chr10 101610533 101610533 1 + C T rs8187707 101610533 + 101610513 101610553 41 ACCATCGCCCACAGGCTGCACACCATCATGGACAGTGACAA ACCATCGCCCACAGGCTGCATACCATCATGGACAGTGACAA Direct Gain 0 0.998263657093048 Functional Gain 0.998263657093048 ABCC2 ENSG00000023839 CDS Human protein_coding chr10:101610533 chr10:101610533 synonymous SNV . 0 21 hPsi_associated_SNPs_18174 1 29367611 Carboplatin disposition in epthelial ovarian cancer 5e-06 GWAS_Catalog TagSNP rs8187707 GCST005351 Genome-wide association study of paclitaxel and carboplatin disposition in women with epithelial ovarian cancer.
127 chr10 104623578 104623578 1 + C T rs9527 104623578 + 104623558 104623598 41 TATCAGGCCAGCTGCAGCCTCTTGCCTTGACCTGCATTCCT TATCAGGCCAGCTGCAGCCTTTTGCCTTGACCTGCATTCCT Direct Gain 0 0.5981085896492 Functional Gain 0.5981085896492 BORCS7-ASMT ENSG00000166275 UTR3 Human protein_coding chr10:104623578 chr10:104623578 . . 0 21 hPsi_associated_SNPs_18249 0 22383894 Arsenic metabolism 3e-09 GWAS_Catalog TagSNP rs9527 GCST001421 Genome-wide association study identifies chromosome 10q24.32 variants associated with arsenic metabolism and toxicity phenotypes in Bangladesh.
128 chr10 111967555 111967555 1 + C T rs1475502 111967555 + 111967535 111967575 41 AGAGGACGAGCTCGGCGGACCCCCGCTCCTCCATGGGCAAA AGAGGACGAGCTCGGCGGACTCCCGCTCCTCCATGGGCAAA Direct Gain 0 0.947502136230469 Functional Gain 0.947502136230469 MXI1 ENSG00000119950 UTR5 Human protein_coding chr10:111967555 chr10:111967555 . . 0 21 hPsi_associated_SNPs_18290 0 30595370 Height 1e-09 GWAS_Catalog TagSNP rs1475502 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
129 chr10 130113462 130113462 1 + G T rs2799399 130113462 + 130113442 130113482 41 TCTCTCTCTCTTTAGCTAAAGATTTCCTAGATGAAAGACCT TCTCTCTCTCTTTAGCTAAATATTTCCTAGATGAAAGACCT Direct Gain 0 0.940530180931091 Functional Gain 0.940530180931091 LINC01163 ENSG00000148773;ENSG00000234640 intergenic Human other chr10:130113462 chr10:130113462 . . 0 21 hPsi_associated_SNPs_18511 0 30038396 Cognitive performance 5e-08 GWAS_Catalog TagSNP rs2799399 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
130 chr10 131265545 131265545 1 + C T rs16906252 131265545 + 131265525 131265565 41 CCGCAGGTCCTCGCGGTGCGCACCGTTTGCGACTTGGTGAG CCGCAGGTCCTCGCGGTGCGTACCGTTTGCGACTTGGTGAG Direct Gain 0 0.540904581546783 Functional Gain 0.540904581546783 MGMT ENSG00000170430 CDS Human protein_coding chr10:131265545 chr10:131265545 synonymous SNV . 0 21 hPsi_associated_SNPs_18513 1 26183928 MGMT methylation in smokers 4e-31 GWAS_Catalog TagSNP rs16906252 GCST003031 Implication of a Chromosome 15q15.2 Locus in Regulating UBR1 and Predisposing Smokers to MGMT Methylation in Lung.
131 chr11 1874221 1874221 1 + C T rs907612 1874221 + 1874201 1874241 41 CACCCTGACCCAAGCCGAGACAGGTTCCAAACCTCAACCTG CACCCTGACCCAAGCCGAGATAGGTTCCAAACCTCAACCTG Direct Gain 0 0.999954104423523 Functional Gain 0.999954104423523 LSP1 ENSG00000130592 UTR5 Human protein_coding chr11:1874221 chr11:1874221 . . 0 21 hPsi_associated_SNPs_18801 0 27863252 Monocyte count 5e-16 GWAS_Catalog TagSNP rs907612 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
132 chr11 4928866 4928866 1 + C T rs7941509 4928866 + 4928846 4928886 41 AGGGTCTTCTTGTTCAATGCCATGGGAATTTCACCTAATGC AGGGTCTTCTTGTTCAATGCTATGGGAATTTCACCTAATGC Direct Gain 0 0.675716042518616 Functional Gain 0.675716042518616 OR51A7 ENSG00000176895 CDS Human protein_coding chr11:4928866 chr11:4928866 synonymous SNV . 0 21 hPsi_associated_SNPs_18879 0 17846124 Type II Diabetes Mellitus 0.00331 Johnson and O'Donnell TagSNP rs7941509 . Identification of type 2 diabetes genes in Mexican Americans through genome-wide association studies.
133 chr11 5373251 5373251 1 + C T rs5006884 5373251 + 5373231 5373271 41 CCTACTGTCGATCCCATGTACTCTCCCATGCTTTCTGTCTA CCTACTGTCGATCCCATGTATTCTCCCATGCTTTCTGTCTA Direct Gain 0 0.946328997612 Functional Gain 0.946328997612 OR51B6 ENSG00000176239 CDS Human protein_coding chr11:5373251 chr11:5373251 nonsynonymous SNV 0.578 4 21 hPsi_associated_SNPs_18882 0 20018918 Fetal hemoglobin levels 3e-08 GWAS_Catalog TagSNP rs5006884 GCST000545 Fetal hemoglobin in sickle cell anemia: genome-wide association studies suggest a regulatory region in the 5' olfactory receptor gene cluster.
134 chr11 25101956 25101956 1 + C T rs1562263 25101956 + 25101936 25101976 41 ACAATGTTTTCAACCTTTGACTTCTTTATCTGTATGTAATC ACAATGTTTTCAACCTTTGATTTCTTTATCTGTATGTAATC Direct Gain 0 0.999515771865845 Functional Gain 0.999515771865845 LUZP2 ENSG00000187398 UTR3 Human protein_coding chr11:25101956 chr11:25101956 . . 0 21 hPsi_associated_SNPs_19151 0 30019117 Adolescent idiopathic scoliosis 2e-07 GWAS_Catalog TagSNP rs1562263 GCST006287 The coexistence of copy number variations (CNVs) and single nucleotide polymorphisms (SNPs) at a locus can result in distorted calculations of the significance in associating SNPs to disease.
135 chr11 27679916 27679916 1 + C T rs6265 27679916 + 27679896 27679936 41 ATCCAACAGCTCTTCTATCACGTGTTCGAAAGTGTCAGCCA ATCCAACAGCTCTTCTATCATGTGTTCGAAAGTGTCAGCCA Direct Gain 0 0.727416038513184 Functional Gain 0.727416038513184 BDNF ENSG00000176697 CDS Human protein_coding chr11:27679916 chr11:27679916 nonsynonymous SNV 0.982 3 21 hPsi_associated_SNPs_19171 7 28892062 Body mass index 2e-51 GWAS_Catalog TagSNP rs6265 GCST004904 Genome-wide association study identifies 112 new loci for body mass index in the Japanese population.
136 chr11 44087989 44087989 1 + G T rs2074038 44087989 + 44087969 44088009 41 GCGCCGATCACACTTCCTCTGCCTGGAAACCTGGAGCCGTC GCGCCGATCACACTTCCTCTTCCTGGAAACCTGGAGCCGTC Direct Gain 0 0.996290326118469 Functional Gain 0.996290326118469 ACCS ENSG00000110455 UTR5 Human protein_coding chr11:44087989 chr11:44087989 . . 0 21 hPsi_associated_SNPs_19280 0 26028593 IgA nephropathy 4e-09 GWAS_Catalog TagSNP rs2074038 GCST002943 Identification of new susceptibility loci for IgA nephropathy in Han Chinese.
137 chr11 45949534 45949534 1 + C T rs939105 45949534 + 45949514 45949554 41 GCACTGGTGGTGCCGGCATTCGAGACCCTGCGCTACCGCTT GCACTGGTGGTGCCGGCATTTGAGACCCTGCGCTACCGCTT Direct Gain 0 0.668542742729187 Functional Gain 0.668542742729187 LARGE2 ENSG00000165905 CDS Human protein_coding chr11:45949534 chr11:45949534 synonymous SNV . 0 21 hPsi_associated_SNPs_19327 0 30595370 Height 4e-16 GWAS_Catalog TagSNP rs939105 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
138 chr11 47270255 47270255 1 + C T rs2167079 47270255 + 47270235 47270275 41 CGAAGCGCAGACTCCGGGCCCGGGTGGGCGGCATCACCACC CGAAGCGCAGACTCCGGGCCTGGGTGGGCGGCATCACCACC Direct Gain 0 0.999961912631989 Functional Gain 0.999961912631989 ACP2 ENSG00000134575 CDS Human protein_coding chr11:47270255 chr11:47270255 nonsynonymous SNV 0.992 0 21 hPsi_associated_SNPs_19349 0 17357082 Progressive Supranuclear Palsy 0.002 Johnson and O'Donnell TagSNP rs2167079 . Identification of a novel risk locus for progressive supranuclear palsy by a pooled genomewide scan of 500,288 single-nucleotide polymorphisms.
139 chr11 48286256 48286256 1 + C T rs10838852 48286256 + 48286236 48286276 41 TGGTCACACCTCTCTTAAACCCTGTGATTTACTCCTTCAGG TGGTCACACCTCTCTTAAACTCTGTGATTTACTCCTTCAGG Direct Gain 0 0.947352468967438 Functional Gain 0.947352468967438 OR4X1 ENSG00000176567 CDS Human protein_coding chr11:48286256 chr11:48286256 nonsynonymous SNV 0.734 3 21 hPsi_associated_SNPs_19369 0 17554300 Multiple complex diseases 0.000773739 Johnson and O'Donnell TagSNP rs10838852 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
140 chr11 55136219 55136219 1 + C T rs7927370 55136219 + 55136199 55136239 41 CCCCTGTATCTTCTTGTATGCAAGGCCCAATTCTACTTTTC CCCCTGTATCTTCTTGTATGTAAGGCCCAATTCTACTTTTC Direct Gain 0 0.99998676776886 Functional Gain 0.99998676776886 OR4A15 ENSG00000181958 CDS Human protein_coding chr11:55136219 chr11:55136219 nonsynonymous SNV 0.089 0 21 hPsi_associated_SNPs_19393 0 21408207 Systemic lupus erythematosus 7e-06 GWAS_Catalog TagSNP rs7927370 GCST000996 Differential genetic associations for systemic lupus erythematosus based on anti-dsDNA autoantibody production.
141 chr11 64120451 64120451 1 + C T rs61886887 64120451 + 64120431 64120471 41 CCTGTCTGGCCTCCCCTCCCCGGCATAACTTCTCTGGCCAG CCTGTCTGGCCTCCCCTCCCTGGCATAACTTCTCTGGCCAG Direct Gain 0 0.525363922119141 Functional Gain 0.525363922119141 CCDC88B ENSG00000168071 intronic Human protein_coding chr11:64120451 chr11:64120451 . . 0 21 hPsi_associated_SNPs_19657 0 30595370 Eczema 7e-08 GWAS_Catalog TagSNP rs61886887 GCST007075 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
142 chr11 65561468 65561468 1 + C T rs644740 65561468 + 65561448 65561488 41 CCGCTGGACCCTCTCTTCTCCACCAAGCCTCTCACCTGTCT CCGCTGGACCCTCTCTTCTCTACCAAGCCTCTCACCTGTCT Direct Gain 0 0.927377104759216 Functional Gain 0.927377104759216 OVOL1 ENSG00000172818 UTR5 Human protein_coding chr11:65561468 chr11:65561468 . . 0 21 hPsi_associated_SNPs_19749 0 17554300 Multiple complex diseases 0.000581255 Johnson and O'Donnell TagSNP rs644740 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
143 chr11 75274150 75274150 1 + G T rs590121 75274150 + 75274130 75274170 41 CCACTGCCACAGGGTTCTTGGAGTAACTGCAGGGTTTAAAC CCACTGCCACAGGGTTCTTGTAGTAACTGCAGGGTTTAAAC Direct Gain 0 0.787550866603851 Functional Gain 0.787550866603851 SERPINH1 ENSG00000149257 UTR5 Human protein_coding chr11:75274150 chr11:75274150 . . 0 21 hPsi_associated_SNPs_20067 0 29212778 Coronary artery disease 2e-10 GWAS_Catalog TagSNP rs590121 GCST005196 Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease.
144 chr11 89867872 89867872 1 + C T rs1892887 89867872 + 89867852 89867892 41 GCGCGCTCTCTGTTTCTCTGCAGCCCCGAAGCTCGCGAATG GCGCGCTCTCTGTTTCTCTGTAGCCCCGAAGCTCGCGAATG Direct Gain 0 0.999114871025085 Functional Gain 0.999114871025085 NAALAD2 ENSG00000077616 UTR5 Human protein_coding chr11:89867872 chr11:89867872 . . 0 21 hPsi_associated_SNPs_20180 0 17052657 Parkinson's disease 0.000160374 Johnson and O'Donnell TagSNP rs1892887 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
145 chr11 101979372 101979372 1 + C T rs7931899 101979372 + 101979352 101979392 41 CCTGTGAAATAATCTGTGAACATGGGACAACAATGACAACT CCTGTGAAATAATCTGTGAATATGGGACAACAATGACAACT Direct Gain 0 0.995442450046539 Functional Gain 0.995442450046539 C11orf70;YAP1 ENSG00000260008 ncRNA_exonic Human lincRNA chr11:101979372 chr11:101979372 . . 0 21 hPsi_associated_SNPs_20270 0 30598549 Heel bone mineral density 1e-09 GWAS_Catalog TagSNP rs7931899 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
146 chr11 102703278 102703278 1 + A T rs646760 102703278 + 102703258 102703298 41 AGTAAAATGGAAAATGGACTATGCATTGCTCTTACCCTTGA AGTAAAATGGAAAATGGACTTTGCATTGCTCTTACCCTTGA Direct Gain 0 0.833243131637573 Functional Gain 0.833243131637573 WTAPP1 ENSG00000255282 ncRNA_exonic Human transcribed_processed_pseudogene chr11:102703278 chr11:102703278 . . 0 21 hPsi_associated_SNPs_20283 0 26634245 Post bronchodilator FEV1/FVC ratio 2e-07 GWAS_Catalog TagSNP rs646760 GCST003264 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
147 chr11 102980324 102980324 1 + C T rs17301028 102980324 + 102980304 102980344 41 ATGGCGAACGGGACTGCGGACGTTCGGAAGCTCTTCATCTT ATGGCGAACGGGACTGCGGATGTTCGGAAGCTCTTCATCTT Direct Gain 0 0.99947202205658 Functional Gain 0.99947202205658 DYNC2H1 ENSG00000187240 CDS Human protein_coding chr11:102980324 chr11:102980324 synonymous SNV . 0 21 hPsi_associated_SNPs_20285 3 17998437 Alzheimer's disease 0.000489 Johnson and O'Donnell TagSNP rs17301028 . Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.
148 chr12 3393100 3393100 1 + C T rs67551338 3393100 + 3393080 3393120 41 GGACAGGAGCCTGGGAGAGGCGGGTGGAGCGTGAAGCAGGC GGACAGGAGCCTGGGAGAGGTGGGTGGAGCGTGAAGCAGGC Direct Gain 0 0.825535655021667 Functional Gain 0.825535655021667 TSPAN9 ENSG00000011105 UTR3 Human protein_coding chr12:3393100 chr12:3393100 . . 0 21 hPsi_associated_SNPs_20845 0 28452372 Glomerular filtration rate (creatinine) 2e-09 GWAS_Catalog TagSNP rs67551338 GCST004292 1000 Genomes-based meta-analysis identifies 10 novel loci for kidney function.
149 chr12 51138862 51138862 1 + C T rs1047912 51138862 + 51138842 51138882 41 ATAGCGTGAGCAGCACATTACTAAAGCAATTACATGCATGT ATAGCGTGAGCAGCACATTATTAAAGCAATTACATGCATGT Direct Gain 0 0.972917079925537 Functional Gain 0.972917079925537 DIP2B ENSG00000066084 UTR3 Human protein_coding chr12:51138862 chr12:51138862 . . 0 21 hPsi_associated_SNPs_21391 0 30595370 Red cell distribution width 5e-35 GWAS_Catalog TagSNP rs1047912 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
150 chr12 51325429 51325429 1 + G T rs319941 51325429 + 51325409 51325449 41 TCTTGAACCCAGAAGGCGAAGGTTGCAGTGAACCGAGATCA TCTTGAACCCAGAAGGCGAATGTTGCAGTGAACCGAGATCA Direct Gain 0 0.82961505651474 Functional Gain 0.82961505651474 METTL7A ENSG00000185432 UTR3 Human protein_coding chr12:51325429 chr12:51325429 . . 0 21 hPsi_associated_SNPs_21396 0 30595370 Mean corpuscular hemoglobin 5e-08 GWAS_Catalog TagSNP rs319941 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
151 chr12 69979517 69979517 1 + C T rs2601006 69979517 + 69979497 69979537 41 GTGGACCGCAAAGCCAGCGTCTCCTTGTGCCTAGGTCTTTG GTGGACCGCAAAGCCAGCGTTTCCTTGTGCCTAGGTCTTTG Direct Gain 0 0.91865599155426 Functional Gain 0.91865599155426 CCT2 ENSG00000166226 UTR5 Human protein_coding chr12:69979517 chr12:69979517 . . 0 21 hPsi_associated_SNPs_21753 0 30220432 Urinary albumin excretion 2e-11 GWAS_Catalog TagSNP rs2601006 GCST006586 Genetic Association of Albuminuria with Cardiometabolic Disease and Blood Pressure.
152 chr12 72179446 72179446 1 + C T rs61754230 72179446 + 72179426 72179466 41 TGGTGGAGGGTGCTGTTCTTCTGGATAACTGTTCACGCCTA TGGTGGAGGGTGCTGTTCTTTTGGATAACTGTTCACGCCTA Direct Gain 0 0.997610211372375 Functional Gain 0.997610211372375 RAB21 ENSG00000080371 CDS Human protein_coding chr12:72179446 chr12:72179446 nonsynonymous SNV 0.998 4 21 hPsi_associated_SNPs_21782 0 30595370 White blood cell count 1e-10 GWAS_Catalog TagSNP rs61754230 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
153 chr13 28867268 28867268 1 + C T rs9554311 28867268 + 28867248 28867288 41 AAGAACATACCAAGAAAATACCAGTGAATTGTTGGATATGA AAGAACATACCAAGAAAATATCAGTGAATTGTTGGATATGA Direct Gain 0 0.746648490428925 Functional Gain 0.746648490428925 PAN3 ENSG00000152520 UTR3 Human protein_coding chr13:28867268 chr13:28867268 . . 0 21 hPsi_associated_SNPs_22727 0 30595370 Menarche (age at onset) 4e-10 GWAS_Catalog TagSNP rs9554311 GCST007078 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
154 chr13 29898783 29898783 1 + C T rs61999321 29898783 + 29898763 29898803 41 TGCTCAGAAAGATCAAGATACGAATAAACCTGCTGTTTCAT TGCTCAGAAAGATCAAGATATGAATAAACCTGCTGTTTCAT Direct Gain 0 0.985254883766174 Functional Gain 0.985254883766174 MTUS2 ENSG00000132938 CDS Human protein_coding chr13:29898783 chr13:29898783 nonsynonymous SNV 0.054 1 21 hPsi_associated_SNPs_22731 0 23251661 Obesity-related traits 8e-06 GWAS_Catalog TagSNP rs61999321 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
155 chr13 79155612 79155612 1 + C T rs1409005 79155612 + 79155592 79155632 41 TAATGCAGTAATCCTTAACCCTTGAACCTAACTTGTACTTA TAATGCAGTAATCCTTAACCTTTGAACCTAACTTGTACTTA Direct Gain 0 0.836737871170044 Functional Gain 0.836737871170044 RNF219-AS1 ENSG00000234377 ncRNA_exonic Human antisense chr13:79155612 chr13:79155612 . . 0 21 hPsi_associated_SNPs_22981 0 25436638 Serum thyroid-stimulating hormone levels 5e-07 GWAS_Catalog TagSNP rs1409005 GCST002707 Genetic variants associated with serum thyroid stimulating hormone (TSH) levels in European Americans and African Americans from the eMERGE Network.
156 chr13 100518634 100518634 1 + C T rs41281112 100518634 + 100518614 100518654 41 CTGGGCTGCTTAGACAGTCACGAGAAGGAGCCGCCATGGGC CTGGGCTGCTTAGACAGTCATGAGAAGGAGCCGCCATGGGC Direct Gain 0 0.557398557662964 Functional Gain 0.557398557662964 CLYBL ENSG00000125246 CDS Human protein_coding chr13:100518634 chr13:100518634 stopgain 0.101 1 21 hPsi_associated_SNPs_23055 0 22367966 Vitamin B12 levels 9e-10 GWAS_Catalog TagSNP rs41281112 GCST001424 Genome-wide association study identifies novel loci associated with serum level of vitamin B12 in Chinese men.
157 chr13 100545822 100545822 1 + C T rs12584825 100545822 + 100545802 100545842 41 TGTCCTTCCTATGGGCAGCCCTCACCCCAATCTAACTAACC TGTCCTTCCTATGGGCAGCCTTCACCCCAATCTAACTAACC Direct Gain 0 0.981923699378967 Functional Gain 0.981923699378967 LOC101927437 ENSG00000125246 UTR3 Human protein_coding chr13:100545822 chr13:100545822 . . 0 21 hPsi_associated_SNPs_23060 0 17554300 Multiple complex diseases 5.09e-05 Johnson and O'Donnell TagSNP rs12584825 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
158 chr14 23568494 23568494 1 + C T rs9972278 23568494 + 23568474 23568514 41 TCATGTTCTGGGCAACATCACACCTCCCTTATTCCTCTAAC TCATGTTCTGGGCAACATCATACCTCCCTTATTCCTCTAAC Direct Gain 0 0.97886598110199 Functional Gain 0.97886598110199 C14orf119 ENSG00000179933 UTR3 Human protein_coding chr14:23568494 chr14:23568494 . . 0 21 hPsi_associated_SNPs_23344 0 30019117 Adolescent idiopathic scoliosis 5e-06 GWAS_Catalog TagSNP rs9972278 GCST006287 The coexistence of copy number variations (CNVs) and single nucleotide polymorphisms (SNPs) at a locus can result in distorted calculations of the significance in associating SNPs to disease.
159 chr14 23848311 23848311 1 + C T rs723840 23848311 + 23848291 23848331 41 GCAGCTGTGACCTCCCGGGACGGAGCTGCCATTGCTGCTTT GCAGCTGTGACCTCCCGGGATGGAGCTGCCATTGCTGCTTT Direct Gain 0 0.77411413192749 Functional Gain 0.77411413192749 CMTM5 ENSG00000166091 CDS Human protein_coding chr14:23848311 chr14:23848311 synonymous SNV . 0 21 hPsi_associated_SNPs_23357 0 31085060 Emotional lability in attention deficit hyperactivity disorder 4e-06 GWAS_Catalog TagSNP rs723840 GCST007880 Genome-wide analysis of emotional lability in adult attention deficit hyperactivity disorder (ADHD).
160 chr14 38296497 38296497 1 + A T rs17107176 38296497 + 38296477 38296517 41 AAGACTACCAAGATGCAATTACTCTAAACCCCAAGTACTCG AAGACTACCAAGATGCAATTTCTCTAAACCCCAAGTACTCG Direct Gain 0 0.988548159599304 Functional Gain 0.988548159599304 TTC6 ENSG00000139865 CDS Human protein_coding chr14:38296497 chr14:38296497 nonsynonymous SNV 0.942 0 21 hPsi_associated_SNPs_23509 0 17554300 Multiple complex diseases 0.000434632 Johnson and O'Donnell TagSNP rs17107176 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
161 chr14 55227152 55227152 1 + G T rs149416017 55227152 + 55227132 55227172 41 GCAGCTGCGATGGGGAGCTGGCCGTCGCCCCCCTGCCAGAG GCAGCTGCGATGGGGAGCTGTCCGTCGCCCCCCTGCCAGAG Direct Gain 0 0.984370827674866 Functional Gain 0.984370827674866 SAMD4A ENSG00000020577 CDS Human protein_coding chr14:55227152 chr14:55227152 nonsynonymous SNV 0.876 1 21 hPsi_associated_SNPs_23570 0 28521775 Subclinical trait of interstitial lung disease (basilar percentage of high attenuation areas on CT scan) 3e-08 GWAS_Catalog TagSNP rs149416017 GCST004526 Genome-wide association study of subclinical interstitial lung disease in MESA.
162 chr14 81610942 81610942 1 + C T rs7144481 81610942 + 81610922 81610962 41 GGTGAAATCAAAATAATCTACACTATCTAGAAGACTTTCTT GGTGAAATCAAAATAATCTATACTATCTAGAAGACTTTCTT Direct Gain 0 0.935471653938293 Functional Gain 0.935471653938293 TSHR ENSG00000258999 ncRNA_intronic Human antisense chr14:81610942 chr14:81610942 . . 0 21 hPsi_associated_SNPs_23925 2 25729143 Maximal oxygen uptake response 9e-08 GWAS_Catalog TagSNP rs7144481 GCST002664 Genome-wide association study identifies three novel genetic markers associated with elite endurance performance.
163 chr14 96708782 96708782 1 + A T rs2069590 96708782 + 96708762 96708802 41 CTACGTACATGTGAGGCATCATTACGCAGACGTAACTGGGA CTACGTACATGTGAGGCATCTTTACGCAGACGTAACTGGGA Direct Gain 0 0.999994397163391 Functional Gain 0.999994397163391 BDKRB2 ENSG00000168398 UTR3 Human protein_coding chr14:96708782 chr14:96708782 . . 0 21 hPsi_associated_SNPs_24064 0 22179738 Gout 1e-07 GWAS_Catalog TagSNP rs2069590 GCST001356 Gout and type 2 diabetes have a mutual inter-dependent effect on genetic risk factors and higher incidences.
164 chr14 103566785 103566785 1 + C T rs2297067 103566785 + 103566765 103566805 41 AGGAAGATACGGGCCTGTTCCGGCGAAGCTCCTGCTCCCTG AGGAAGATACGGGCCTGTTCTGGCGAAGCTCCTGCTCCCTG Direct Gain 0 0.900357306003571 Functional Gain 0.900357306003571 EXOC3L4 ENSG00000205436 CDS Human protein_coding chr14:103566785 chr14:103566785 nonsynonymous SNV 0.000 2 21 hPsi_associated_SNPs_24184 0 22139419 Platelet count 2e-10 GWAS_Catalog TagSNP rs2297067 GCST001337 New gene functions in megakaryopoiesis and platelet formation.
165 chr15 25364795 25364795 1 + C T rs691 25364795 + 25364775 25364815 41 TAACACATTTTTCTGCAAATCACCTCTTTCATTTAACAGCC TAACACATTTTTCTGCAAATTACCTCTTTCATTTAACAGCC Direct Gain 0 0.918386697769165 Functional Gain 0.918386697769165 IPW ENSG00000224078 ncRNA_exonic Human processed_transcript chr15:25364795 chr15:25364795 . . 0 21 hPsi_associated_SNPs_24418 0 17463246 Multiple continuous traits in DGI samples 0.0009818 Johnson and O'Donnell TagSNP rs691 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
166 chr15 33954652 33954652 1 + C T rs4780144 33954652 + 33954632 33954672 41 CCAGCACCACCAGGAATATCCGCCTCTTCCCGGACGAGTCC CCAGCACCACCAGGAATATCTGCCTCTTCCCGGACGAGTCC Direct Gain 0 0.999800682067871 Functional Gain 0.999800682067871 RYR3 ENSG00000198838 CDS Human protein_coding chr15:33954652 chr15:33954652 nonsynonymous SNV 0.889 1 21 hPsi_associated_SNPs_24531 0 25646338 Trans fatty acid levels 2e-06 GWAS_Catalog TagSNP rs4780144 GCST002721 Genetic loci associated with circulating phospholipid trans fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium.
167 chr15 38991164 38991164 1 + C T rs17654449 38991164 + 38991144 38991184 41 TGTAATAACCTGGACATTGCCAAGACAGCTTCCTCAGGGCT TGTAATAACCTGGACATTGCTAAGACAGCTTCCTCAGGGCT Direct Gain 0 0.999978303909302 Functional Gain 0.999978303909302 C15orf53 ENSG00000175779 UTR3 Human protein_coding chr15:38991164 chr15:38991164 . . 0 21 hPsi_associated_SNPs_24553 0 17554300 Multiple complex diseases 0.000473201 Johnson and O'Donnell TagSNP rs17654449 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
168 chr15 44720011 44720011 1 + C T rs116908763 44720011 + 44719991 44720031 41 GCCGCCGCTGCTTCCAATCTCAGTCCTCCTCCTCTTCCAGG GCCGCCGCTGCTTCCAATCTTAGTCCTCCTCCTCTTCCAGG Direct Gain 0 0.578994154930115 Functional Gain 0.578994154930115 CTDSPL2 ENSG00000137770 UTR5 Human protein_coding chr15:44720011 chr15:44720011 . . 0 21 hPsi_associated_SNPs_24734 0 27863252 Mean corpuscular hemoglobin 2e-10 GWAS_Catalog TagSNP rs116908763 GCST004630 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
169 chr15 74244344 74244344 1 + C T rs3522 74244344 + 74244324 74244364 41 AAAACCACAGGGATTCCGGACGCCAGACCCCATTTTATACT AAAACCACAGGGATTCCGGATGCCAGACCCCATTTTATACT Direct Gain 0 0.977765321731567 Functional Gain 0.977765321731567 LOXL1 ENSG00000129038 UTR3 Human protein_coding chr15:74244344 chr15:74244344 . . 0 21 hPsi_associated_SNPs_25089 0 17690259 Glaucoma 0.0027 Johnson and O'Donnell TagSNP rs3522 . Common sequence variants in the LOXL1 gene confer susceptibility to exfoliation glaucoma.
170 chr15 78886198 78886198 1 + C T rs8192482 78886198 + 78886178 78886218 41 TTCGAGACCAGCCTGACCAACGTGGAGAAACCCCGTCTCTA TTCGAGACCAGCCTGACCAATGTGGAGAAACCCCGTCTCTA Direct Gain 0 0.993011295795441 Functional Gain 0.993011295795441 CHRNA5 ENSG00000169684 UTR3 Human protein_coding chr15:78886198 chr15:78886198 . . 0 21 hPsi_associated_SNPs_25200 0 29767774 Current cigarettes per day in chronic obstructive pulmonary disease 2e-15 GWAS_Catalog TagSNP rs8192482 GCST006042 Common and rare variants genetic association analysis of cigarettes per day among ever smokers in COPD cases and controls.
171 chr15 85188839 85188839 1 + C T rs11073619 85188839 + 85188819 85188859 41 GGGGGTCAAGAAGACAAAGACGCCCATCTGAGCCAAGGCTG GGGGGTCAAGAAGACAAAGATGCCCATCTGAGCCAAGGCTG Direct Gain 0 0.55471396446228 Functional Gain 0.55471396446228 WDR73 ENSG00000177082 CDS Human protein_coding chr15:85188839 chr15:85188839 nonsynonymous SNV 0.440 0 21 hPsi_associated_SNPs_25309 0 27089181 Positive affect 1e-06 GWAS_Catalog TagSNP rs11073619 GCST003768 Genetic variants associated with subjective well-being, depressive symptoms, and neuroticism identified through genome-wide analyses.
172 chr15 86838497 86838497 1 + C T rs9630451 86838497 + 86838477 86838517 41 CTGCTCCAGACTCATCTTGACATCCTGGAAAAGAGTGTCAA CTGCTCCAGACTCATCTTGATATCCTGGAAAAGAGTGTCAA Direct Gain 0 0.999218940734863 Functional Gain 0.999218940734863 AGBL1 ENSG00000166748 CDS Human other chr15:86838497 chr15:86838497 synonymous SNV . 0 21 hPsi_associated_SNPs_25354 0 17554300 Multiple complex diseases 0.000209188 Johnson and O'Donnell TagSNP rs9630451 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
173 chr15 89388905 89388905 1 + C T rs16942341 89388905 + 89388885 89388925 41 GTAAAGCCCATCTTCGAGGTCTCCCCCAGTCCCCTGGAACC GTAAAGCCCATCTTCGAGGTTTCCCCCAGTCCCCTGGAACC Direct Gain 0 0.98761785030365 Functional Gain 0.98761785030365 ACAN ENSG00000157766 CDS Human protein_coding chr15:89388905 chr15:89388905 synonymous SNV . 0 21 hPsi_associated_SNPs_25371 0 20881960 Height 4e-27 GWAS_Catalog TagSNP rs16942341 GCST000817 Hundreds of variants clustered in genomic loci and biological pathways affect human height.
174 chr15 89398105 89398105 1 + C T rs2351491 89398105 + 89398085 89398125 41 ATCCTTCCTACTTGGCCTCCCACTGGCGCAGCAACAGAGGA ATCCTTCCTACTTGGCCTCCTACTGGCGCAGCAACAGAGGA Direct Gain 0 0.964530467987061 Functional Gain 0.964530467987061 ACAN ENSG00000157766 CDS Human protein_coding chr15:89398105 chr15:89398105 synonymous SNV . 0 21 hPsi_associated_SNPs_25377 0 21998595 Height 2e-09 GWAS_Catalog TagSNP rs2351491 GCST001263 Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry.
175 chr15 99504843 99504843 1 + C T rs2654980 99504843 + 99504823 99504863 41 CCTTCTGCCAGCAGCTCACACTGCTTGAAGTCATATGAACC CCTTCTGCCAGCAGCTCACATTGCTTGAAGTCATATGAACC Direct Gain 0 0.589109838008881 Functional Gain 0.589109838008881 IGF1R ENSG00000259475 ncRNA_intronic Human antisense chr15:99504843 chr15:99504843 . . 0 21 hPsi_associated_SNPs_25552 1 30595370 Waist-hip ratio 6e-10 GWAS_Catalog TagSNP rs2654980 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
176 chr16 3584179 3584179 1 + C T rs17794023 3584179 + 3584159 3584199 41 CAGCAATAATGATGGATTGTCGGATCAGGGCTCATGGTGTT CAGCAATAATGATGGATTGTTGGATCAGGGCTCATGGTGTT Direct Gain 0 0.669153213500977 Functional Gain 0.669153213500977 CLUAP1 ENSG00000103351 UTR3 Human protein_coding chr16:3584179 chr16:3584179 . . 0 21 hPsi_associated_SNPs_26011 0 29959729 Cerebrospinal fluid α-synuclein levels 1e-08 GWAS_Catalog TagSNP rs17794023 GCST006279 A Genome-Wide Association Study of α-Synuclein Levels in Cerebrospinal Fluid.
177 chr16 16142079 16142079 1 + G T rs60782127 16142079 + 16142059 16142099 41 ATGTCTGTGGACGCTCAGAGGTTCATGGACTTGGCCACGTA ATGTCTGTGGACGCTCAGAGTTTCATGGACTTGGCCACGTA Direct Gain 0 0.999657034873962 Functional Gain 0.999657034873962 ABCC1 ENSG00000103222 CDS Human protein_coding chr16:16142079 chr16:16142079 nonsynonymous SNV 0.994 5 21 hPsi_associated_SNPs_26213 0 30595370 Height 5e-17 GWAS_Catalog TagSNP rs60782127 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
178 chr16 28875204 28875204 1 + A T rs11864750 28875204 + 28875184 28875224 41 CGCGTAGTGGGTGGGGGCGCAGGGAGCGGGAGCCGCCGCCG CGCGTAGTGGGTGGGGGCGCTGGGAGCGGGAGCCGCCGCCG Direct Gain 0 0.599777102470398 Functional Gain 0.599777102470398 SH2B1 ENSG00000178188 UTR5 Human protein_coding chr16:28875204 chr16:28875204 . . 0 21 hPsi_associated_SNPs_26413 0 30038396 Highest math class taken (MTAG) 7e-37 GWAS_Catalog TagSNP rs11864750 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
179 chr16 29820480 29820480 1 + C T rs34286592 29820480 + 29820460 29820500 41 CGGGTAGCAGAGAAAGCTGCCTTCAGTCAGACTCACCGGTT CGGGTAGCAGAGAAAGCTGCTTTCAGTCAGACTCACCGGTT Direct Gain 0 0.970686912536621 Functional Gain 0.970686912536621 MAZ ENSG00000238045;ENSG00000261962 ncRNA_intronic Human other chr16:29820480 chr16:29820480 . . 0 21 hPsi_associated_SNPs_26463 0 27386562 Multiple sclerosis 5e-07 GWAS_Catalog TagSNP rs34286592 GCST003566 Novel multiple sclerosis susceptibility loci implicated in epigenetic regulation.
180 chr16 30785824 30785824 1 + C T rs11642862 30785824 + 30785804 30785844 41 GAAGGCTCGCTCCCTGCCTACTGGCTCACAAATGAGGACCA GAAGGCTCGCTCCCTGCCTATTGGCTCACAAATGAGGACCA Direct Gain 0 0.948983192443848 Functional Gain 0.948983192443848 RNF40 ENSG00000103549 UTR3 Human protein_coding chr16:30785824 chr16:30785824 . . 0 21 hPsi_associated_SNPs_26518 0 28928442 Tonsillectomy 2e-06 GWAS_Catalog TagSNP rs11642862 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
181 chr16 50668077 50668077 1 + G T rs117372389 50668077 + 50668057 50668097 41 GAGCACCCTTACTTGGCCCGGCTTCCAGAGACCCTCGAAAT GAGCACCCTTACTTGGCCCGTCTTCCAGAGACCCTCGAAAT Direct Gain 0 0.847837150096893 Functional Gain 0.847837150096893 NKD1 ENSG00000140807 UTR3 Human protein_coding chr16:50668077 chr16:50668077 . . 0 21 hPsi_associated_SNPs_26603 0 26301688 Pediatric autoimmune diseases 8e-11 GWAS_Catalog TagSNP rs117372389 GCST003097 Meta-analysis of shared genetic architecture across ten pediatric autoimmune diseases.
182 chr16 50705254 50705254 1 + C T rs59302410 50705254 + 50705234 50705274 41 ATTCAGCCCTAAAACATGGGCGAGTGCCCGCTTGCAGTTCA ATTCAGCCCTAAAACATGGGTGAGTGCCCGCTTGCAGTTCA Direct Gain 0 0.833615064620972 Functional Gain 0.833615064620972 LOC101927272 ENSG00000260249 ncRNA_exonic Human antisense chr16:50705254 chr16:50705254 . . 0 21 hPsi_associated_SNPs_26610 0 30048462 Heel bone mineral density 2e-19 GWAS_Catalog TagSNP rs59302410 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
183 chr16 50819910 50819910 1 + C T rs2111435 50819910 + 50819890 50819930 41 AGTAAACTTATGGTAGCCGCCAAGTTCTCCTCTGAAGCCAT AGTAAACTTATGGTAGCCGCTAAGTTCTCCTCTGAAGCCAT Direct Gain 0 0.501437783241272 Functional Gain 0.501437783241272 CYLD ENSG00000260616 ncRNA_intronic Human antisense chr16:50819910 chr16:50819910 . . 0 21 hPsi_associated_SNPs_26614 0 17804789 Crohn's disease 2.6e-05 Johnson and O'Donnell TagSNP rs2111435 . Genome-wide association study for Crohn's disease in the Quebec Founder Population identifies multiple validated disease loci.
184 chr16 67572130 67572130 1 + C T rs567068501 67572130 + 67572110 67572150 41 GGGGCCGAGCCGAGGCCACGCTGAGTCCGAGGCCGAGTCGC GGGGCCGAGCCGAGGCCACGTTGAGTCCGAGGCCGAGTCGC Direct Gain 0 0.991590738296509 Functional Gain 0.991590738296509 RIPOR1 ENSG00000039523 UTR5 Human protein_coding chr16:67572130 chr16:67572130 . . 0 21 hPsi_associated_SNPs_26821 0 30598549 Heel bone mineral density 5e-15 GWAS_Catalog TagSNP rs567068501 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
185 chr16 87678576 87678576 1 + C T rs34975147 87678576 + 87678556 87678596 41 ATCCGCGAGAAGGTGGACCGCGCCGTTGAGGCCGCTGAGCG ATCCGCGAGAAGGTGGACCGTGCCGTTGAGGCCGCTGAGCG Direct Gain 0 0.999428987503052 Functional Gain 0.999428987503052 JPH3 ENSG00000154118 CDS Human protein_coding chr16:87678576 chr16:87678576 synonymous SNV . 0 21 hPsi_associated_SNPs_27166 0 24322204 Bipolar disorder (body mass index interaction) 5e-06 GWAS_Catalog TagSNP rs34975147 GCST002306 Genome-wide association study of bipolar disorder accounting for effect of body mass index identifies a new risk allele in TCF7L2.
186 chr16 89985844 89985844 1 + G T rs1805005 89985844 + 89985824 89985864 41 TGGTGGAGAACGCGCTGGTGGTGGCCACCATCGCCAAGAAC TGGTGGAGAACGCGCTGGTGTTGGCCACCATCGCCAAGAAC Direct Gain 0 0.985197901725769 Functional Gain 0.985197901725769 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89985844 chr16:89985844 nonsynonymous SNV 0.718 3 21 hPsi_associated_SNPs_27332 3 30531825 Red vs. brown/black hair color 3e-243 GWAS_Catalog TagSNP rs1805005 GCST006986 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
187 chr17 5288179 5288179 1 + A T rs10792 5288179 + 5288159 5288199 41 TACAGGGGATTTTATTAATTATAAAATGCAATCAATTTAAA TACAGGGGATTTTATTAATTTTAAAATGCAATCAATTTAAA Direct Gain 0 0.972716927528381 Functional Gain 0.972716927528381 NUP88;RABEP1 ENSG00000029725 UTR3 Human protein_coding chr17:5288179 chr17:5288179 . . 0 21 hPsi_associated_SNPs_27541 0 30595370 Body mass index 2e-12 GWAS_Catalog TagSNP rs10792 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
188 chr17 6683878 6683878 1 + C T rs1509123 6683878 + 6683858 6683898 41 ACAATCTTGTGTCCCTGAACCTCAACTACAACTGTATCTCC ACAATCTTGTGTCCCTGAACTTCAACTACAACTGTATCTCC Direct Gain 0 0.691601395606995 Functional Gain 0.691601395606995 FBXO39 ENSG00000177294 CDS Human protein_coding chr17:6683878 chr17:6683878 nonsynonymous SNV 0.915 2 21 hPsi_associated_SNPs_27575 0 24816252 Blood metabolite levels 5e-09 GWAS_Catalog TagSNP rs1509123 GCST002443 An atlas of genetic influences on human blood metabolites.
189 chr17 7417640 7417640 1 + C T rs8753 7417640 + 7417620 7417660 41 GCAGAGCTCCCGGTGAACTTCTGGATCCCGTTTCTGATGCA GCAGAGCTCCCGGTGAACTTTTGGATCCCGTTTCTGATGCA Direct Gain 0 0.999808967113495 Functional Gain 0.999808967113495 POLR2A ENSG00000181222 UTR3 Human protein_coding chr17:7417640 chr17:7417640 . . 0 21 hPsi_associated_SNPs_27621 0 26424050 Non-glioblastoma glioma 8e-18 GWAS_Catalog TagSNP rs8753 GCST003227 Genome-wide association study identifies multiple susceptibility loci for glioma.
190 chr17 7417663 7417663 1 + C T rs6761 7417663 + 7417643 7417683 41 GATCCCGTTTCTGATGCAGACTCTTGTCTTGTTCTCCACTT GATCCCGTTTCTGATGCAGATTCTTGTCTTGTTCTCCACTT Direct Gain 0 0.973456263542175 Functional Gain 0.973456263542175 POLR2A ENSG00000181222 UTR3 Human protein_coding chr17:7417663 chr17:7417663 . . 0 21 hPsi_associated_SNPs_27622 0 18464913 Protein quantitative trait loci 3e-07 GWAS_Catalog TagSNP rs6761 GCST000189 A genome-wide association study identifies protein quantitative trait loci (pQTLs).
191 chr17 7554772 7554772 1 + C T rs1642762 7554772 + 7554752 7554792 41 GGGTGTGTGGAGGGCTTCAGCGCGCGGCGCCCCCGCTTCTC GGGTGTGTGGAGGGCTTCAGTGCGCGGCGCCCCCGCTTCTC Direct Gain 0 0.995305001735687 Functional Gain 0.995305001735687 ATP1B2 ENSG00000129244 UTR5 Human protein_coding chr17:7554772 chr17:7554772 . . 0 21 hPsi_associated_SNPs_27642 0 29875488 Blood protein levels 2e-29 GWAS_Catalog TagSNP rs1642762 GCST005806 Genomic atlas of the human plasma proteome.
192 chr17 8157310 8157310 1 + C T rs9891699 8157310 + 8157290 8157330 41 CTGGCCATGAGGGGGCAGCCCCTGGACACACTCGGAGGAAA CTGGCCATGAGGGGGCAGCCTCTGGACACACTCGGAGGAAA Direct Gain 0 0.874104499816895 Functional Gain 0.874104499816895 PFAS ENSG00000178921 CDS Human protein_coding chr17:8157310 chr17:8157310 nonsynonymous SNV 0.213 0 21 hPsi_associated_SNPs_27703 0 30595370 Red blood cell count 4e-18 GWAS_Catalog TagSNP rs9891699 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
193 chr17 8161149 8161149 1 + C T rs4791641 8161149 + 8161129 8161169 41 CAATCTGCCCTGGGAGGATCCAAGCTTCCAGTATCCTGGGA CAATCTGCCCTGGGAGGATCTAAGCTTCCAGTATCCTGGGA Direct Gain 0 0.999787330627441 Functional Gain 0.999787330627441 PFAS ENSG00000178921 CDS Human protein_coding chr17:8161149 chr17:8161149 nonsynonymous SNV 0.999 0 21 hPsi_associated_SNPs_27706 0 27863252 Red blood cell count 5e-11 GWAS_Catalog TagSNP rs4791641 GCST004601 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
194 chr17 18923681 18923681 1 + C T rs117355297 18923681 + 18923661 18923701 41 CACGCCTTCTGGGCCCGTGTCTGTGGCTTCAATGCCATCCT CACGCCTTCTGGGCCCGTGTTTGTGGCTTCAATGCCATCCT Direct Gain 0 0.949126780033112 Functional Gain 0.949126780033112 SLC5A10 ENSG00000154025 CDS Human protein_coding chr17:18923681 chr17:18923681 synonymous SNV . 0 21 hPsi_associated_SNPs_27923 0 28588231 1,5-anhydroglucitol levels 2e-17 GWAS_Catalog TagSNP rs117355297 GCST004643 Genome-wide association study of 1,5-anhydroglucitol identifies novel genetic loci linked to glucose metabolism.
195 chr17 33331575 33331575 1 + C T rs1052536 33331575 + 33331555 33331595 41 TACTCTCCTTTACCATACTACTGGACTGGACTCAGGCTGGA TACTCTCCTTTACCATACTATTGGACTGGACTCAGGCTGGA Direct Gain 0 0.999077558517456 Functional Gain 0.999077558517456 LIG3 ENSG00000005156 UTR3 Human protein_coding chr17:33331575 chr17:33331575 . . 0 21 hPsi_associated_SNPs_28160 0 24952745 QT interval 6e-25 GWAS_Catalog TagSNP rs1052536 GCST002500 Genetic association study of QT interval highlights role for calcium signaling pathways in myocardial repolarization.
196 chr17 38240216 38240216 1 + C T rs2230701 38240216 + 38240196 38240236 41 CGCTTCAAGAAGTGCATCGCCGTGGGCATGGCCATGGACTG CGCTTCAAGAAGTGCATCGCTGTGGGCATGGCCATGGACTG Direct Gain 0 0.848485767841339 Functional Gain 0.848485767841339 THRA ENSG00000126351 CDS Human protein_coding chr17:38240216 chr17:38240216 synonymous SNV . 0 21 hPsi_associated_SNPs_28291 1 30108127 Body mass index 2e-07 GWAS_Catalog TagSNP rs2230701 GCST006368 A Large Multi-ethnic Genome-Wide Association Study of Adult Body Mass Index Identifies Novel Loci.
197 chr17 40913366 40913366 1 + C T rs9892728 40913366 + 40913346 40913386 41 GCAGCGCTCCGCCTCCTCCTCCTGCTGGGCGGTGAGCGCGG GCAGCGCTCCGCCTCCTCCTTCTGCTGGGCGGTGAGCGCGG Direct Gain 0 0.991718530654907 Functional Gain 0.991718530654907 RAMP2 ENSG00000131477 CDS Human protein_coding chr17:40913366 chr17:40913366 synonymous SNV . 0 21 hPsi_associated_SNPs_28365 0 30718926 Type 2 diabetes 4e-08 GWAS_Catalog TagSNP rs9892728 GCST007847 Identification of 28 new susceptibility loci for type 2 diabetes in the Japanese population.
198 chr17 42637488 42637488 1 + C T rs4792948 42637488 + 42637468 42637508 41 CTGCAGGCTGGAAGATCTTTCTCCTGTCTGGCTTCTCTTCT CTGCAGGCTGGAAGATCTTTTTCCTGTCTGGCTTCTCTTCT Direct Gain 0 0.846842050552368 Functional Gain 0.846842050552368 FZD2 ENSG00000180340 downstream Human protein_coding chr17:42637488 chr17:42637488 . . 0 21 hPsi_associated_SNPs_28439 0 17486107 Bipolar disorder 0.0054 Johnson and O'Donnell TagSNP rs4792948 . A genome-wide association study implicates diacylglycerol kinase eta (DGKH) and several other genes in the etiology of bipolar disorder.
199 chr17 47000251 47000251 1 + C T rs1058018 47000251 + 47000231 47000271 41 CTGGAGTATTACGACTTCTACGAGGTGGCCTGCAAAGATCG CTGGAGTATTACGACTTCTATGAGGTGGCCTGCAAAGATCG Direct Gain 0 0.837828934192657 Functional Gain 0.837828934192657 UBE2Z ENSG00000159202 CDS Human protein_coding chr17:47000251 chr17:47000251 synonymous SNV . 0 21 hPsi_associated_SNPs_28556 0 27362418 Type 2 diabetes 3e-08 GWAS_Catalog TagSNP rs1058018 GCST005716 A Powerful Procedure for Pathway-Based Meta-analysis Using Summary Statistics Identifies 43 Pathways Associated with Type II Diabetes in European Populations.
200 chr17 59483766 59483766 1 + C T rs8068318 59483766 + 59483746 59483786 41 AGGACAAGGCTGGTCTTTCCCCTACCTTGAGTTCCCAGCAC AGGACAAGGCTGGTCTTTCCTCTACCTTGAGTTCCCAGCAC Direct Gain 0 0.760081768035889 Functional Gain 0.760081768035889 TBX2 ENSG00000267280 ncRNA_intronic Human antisense chr17:59483766 chr17:59483766 . . 0 21 hPsi_associated_SNPs_28736 0 27618447 Diastolic blood pressure 3e-18 GWAS_Catalog TagSNP rs8068318 GCST006020 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
201 chr17 59485393 59485393 1 + C T rs2240736 59485393 + 59485373 59485413 41 CAGGCAAGATGTCTAACCCTCGTCTTGTTCTGTTTCTTCCA CAGGCAAGATGTCTAACCCTTGTCTTGTTCTGTTTCTTCCA Direct Gain 0 0.92480343580246 Functional Gain 0.92480343580246 TBX2 ENSG00000267280 ncRNA_intronic Human antisense chr17:59485393 chr17:59485393 . . 0 21 hPsi_associated_SNPs_28739 0 28739976 Systolic blood pressure 4e-06 GWAS_Catalog TagSNP rs2240736 GCST004776 Novel Blood Pressure Locus and Gene Discovery Using Genome-Wide Association Study and Expression Data Sets From Blood and the Kidney.
202 chr17 61667008 61667008 1 + C T rs72845888 61667008 + 61666988 61667028 41 GTGTGTTTAACAAATTTTAACTTTGTATATTTGTTATCTAT GTGTGTTTAACAAATTTTAATTTTGTATATTTGTTATCTAT Direct Gain 0 0.918178081512451 Functional Gain 0.918178081512451 DCAF7 ENSG00000136485 UTR3 Human protein_coding chr17:61667008 chr17:61667008 . . 0 21 hPsi_associated_SNPs_28795 0 30595370 Body mass index 5e-11 GWAS_Catalog TagSNP rs72845888 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
203 chr17 73519413 73519413 1 + C T rs8064529 73519413 + 73519393 73519433 41 ACACCTTCCTGATGGAGGTGCCCGGTAAGTTTCCAAGCAGT ACACCTTCCTGATGGAGGTGTCCGGTAAGTTTCCAAGCAGT Direct Gain 0 0.693381011486053 Functional Gain 0.693381011486053 TSEN54 ENSG00000182173 CDS Human protein_coding chr17:73519413 chr17:73519413 nonsynonymous SNV 0.866 0 21 hPsi_associated_SNPs_28983 2 30595370 Lung function (FEV1/FVC) 1e-09 GWAS_Catalog TagSNP rs8064529 GCST007080 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
204 chr17 79682051 79682051 1 + C T rs3204270 79682051 + 79682031 79682071 41 GCGCTGCGGGTGGTGCGTACCGACGGCATCCTGGCACTCTA GCGCTGCGGGTGGTGCGTACTGACGGCATCCTGGCACTCTA Direct Gain 0 0.938751578330994 Functional Gain 0.938751578330994 SLC25A10 ENSG00000183048;ENSG00000262660 CDS Human other chr17:79682051 chr17:79682051 stopgain . 0 21 hPsi_associated_SNPs_29339 0 23259602 Dental caries 5e-06 GWAS_Catalog TagSNP rs3204270 GCST001786 Genome-wide association scan of dental caries in the permanent dentition.
205 chr18 28711519 28711519 1 + C T rs1789072 28711519 + 28711499 28711539 41 GATTTATAACTAGCATTTAACTTCCATGTAATATGACCTCA GATTTATAACTAGCATTTAATTTCCATGTAATATGACCTCA Direct Gain 0 0.770684599876404 Functional Gain 0.770684599876404 DSCAS ENSG00000263698 ncRNA_exonic Human antisense chr18:28711519 chr18:28711519 . . 0 21 hPsi_associated_SNPs_29656 0 17554300 Multiple complex diseases 0.000739965 Johnson and O'Donnell TagSNP rs1789072 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
206 chr18 43845269 43845269 1 + C T rs3744858 43845269 + 43845249 43845289 41 TAATGAATGTTTTTGCATGACCTGTTCTTATGTTAACCACA TAATGAATGTTTTTGCATGATCTGTTCTTATGTTAACCACA Direct Gain 0 0.899221062660217 Functional Gain 0.899221062660217 C18orf25 ENSG00000152242 UTR3 Human protein_coding chr18:43845269 chr18:43845269 . . 0 21 hPsi_associated_SNPs_29745 0 27863252 White blood cell count 5e-10 GWAS_Catalog TagSNP rs3744858 GCST004610 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
207 chr19 11350488 11350488 1 + C T rs2278426 11350488 + 11350468 11350508 41 TGTACAGGACCACGGAGGGACGGCTGACAAAGGCCAGGAAC TGTACAGGACCACGGAGGGATGGCTGACAAAGGCCAGGAAC Direct Gain 0 0.564989149570465 Functional Gain 0.564989149570465 ANGPTL8 ENSG00000130173 CDS Human protein_coding chr19:11350488 chr19:11350488 nonsynonymous SNV 0.526 2 21 hPsi_associated_SNPs_30610 0 23505323 HDL cholesterol 3e-09 GWAS_Catalog TagSNP rs2278426 GCST001904 Genomic study in Mexicans identifies a new locus for triglycerides and refines European lipid loci.
208 chr19 12061384 12061384 1 + C T rs279261 12061384 + 12061364 12061404 41 GAAAGCCTTCAGATGTGCCTCGCACCTTCAACGGCATGGAA GAAAGCCTTCAGATGTGCCTTGCACCTTCAACGGCATGGAA Direct Gain 0 0.679464042186737 Functional Gain 0.679464042186737 ZNF700 ENSG00000267274 ncRNA_intronic Human sense_overlapping chr19:12061384 chr19:12061384 . . 0 21 hPsi_associated_SNPs_30644 0 30019117 Adolescent idiopathic scoliosis 5e-06 GWAS_Catalog TagSNP rs279261 GCST006287 The coexistence of copy number variations (CNVs) and single nucleotide polymorphisms (SNPs) at a locus can result in distorted calculations of the significance in associating SNPs to disease.
209 chr19 21666210 21666210 1 + C T rs2562456 21666210 + 21666190 21666230 41 TTTGAGGCTCTGGCCGATTTCTTTTCCCAAGTCCCCATGGA TTTGAGGCTCTGGCCGATTTTTTTTCCCAAGTCCCCATGGA Direct Gain 0 0.760659456253052 Functional Gain 0.760659456253052 LINC00664 ENSG00000268658 ncRNA_exonic Human lincRNA chr19:21666210 chr19:21666210 . . 0 21 hPsi_associated_SNPs_31052 0 19207018 Pain 2e-10 GWAS_Catalog TagSNP rs2562456 GCST000326 Genome-wide association study of acute post-surgical pain in humans.
210 chr19 41523016 41523016 1 + C T rs3181842 41523016 + 41522996 41523036 41 GGAGTGCAGTGGCGTGATCTCGGCTCACTGCAACCTCCACC GGAGTGCAGTGGCGTGATCTTGGCTCACTGCAACCTCCACC Direct Gain 0 0.961553573608398 Functional Gain 0.961553573608398 CYP2B6 ENSG00000197408 UTR3 Human protein_coding chr19:41523016 chr19:41523016 . . 0 21 hPsi_associated_SNPs_31492 0 25839716 Polychlorinated biphenyl levels 1e-07 GWAS_Catalog TagSNP rs3181842 GCST002839 Genome-wide association study of plasma levels of polychlorinated biphenyls disclose an association with the CYP2B6 gene in a population-based sample.
211 chr19 45296806 45296806 1 + C T rs3208856 45296806 + 45296786 45296826 41 CCGTGAGTATCTACCAGTTCCACGGTCAGGCTACTGCTGAG CCGTGAGTATCTACCAGTTCTACGGTCAGGCTACTGCTGAG Direct Gain 0 0.979280412197113 Functional Gain 0.979280412197113 CBLC ENSG00000142273 CDS Human protein_coding chr19:45296806 chr19:45296806 nonsynonymous SNV 0.005 1 21 hPsi_associated_SNPs_31636 0 29507422 Total cholesterol levels 1e-41 GWAS_Catalog TagSNP rs3208856 GCST007143 A large electronic-health-record-based genome-wide study of serum lipids.
212 chr19 45412040 45412040 1 + C T rs769455 45412040 + 45412020 45412060 41 CCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGAT CCTCCCACCTGCGCAAGCTGTGTAAGCGGCTCCTCCGCGAT Direct Gain 0 0.971782982349396 Functional Gain 0.971782982349396 APOE ENSG00000130203 CDS Human protein_coding chr19:45412040 chr19:45412040 nonsynonymous SNV 0.993 3 21 hPsi_associated_SNPs_31649 2 29507422 Triglycerides 1e-09 GWAS_Catalog TagSNP rs769455 GCST007142 A large electronic-health-record-based genome-wide study of serum lipids.
213 chr19 45452812 45452812 1 + C T rs1130742 45452812 + 45452792 45452832 41 GAATAGTAACAATAAATAATCGTAACAGCAATTAGAGACTA GAATAGTAACAATAAATAATTGTAACAGCAATTAGAGACTA Direct Gain 0 0.919358432292938 Functional Gain 0.919358432292938 APOC4-APOC2 ENSG00000224916;ENSG00000234906;ENSG00000267467 UTR3 Human other chr19:45452812 chr19:45452812 . . 0 21 hPsi_associated_SNPs_31657 1 29875488 Blood protein levels 5e-72 GWAS_Catalog TagSNP rs1130742 GCST005806 Genomic atlas of the human plasma proteome.
214 chr19 49206631 49206631 1 + A T rs1047781 49206631 + 49206611 49206651 41 TGGAGGAGGAATACCGCCACATCCCGGGGGAGTACGTCCGC TGGAGGAGGAATACCGCCACTTCCCGGGGGAGTACGTCCGC Direct Gain 0 0.746015310287476 Functional Gain 0.746015310287476 FUT2 ENSG00000176920 CDS Human protein_coding chr19:49206631 chr19:49206631 nonsynonymous SNV 0.262 3 21 hPsi_associated_SNPs_31825 1 22367966 Vitamin B12 levels 4e-36 GWAS_Catalog TagSNP rs1047781 GCST001424 Genome-wide association study identifies novel loci associated with serum level of vitamin B12 in Chinese men.
215 chr19 51228746 51228746 1 + C T rs13866 51228746 + 51228726 51228766 41 GGGGCCGGTACCCCGCCTCCCTGCCCATCCCACCACCCGGC GGGGCCGGTACCCCGCCTCCTTGCCCATCCCACCACCCGGC Direct Gain 0 0.951733350753784 Functional Gain 0.951733350753784 CLEC11A ENSG00000105472 UTR3 Human protein_coding chr19:51228746 chr19:51228746 . . 0 21 hPsi_associated_SNPs_31969 0 30072576 Blood protein levels 4e-09 GWAS_Catalog TagSNP rs13866 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
216 chr19 51383200 51383200 1 + G T rs80050017 51383200 + 51383180 51383220 41 CAGGGGATGAGGGAAAGGGAGAGGATGAGGAAGCCCCCCTG CAGGGGATGAGGGAAAGGGATAGGATGAGGAAGCCCCCCTG Direct Gain 0 0.758299767971039 Functional Gain 0.758299767971039 KLK2 ENSG00000167751 UTR3 Human protein_coding chr19:51383200 chr19:51383200 . . 0 21 hPsi_associated_SNPs_31981 0 26219847 Tandem gait 4e-07 GWAS_Catalog TagSNP rs80050017 GCST003055 Heritability and Genome-Wide Association Analyses of Human Gait Suggest Contribution of Common Variants.
217 chr19 53762537 53762537 1 + C T rs12609049 53762537 + 53762517 53762557 41 CACATCTGTAGGAACAATCTCTACCCCAACTCTTCTCCTGG CACATCTGTAGGAACAATCTTTACCCCAACTCTTCTCCTGG Direct Gain 0 0.999995052814484 Functional Gain 0.999995052814484 VN1R2 ENSG00000196131 CDS Human protein_coding chr19:53762537 chr19:53762537 synonymous SNV . 0 21 hPsi_associated_SNPs_32070 0 17463246 Multiple continuous traits in DGI samples 0.0008793 Johnson and O'Donnell TagSNP rs12609049 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
218 chr19 54697079 54697079 1 + C T rs7595 54697079 + 54697059 54697099 41 ATCGCTCAGTGCTGGGCCCCCGAGGACACCATCCCACTCCA ATCGCTCAGTGCTGGGCCCCTGAGGACACCATCCCACTCCA Direct Gain 0 0.888104319572449 Functional Gain 0.888104319572449 TSEN34 ENSG00000170892 CDS Human protein_coding chr19:54697079 chr19:54697079 synonymous SNV . 0 21 hPsi_associated_SNPs_32141 2 23251661 Obesity-related traits 3e-08 GWAS_Catalog TagSNP rs7595 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
219 chr19 55993436 55993436 1 + G T rs147110934 55993436 + 55993416 55993456 41 GCGGCGGAGACCACGGTGGAGCTGGTGTACCGCTGCGATGG GCGGCGGAGACCACGGTGGATCTGGTGTACCGCTGCGATGG Direct Gain 0 0.993645966053009 Functional Gain 0.993645966053009 ZNF628 ENSG00000197483 CDS Human protein_coding chr19:55993436 chr19:55993436 nonsynonymous SNV 0.952 0 21 hPsi_associated_SNPs_32258 0 30593698 Fat-free mass 8e-09 GWAS_Catalog TagSNP rs147110934 GCST007063 Genomics of body fat percentage may contribute to sex bias in anorexia nervosa.
220 chr20 4101800 4101800 1 + C T rs1741344 4101800 + 4101780 4101820 41 GAGTTGGAAGCTGAGTTGACCGTGGAATTTCCGAGCTTGGA GAGTTGGAAGCTGAGTTGACTGTGGAATTTCCGAGCTTGGA Direct Gain 0 0.891086459159851 Functional Gain 0.891086459159851 RNF24;SMOX ENSG00000205300;ENSG00000088826 intergenic Human other chr20:4101800 chr20:4101800 . . 0 21 hPsi_associated_SNPs_32588 0 20881960 Height 3e-09 GWAS_Catalog TagSNP rs1741344 GCST000817 Hundreds of variants clustered in genomic loci and biological pathways affect human height.
221 chr20 29960787 29960787 1 + C T rs34247288 29960787 + 29960767 29960807 41 ATTCCATCCAATGAAGACCACAGGCGAGTTCCTGCGACATC ATTCCATCCAATGAAGACCATAGGCGAGTTCCTGCGACATC Direct Gain 0 0.605655610561371 Functional Gain 0.605655610561371 DEFB118 ENSG00000131068 CDS Human protein_coding chr20:29960787 chr20:29960787 synonymous SNV . 0 21 hPsi_associated_SNPs_32768 0 28644415 Prudent dietary pattern 2e-06 GWAS_Catalog TagSNP rs34247288 GCST004639 Genome-Wide Association Study of Dietary Pattern Scores.
222 chr20 34131396 34131396 1 + C T rs12481365 34131396 + 34131376 34131416 41 TGGTGGGGAGTTTTATCATTCGTTGTTTCAGCAGATTAATG TGGTGGGGAGTTTTATCATTTGTTGTTTCAGCAGATTAATG Direct Gain 0 0.984856605529785 Functional Gain 0.984856605529785 ERGIC3 ENSG00000125991 intronic Human protein_coding chr20:34131396 chr20:34131396 . . 0 21 hPsi_associated_SNPs_32909 0 30275531 Total cholesterol levels 2e-19 GWAS_Catalog TagSNP rs12481365 GCST006614 Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program.
223 chr20 36952342 36952342 1 + C T rs5741804 36952342 + 36952322 36952362 41 AGTGATGGAGTTTCCCGCTGCCCATGACCGCATGGTATACC AGTGATGGAGTTTCCCGCTGTCCATGACCGCATGGTATACC Direct Gain 0 0.94282341003418 Functional Gain 0.94282341003418 BPI ENSG00000101425 CDS Human protein_coding chr20:36952342 chr20:36952342 nonsynonymous SNV 0.000 0 21 hPsi_associated_SNPs_32967 0 29367611 Carboplatin disposition in epthelial ovarian cancer 9e-06 GWAS_Catalog TagSNP rs5741804 GCST005351 Genome-wide association study of paclitaxel and carboplatin disposition in women with epithelial ovarian cancer.
224 chr20 44336716 44336716 1 + C T rs6032449 44336716 + 44336696 44336736 41 AGGAGAGGAATCAGAAACCCCACTTTGGCATAGAGACAAGC AGGAGAGGAATCAGAAACCCTACTTTGGCATAGAGACAAGC Direct Gain 0 0.592390656471252 Functional Gain 0.592390656471252 WFDC13 ENSG00000168634 UTR3 Human protein_coding chr20:44336716 chr20:44336716 . . 0 21 hPsi_associated_SNPs_33116 0 17463246 Multiple continuous traits in DGI samples 0.0004785 Johnson and O'Donnell TagSNP rs6032449 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
225 chr20 57473728 57473728 1 + C T rs76801208 57473728 + 57473708 57473748 41 CAAGAAAACAATTATCCATCCCTCCTGTCTCCGACCAGAGT CAAGAAAACAATTATCCATCTCTCCTGTCTCCGACCAGAGT Direct Gain 0 0.997043013572693 Functional Gain 0.997043013572693 GNAS ENSG00000087460 intronic Human protein_coding chr20:57473728 chr20:57473728 . . 0 21 hPsi_associated_SNPs_33293 0 28762467 Sulfasalazine-induced agranulocytosis 2e-07 GWAS_Catalog TagSNP rs76801208 GCST004781 Sulfasalazine-Induced Agranulocytosis Is Associated With the Human Leukocyte Antigen Locus.
226 chr20 62328742 62328742 1 + C T rs909341 62328742 + 62328722 62328762 41 GGCACCTTCTCAGCCAGCAGCTCCAGCTCAGAGCAGTGCCA GGCACCTTCTCAGCCAGCAGTTCCAGCTCAGAGCAGTGCCA Direct Gain 0 0.823568820953369 Functional Gain 0.823568820953369 TNFRSF6B ENSG00000243509 CDS Human protein_coding chr20:62328742 chr20:62328742 synonymous SNV . 0 21 hPsi_associated_SNPs_33455 0 25574825 Atopic dermatitis 8e-10 GWAS_Catalog TagSNP rs909341 GCST002737 Genome-wide comparative analysis of atopic dermatitis and psoriasis gives insight into opposing genetic mechanisms.
227 chr20 62729431 62729431 1 + C T rs2229205 62729431 + 62729411 62729451 41 TCCAGCAAAGCCCAGGCTGTCAATGTGGCCATCTGGGCCCT TCCAGCAAAGCCCAGGCTGTTAATGTGGCCATCTGGGCCCT Direct Gain 0 0.953892886638641 Functional Gain 0.953892886638641 OPRL1 ENSG00000125510 CDS Human protein_coding chr20:62729431 chr20:62729431 synonymous SNV . 0 21 hPsi_associated_SNPs_33504 0 26112879 LDL peak particle diameter (total fat intake interaction) 7e-06 GWAS_Catalog TagSNP rs2229205 GCST002989 Interaction between Common Genetic Variants and Total Fat Intake on Low-Density Lipoprotein Peak Particle Diameter: A Genome-Wide Association Study.
228 chr21 34729377 34729377 1 + G T rs2834201 34729377 + 34729357 34729397 41 CCAAAGGCACCTACAACTTAGTTTTAAATTACTTGCTACTG CCAAAGGCACCTACAACTTATTTTTAAATTACTTGCTACTG Direct Gain 0 0.745875716209412 Functional Gain 0.745875716209412 IFNAR1 ENSG00000142166 UTR3 Human protein_coding chr21:34729377 chr21:34729377 . . 0 21 hPsi_associated_SNPs_33621 0 17554300 Multiple complex diseases 0.000863311 Johnson and O'Donnell TagSNP rs2834201 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
229 chr21 38885506 38885506 1 + C T rs17193211 38885506 + 38885486 38885526 41 CCTACTGAGGAGCAAAGCAGCAATTACATGGGATCCTGTGG CCTACTGAGGAGCAAAGCAGTAATTACATGGGATCCTGTGG Direct Gain 0 0.999922752380371 Functional Gain 0.999922752380371 DYRK1A ENSG00000157540 UTR3 Human protein_coding chr21:38885506 chr21:38885506 . . 0 21 hPsi_associated_SNPs_33702 0 30595370 Body mass index 9e-09 GWAS_Catalog TagSNP rs17193211 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
230 chr21 44871148 44871148 1 + C T rs55946466 44871148 + 44871128 44871168 41 TCATCGCTGGGCCCACACGCCGCCGACAGCTTCCGCGTGTG TCATCGCTGGGCCCACACGCTGCCGACAGCTTCCGCGTGTG Direct Gain 0 0.969824433326721 Functional Gain 0.969824433326721 LINC00319 ENSG00000188660 ncRNA_exonic Human lincRNA chr21:44871148 chr21:44871148 . . 0 21 hPsi_associated_SNPs_33791 0 29855589 Velopharyngeal dysfunction 1e-06 GWAS_Catalog TagSNP rs55946466 GCST006280 GWAS reveals loci associated with velopharyngeal dysfunction.
231 chr21 46348764 46348764 1 + A T rs4818988 46348764 + 46348744 46348784 41 CACCCTGGATGCCTGTGGGCAGCCTTCCTCACCCTGGATGC CACCCTGGATGCCTGTGGGCTGCCTTCCTCACCCTGGATGC Direct Gain 0 0.915355324745178 Functional Gain 0.915355324745178 ITGB2-AS1 ENSG00000227039 ncRNA_exonic Human antisense chr21:46348764 chr21:46348764 . . 0 21 hPsi_associated_SNPs_33890 0 28869591 Heel bone mineral density 3e-07 GWAS_Catalog TagSNP rs4818988 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
232 chr22 22049783 22049783 1 + C T rs12484060 22049783 + 22049763 22049803 41 ACTTCAGCTCCTGGTAGCAGCAGGTTGGCCGCTGTGGACCT ACTTCAGCTCCTGGTAGCAGTAGGTTGGCCGCTGTGGACCT Direct Gain 0 0.510343372821808 Functional Gain 0.510343372821808 PPIL2 ENSG00000100023 CDS Human protein_coding chr22:22049783 chr22:22049783 nonsynonymous SNV . 0 21 hPsi_associated_SNPs_34193 0 17554300 Multiple complex diseases 0.000310468 Johnson and O'Donnell TagSNP rs12484060 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
233 chr22 30423460 30423460 1 + C T rs12537 30423460 + 30423440 30423480 41 CAGTGGCAACACAGTTTGAACGTGGTGAAACAGGGTGTAGT CAGTGGCAACACAGTTTGAATGTGGTGAAACAGGGTGTAGT Direct Gain 0 0.816578328609467 Functional Gain 0.816578328609467 HORMAD2-AS1 ENSG00000227117 ncRNA_intronic Human antisense chr22:30423460 chr22:30423460 . . 0 21 hPsi_associated_SNPs_34467 0 22197929 IgA nephropathy 1e-11 GWAS_Catalog TagSNP rs12537 GCST001364 A genome-wide association study in Han Chinese identifies multiple susceptibility loci for IgA nephropathy.
234 chr22 44324730 44324730 1 + C T rs738408 44324730 + 44324710 44324750 41 GTATGTTCCTGCTTCATCCCCTTCTACAGTGGCCTTATCCC GTATGTTCCTGCTTCATCCCTTTCTACAGTGGCCTTATCCC Direct Gain 0 0.810138583183289 Functional Gain 0.810138583183289 PNPLA3 ENSG00000100344 CDS Human protein_coding chr22:44324730 chr22:44324730 synonymous SNV . 0 21 hPsi_associated_SNPs_34851 1 27863252 Hematocrit 6e-09 GWAS_Catalog TagSNP rs738408 GCST004604 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
235 chr22 49292667 49292667 1 + G T rs149925895 49292667 + 49292647 49292687 41 CACTGGCTTCAAAAAGATGTGGAGGCTGATGGGGAGGAGGA CACTGGCTTCAAAAAGATGTTGAGGCTGATGGGGAGGAGGA Direct Gain 0 0.833219110965729 Functional Gain 0.833219110965729 LINC01310 ENSG00000205632 ncRNA_exonic Human lincRNA chr22:49292667 chr22:49292667 . . 0 21 hPsi_associated_SNPs_34968 0 29898447 Erosive tooth wear (severe vs non-severe) 9e-06 GWAS_Catalog TagSNP rs149925895 GCST006218 Genome-Wide Association Study of Erosive Tooth Wear in a Finnish Cohort.
236 chrX 147088249 147088249 1 + C T rs764631 147088249 + 147088229 147088269 41 TCTGAGGGAAAATCAGGTGGCAAAGCCTTGTAATGAGCTGC TCTGAGGGAAAATCAGGTGGTAAAGCCTTGTAATGAGCTGC Direct Gain 0 0.984468817710876 Functional Gain 0.984468817710876 FMR1NB ENSG00000176988 CDS Human protein_coding chrX:147088249 chrX:147088249 nonsynonymous SNV 0.000 0 21 hPsi_associated_SNPs_35834 0 17052657 Parkinson's disease 0.000706713 Johnson and O'Donnell TagSNP rs764631 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
237 chr1 2494330 2494330 1 + G A rs2234167 2494330 - 2494310 2494350 41 GAGGAGGATCAATACCTGGACGGAGACGATCACCTTGACTA GAGGAGGATCAATACCTGGATGGAGACGATCACCTTGACTA Direct Gain 0 0.918600916862488 Functional Gain 0.918600916862488 TNFRSF14 ENSG00000157873 CDS Human protein_coding chr1:2494330 chr1:2494330 nonsynonymous SNV 0.000 1 21 hPsi_associated_SNPs_211922 1 31015401 Medication use (thyroid preparations) 9e-10 GWAS_Catalog TagSNP rs2234167 GCST007932 Genome-wide association study of medication-use and associated disease in the UK Biobank.
238 chr1 3651409 3651409 1 + G A rs10910018 3651409 - 3651389 3651429 41 GCAGCCAGATCCCCTGAGAGCCGACAGCCCCGTTCCTGCTG GCAGCCAGATCCCCTGAGAGTCGACAGCCCCGTTCCTGCTG Direct Gain 0 0.709375381469727 Functional Gain 0.709375381469727 TP73 ENSG00000078900 UTR3 Human protein_coding chr1:3651409 chr1:3651409 . . 0 21 hPsi_associated_SNPs_211983 0 22589738 Visceral fat 2e-06 GWAS_Catalog TagSNP rs10910018 GCST001525 Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women.
239 chr1 7723957 7723957 1 + G A rs12128526 7723957 - 7723937 7723977 41 GGCAGCATGGACAGGCTCTCCGAGCTGCCCGTGGTGGGAAA GGCAGCATGGACAGGCTCTCTGAGCTGCCCGTGGTGGGAAA Direct Gain 0 0.90864896774292 Functional Gain 0.90864896774292 CAMTA1 ENSG00000171735 CDS Human protein_coding chr1:7723957 chr1:7723957 synonymous SNV . 0 21 hPsi_associated_SNPs_212055 1 30595370 Body mass index 2e-10 GWAS_Catalog TagSNP rs12128526 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
240 chr1 11838762 11838762 1 + G A rs72640211 11838762 - 11838742 11838782 41 GCCCTCAAGTGCCACCATCTCAGGCTGCGCTGCAGCATCCG GCCCTCAAGTGCCACCATCTTAGGCTGCGCTGCAGCATCCG Direct Gain 0 0.999289453029633 Functional Gain 0.999289453029633 C1orf167 ENSG00000215910 CDS Human protein_coding chr1:11838762 chr1:11838762 synonymous SNV . 0 21 hPsi_associated_SNPs_212213 0 29912962 Pulse pressure x alcohol consumption interaction (2df test) 1e-13 GWAS_Catalog TagSNP rs72640211 GCST006168 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
241 chr1 12175658 12175658 1 + G A rs2230624 12175658 - 12175638 12175678 41 TGCGGGAGGAGTTCCATGCACATGGCGTCTTCTCCACAAGG TGCGGGAGGAGTTCCATGCATATGGCGTCTTCTCCACAAGG Direct Gain 0 0.999813854694366 Functional Gain 0.999813854694366 TNFRSF8 ENSG00000120949 CDS Human protein_coding chr1:12175658 chr1:12175658 nonsynonymous SNV 0.002 4 21 hPsi_associated_SNPs_212242 0 28199695 Mosquito bite size 4e-08 GWAS_Catalog TagSNP rs2230624 GCST004863 GWAS of self-reported mosquito bite size, itch intensity and attractiveness to mosquitoes implicates immune-related predisposition loci.
242 chr1 15793913 15793913 1 + G A rs1042010 15793913 - 15793893 15793933 41 ACCTGCCACCGGCCGTCAGACGCCTGACAGTTCAGTGGCCC ACCTGCCACCGGCCGTCAGATGCCTGACAGTTCAGTGGCCC Direct Gain 0 0.991162955760956 Functional Gain 0.991162955760956 CELA2A ENSG00000142615 CDS Human protein_coding chr1:15793913 chr1:15793913 synonymous SNV . 0 21 hPsi_associated_SNPs_212378 0 28739976 Systolic blood pressure 4e-07 GWAS_Catalog TagSNP rs1042010 GCST004776 Novel Blood Pressure Locus and Gene Discovery Using Genome-Wide Association Study and Expression Data Sets From Blood and the Kidney.
243 chr1 15808872 15808872 1 + G A rs3766160 15808872 - 15808852 15808892 41 GAACCCTTTGGAGACCTGGTCGGAGTTCCAGTCCTTGTGCA GAACCCTTTGGAGACCTGGTTGGAGTTCCAGTCCTTGTGCA Direct Gain 0 0.957145869731903 Functional Gain 0.957145869731903 CELA2B ENSG00000215704 CDS Human protein_coding chr1:15808872 chr1:15808872 nonsynonymous SNV 0.000 1 21 hPsi_associated_SNPs_212381 0 30237584 Resistant hypertension 1e-06 GWAS_Catalog TagSNP rs3766160 GCST007135 Genome-wide association analysis of common genetic variants of resistant hypertension.
244 chr1 18808292 18808292 1 + C A rs2992753 18808292 - 18808272 18808312 41 CTCCGCCTTCTGTATGAAATGCTCCTCCATTCGGACGCGGG CTCCGCCTTCTGTATGAAATTCTCCTCCATTCGGACGCGGG Direct Gain 0 0.960009217262268 Functional Gain 0.960009217262268 KLHDC7A ENSG00000179023 CDS Human protein_coding chr1:18808292 chr1:18808292 nonsynonymous SNV 0.947 0 21 hPsi_associated_SNPs_212567 0 30275531 LDL cholesterol 5e-09 GWAS_Catalog TagSNP rs2992753 GCST006612 Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program.
245 chr1 22895820 22895820 1 + G A rs45498698 22895820 - 22895800 22895840 41 AGCCGGATACGTGAGCCAGCCCCAGTCCCCGTGGATGGTCG AGCCGGATACGTGAGCCAGCTCCAGTCCCCGTGGATGGTCG Direct Gain 0 0.999977707862854 Functional Gain 0.999977707862854 EPHA8 ENSG00000070886 CDS Human protein_coding chr1:22895820 chr1:22895820 nonsynonymous SNV 1.000 4 21 hPsi_associated_SNPs_212698 0 27989323 Interferon gamma levels 1e-08 GWAS_Catalog TagSNP rs45498698 GCST004456 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
246 chr1 43699970 43699970 1 + G A rs2484714 43699970 - 43699950 43699990 41 TCTGTTTTAAACCTTTTGACCAGCGCTTCCAAGTCTCGCTC TCTGTTTTAAACCTTTTGACTAGCGCTTCCAAGTCTCGCTC Direct Gain 0 0.992860794067383 Functional Gain 0.992860794067383 CFAP57 ENSG00000243710 CDS Human protein_coding chr1:43699970 chr1:43699970 synonymous SNV . 0 21 hPsi_associated_SNPs_213316 0 17998437 Alzheimer's disease 2.56e-05 Johnson and O'Donnell TagSNP rs2484714 . Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.
247 chr1 43919486 43919486 1 + C A rs182798940 43919486 - 43919466 43919506 41 CTTTGGATCCCGCGGACTCCGCCCGGCCCGGCCTCCCCAGG CTTTGGATCCCGCGGACTCCTCCCGGCCCGGCCTCCCCAGG Direct Gain 0 0.972115635871887 Functional Gain 0.972115635871887 HYI;SZT2 ENSG00000178922 UTR5 Human protein_coding chr1:43919486 chr1:43919486 . . 0 21 hPsi_associated_SNPs_213345 0 26830138 Alzheimer disease and age of onset 7e-07 GWAS_Catalog TagSNP rs182798940 GCST003427 Family-based association analyses of imputed genotypes reveal genome-wide significant association of Alzheimer's disease with OSBPL6, PTPRG, and PDCL3.
248 chr1 46073489 46073489 1 + G A rs2230657 46073489 - 46073469 46073509 41 ACATCCACTGGCTTGACTGTCGGGTCTAAAGACTCTGCTTC ACATCCACTGGCTTGACTGTTGGGTCTAAAGACTCTGCTTC Direct Gain 0 0.999992847442627 Functional Gain 0.999992847442627 NASP ENSG00000132780 CDS Human protein_coding chr1:46073489 chr1:46073489 synonymous SNV . 0 21 hPsi_associated_SNPs_213423 0 27863252 Hemoglobin concentration 3e-13 GWAS_Catalog TagSNP rs2230657 GCST004615 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
249 chr1 55505647 55505647 1 + G A rs11591147 55505647 - 55505627 55505667 41 CCAGGCCGTCCTCCTCGGAACGCAAGGCTAGCACCAGCTCC CCAGGCCGTCCTCCTCGGAATGCAAGGCTAGCACCAGCTCC Direct Gain 0 0.998557806015015 Functional Gain 0.998557806015015 PCSK9 ENSG00000169174 CDS Human protein_coding chr1:55505647 chr1:55505647 nonsynonymous SNV 0.001 0 21 hPsi_associated_SNPs_213599 0 22331829 Response to statins (LDL cholesterol change) 5e-09 GWAS_Catalog TagSNP rs11591147 GCST001408 Genetic determinants of statin-induced low-density lipoprotein cholesterol reduction: the Justification for the Use of Statins in Prevention: an Intervention Trial Evaluating Rosuvastatin (JUPITER) trial.
250 chr1 55529187 55529187 1 + G A rs505151 55529187 - 55529167 55529207 41 TGGCAACGGCTGTCACGGCCCCTTCGCTGGTGCTGCCTGTA TGGCAACGGCTGTCACGGCCTCTTCGCTGGTGCTGCCTGTA Direct Gain 0 0.878951489925385 Functional Gain 0.878951489925385 PCSK9 ENSG00000169174 CDS Human protein_coding chr1:55529187 chr1:55529187 nonsynonymous SNV 0.001 0 21 hPsi_associated_SNPs_213605 3 28334899 Total cholesterol levels 3e-08 GWAS_Catalog TagSNP rs505151 GCST004235 Association analyses of East Asian individuals and trans-ancestry analyses with European individuals reveal new loci associated with cholesterol and triglyceride levels.
251 chr1 62580201 62580201 1 + G A rs12044746 62580201 - 62580181 62580221 41 TTTAATCAACCTCTGCAAAACTCCGATCTTAGTAATTCCAA TTTAATCAACCTCTGCAAAATTCCGATCTTAGTAATTCCAA Direct Gain 0 0.902124285697937 Functional Gain 0.902124285697937 PATJ ENSG00000132849 intronic Human protein_coding chr1:62580201 chr1:62580201 . . 0 21 hPsi_associated_SNPs_213652 0 17554300 Multiple complex diseases 0.000144141 Johnson and O'Donnell TagSNP rs12044746 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
252 chr1 64646752 64646752 1 + C A rs12135035 64646752 - 64646732 64646772 41 ACATTGTCAACAAAGGAAAAGATATTTTTCAGCTTGTGAAA ACATTGTCAACAAAGGAAAATATATTTTTCAGCTTGTGAAA Direct Gain 0 0.608598828315735 Functional Gain 0.608598828315735 ROR1 ENSG00000185483 UTR3 Human protein_coding chr1:64646752 chr1:64646752 . . 0 21 hPsi_associated_SNPs_213680 0 30072576 Blood protein levels 3e-14 GWAS_Catalog TagSNP rs12135035 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
253 chr1 66099013 66099013 1 + C A rs17415296 66099013 - 66098993 66099033 41 AATTTACACATCTATTTTAAGTTCTAAATCAACATAATCCA AATTTACACATCTATTTTAATTTCTAAATCAACATAATCCA Direct Gain 0 0.945257306098938 Functional Gain 0.945257306098938 LEPR ENSG00000116678 UTR3 Human protein_coding chr1:66099013 chr1:66099013 . . 0 21 hPsi_associated_SNPs_213712 0 28240269 Blood protein levels 4e-229 GWAS_Catalog TagSNP rs17415296 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
254 chr1 67705958 67705958 1 + G A rs11209026 67705958 - 67705938 67705978 41 CTGCAAAAACCTACCCAGTTCGGAATGATCTGTTAAATATC CTGCAAAAACCTACCCAGTTTGGAATGATCTGTTAAATATC Direct Gain 0 0.50589245557785 Functional Gain 0.50589245557785 IL23R ENSG00000162594 CDS Human protein_coding chr1:67705958 chr1:67705958 nonsynonymous SNV 0.935 4 21 hPsi_associated_SNPs_213736 2 20953190 Psoriasis 7e-07 GWAS_Catalog TagSNP rs11209026 GCST000833 A genome-wide association study identifies new psoriasis susceptibility loci and an interaction between HLA-C and ERAP1.
255 chr1 76255228 76255228 1 + G A rs11161620 76255228 - 76255208 76255248 41 AAAATTTTACCCTCCAAGGTCTCAGTGTAATTTTAGAACTC AAAATTTTACCCTCCAAGGTTTCAGTGTAATTTTAGAACTC Direct Gain 0 0.99651974439621 Functional Gain 0.99651974439621 SNORD45B ENSG00000201487 ncRNA_exonic Human snoRNA chr1:76255228 chr1:76255228 . . 0 21 hPsi_associated_SNPs_213794 0 23093944 Serum metabolite levels 5e-16 GWAS_Catalog TagSNP rs11161620 GCST006249 Mining the unknown: a systems approach to metabolite identification combining genetic and metabolic information.
256 chr1 86900372 86900372 1 + C A rs17409304 86900372 - 86900352 86900392 41 GACCACTTTGTCACCAGCCTGTACAAGCGAGAATGTGGGAG GACCACTTTGTCACCAGCCTTTACAAGCGAGAATGTGGGAG Direct Gain 0 0.901233673095703 Functional Gain 0.901233673095703 CLCA2 ENSG00000137975 CDS Human protein_coding chr1:86900372 chr1:86900372 nonsynonymous SNV 0.682 1 21 hPsi_associated_SNPs_213876 0 17554300 Multiple complex diseases 0.000508882 Johnson and O'Donnell TagSNP rs17409304 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
257 chr1 92554283 92554283 1 + G A rs34856868 92554283 - 92554263 92554303 41 ACAACCCACAGAGAAGGTAACATCTGTATGGAATTCTTCCC ACAACCCACAGAGAAGGTAATATCTGTATGGAATTCTTCCC Direct Gain 0 0.85509181022644 Functional Gain 0.85509181022644 BTBD8 ENSG00000189195 CDS Human protein_coding chr1:92554283 chr1:92554283 nonsynonymous SNV 0.366 0 21 hPsi_associated_SNPs_213935 0 23251661 Obesity-related traits 2e-06 GWAS_Catalog TagSNP rs34856868 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
258 chr1 99164434 99164434 1 + G A rs6577322 99164434 - 99164414 99164454 41 ATTTCACTATAAAGCACGTACTCATGTACAACAGGAAGCAG ATTTCACTATAAAGCACGTATTCATGTACAACAGGAAGCAG Direct Gain 0 0.974198162555695 Functional Gain 0.974198162555695 SNX7 ENSG00000162627 CDS Human protein_coding chr1:99164434 chr1:99164434 synonymous SNV . 0 21 hPsi_associated_SNPs_213987 0 17554300 Multiple complex diseases 0.000570631 Johnson and O'Donnell TagSNP rs6577322 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
259 chr1 101204495 101204495 1 + C A rs3783621 101204495 - 101204475 101204515 41 ACATTGGGAAAGTTGCACAGGAGTCTGATGAACAAACTTCG ACATTGGGAAAGTTGCACAGTAGTCTGATGAACAAACTTCG Direct Gain 0 0.983794987201691 Functional Gain 0.983794987201691 VCAM1 ENSG00000162692 UTR3 Human protein_coding chr1:101204495 chr1:101204495 . . 0 21 hPsi_associated_SNPs_214027 0 17554300 Multiple complex diseases 0.000902847 Johnson and O'Donnell TagSNP rs3783621 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
260 chr1 101704577 101704577 1 + C A rs41287280 101704577 - 101704557 101704597 41 GTAGTCAGAGACCGAGCTGCGGTGGGCCTTGACCAGCGGGA GTAGTCAGAGACCGAGCTGCTGTGGGCCTTGACCAGCGGGA Direct Gain 0 0.986219704151154 Functional Gain 0.986219704151154 S1PR1 ENSG00000170989 CDS Human protein_coding chr1:101704577 chr1:101704577 nonsynonymous SNV 0.012 0 21 hPsi_associated_SNPs_214037 0 27863252 Lymphocyte counts 2e-19 GWAS_Catalog TagSNP rs41287280 GCST004627 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
261 chr1 107599918 107599918 1 + C A rs2232016 107599918 - 107599898 107599938 41 GCATCTGGTCGCTGATGGGGGCTATGAAGAGCTCGGCGGAG GCATCTGGTCGCTGATGGGGTCTATGAAGAGCTCGGCGGAG Direct Gain 0 0.990947246551514 Functional Gain 0.990947246551514 PRMT6 ENSG00000198890 CDS Human protein_coding chr1:107599918 chr1:107599918 nonsynonymous SNV 0.956 4 21 hPsi_associated_SNPs_214054 0 30595370 Red cell distribution width 2e-10 GWAS_Catalog TagSNP rs2232016 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
262 chr1 113005808 113005808 1 + T A rs2488787 113005808 - 113005788 113005828 41 GCATTCCCTGCACCTAGGGAATTAAATTTCACTCCTGAAAG GCATTCCCTGCACCTAGGGATTTAAATTTCACTCCTGAAAG Direct Gain 0 0.985325217247009 Functional Gain 0.985325217247009 MIR4256;WNT2B ENSG00000143079;ENSG00000134245 intergenic Human other chr1:113005808 chr1:113005808 . . 0 21 hPsi_associated_SNPs_214249 0 16252231 Parkinson's disease 0.00087325 Johnson and O'Donnell TagSNP rs2488787 . High-resolution whole-genome association study of Parkinson disease.
263 chr1 114226143 114226143 1 + G A rs61742849 114226143 - 114226123 114226163 41 CAGCATTACTGCCCGTATAGCCTGCTATTCTTCGACTCTTA CAGCATTACTGCCCGTATAGTCTGCTATTCTTCGACTCTTA Direct Gain 0 0.74082887172699 Functional Gain 0.74082887172699 MAGI3 ENSG00000081026 CDS Human protein_coding chr1:114226143 chr1:114226143 nonsynonymous SNV 0.010 1 21 hPsi_associated_SNPs_214282 0 23568457 Bulimia nervosa 6e-06 GWAS_Catalog TagSNP rs61742849 GCST001958 Genetic variants associated with disordered eating.
264 chr1 117487711 117487711 1 + T A rs4546904 117487711 - 117487691 117487731 41 CATCGTTTCCAGCTCACCTGATGGCTGGATCACCACGGTGG CATCGTTTCCAGCTCACCTGTTGGCTGGATCACCACGGTGG Direct Gain 0 0.972442924976349 Functional Gain 0.972442924976349 PTGFRN ENSG00000134247 CDS Human protein_coding chr1:117487711 chr1:117487711 nonsynonymous SNV 0.906 0 21 hPsi_associated_SNPs_214344 0 29875488 Blood protein levels 4e-240 GWAS_Catalog TagSNP rs4546904 GCST005806 Genomic atlas of the human plasma proteome.
265 chr1 150480571 150480571 1 + G A rs12724450 150480571 - 150480551 150480591 41 TACGGTTGTGAGCTTCAGGACCAGCTCTTCTTTTATAATTG TACGGTTGTGAGCTTCAGGATCAGCTCTTCTTTTATAATTG Direct Gain 0 0.959232926368713 Functional Gain 0.959232926368713 ECM1 ENSG00000143369 UTR5 Human protein_coding chr1:150480571 chr1:150480571 . . 0 21 hPsi_associated_SNPs_214580 0 28240269 Blood protein levels 2e-12 GWAS_Catalog TagSNP rs12724450 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
266 chr1 150954720 150954720 1 + G A rs28521412 150954720 - 150954700 150954740 41 TGAACAGCCAGTCAGATGACCTCTCTTAGGGACGAACCCAG TGAACAGCCAGTCAGATGACTTCTCTTAGGGACGAACCCAG Direct Gain 0 0.947322010993958 Functional Gain 0.947322010993958 ANXA9 ENSG00000143412 UTR5 Human protein_coding chr1:150954720 chr1:150954720 . . 0 21 hPsi_associated_SNPs_214595 0 30593698 Fat-free mass 2e-06 GWAS_Catalog TagSNP rs28521412 GCST007063 Genomics of body fat percentage may contribute to sex bias in anorexia nervosa.
267 chr1 154437896 154437896 1 + T A rs2229238 154437896 - 154437876 154437916 41 GCTGAGCCCGTTTGTGTTTTATCATCCACAGGGTCCAGGCT GCTGAGCCCGTTTGTGTTTTTTCATCCACAGGGTCCAGGCT Direct Gain 0 0.99999338388443 Functional Gain 0.99999338388443 IL6R ENSG00000160712 UTR3 Human protein_coding chr1:154437896 chr1:154437896 . . 0 21 hPsi_associated_SNPs_214761 0 22319020 Coronary heart disease 7e-07 GWAS_Catalog TagSNP rs2229238 GCST001401 A genome-wide association study for coronary artery disease identifies a novel susceptibility locus in the major histocompatibility complex.
268 chr1 155033308 155033308 1 + G A rs11589479 155033308 - 155033288 155033328 41 CTCTGGCATCCAGGACTCACCTTAGTGCCTCGTGCCAGCAG CTCTGGCATCCAGGACTCACTTTAGTGCCTCGTGCCAGCAG Direct Gain 0 0.761172413825989 Functional Gain 0.761172413825989 ADAM15 ENSG00000143537 CDS Human protein_coding chr1:155033308 chr1:155033308 synonymous SNV . 0 21 hPsi_associated_SNPs_214796 0 27182965 Chin dimples 5e-11 GWAS_Catalog TagSNP rs11589479 GCST003989 Detection and interpretation of shared genetic influences on 42 human traits.
269 chr1 161641384 161641384 1 + G A rs6665610 161641384 - 161641364 161641404 41 CTGGTCTGGCCAGTCTGGCACGTGTACTCCCCGCTGTCATT CTGGTCTGGCCAGTCTGGCATGTGTACTCCCCGCTGTCATT Direct Gain 0 0.73168408870697 Functional Gain 0.73168408870697 FCGR2B ENSG00000072694 CDS Human protein_coding chr1:161641384 chr1:161641384 synonymous SNV . 0 21 hPsi_associated_SNPs_215063 0 28240269 Blood protein levels 4e-160 GWAS_Catalog TagSNP rs6665610 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
270 chr1 161642985 161642985 1 + G A rs182968886 161642985 - 161642965 161643005 41 GTCACAGGCTTGGATGAGTACAGCGTGTAGCCTATGTTTCC GTCACAGGCTTGGATGAGTATAGCGTGTAGCCTATGTTTCC Direct Gain 0 0.780303180217743 Functional Gain 0.780303180217743 FCGR2B ENSG00000072694 CDS Human protein_coding chr1:161642985 chr1:161642985 synonymous SNV . 0 21 hPsi_associated_SNPs_215065 0 27863252 Monocyte percentage of white cells 7e-11 GWAS_Catalog TagSNP rs182968886 GCST004609 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
271 chr1 162737080 162737080 1 + C A rs143928882 162737080 - 162737060 162737100 41 ATGGCCAGGAGGATAAAGATGATGGCCACCAAGCAGCCAAT ATGGCCAGGAGGATAAAGATTATGGCCACCAAGCAGCCAAT Direct Gain 0 0.99934983253479 Functional Gain 0.99934983253479 DDR2 ENSG00000162733 CDS Human protein_coding chr1:162737080 chr1:162737080 synonymous SNV . 0 21 hPsi_associated_SNPs_215115 0 28090653 Alanine aminotransferase (ALT) levels after remission induction therapy in actute lymphoblastic leukemia (ALL) 2e-06 GWAS_Catalog TagSNP rs143928882 GCST004250 Genome-Wide Study Links PNPLA3 Variant With Elevated Hepatic Transaminase After Acute Lymphoblastic Leukemia Therapy.
272 chr1 181745701 181745701 1 + C A rs71632123 181745701 - 181745681 181745721 41 AAACCCTTGTCAAACCCCCTGATAACTCAAAGGAGTCCACT AAACCCTTGTCAAACCCCCTTATAACTCAAAGGAGTCCACT Direct Gain 0 0.867974460124969 Functional Gain 0.867974460124969 CACNA1E ENSG00000198216 intronic Human protein_coding chr1:181745701 chr1:181745701 . . 0 21 hPsi_associated_SNPs_215461 0 27098658 Presence of antiphospholipid antibodies 1e-06 GWAS_Catalog TagSNP rs71632123 GCST003563 Antiphospholipid antibodies in a large population-based cohort: genome-wide associations and effects on monocyte gene expression.
273 chr1 183155482 183155482 1 + C A rs684527 183155482 - 183155462 183155502 41 CCAGAGCGCAGGCATGGCGGGGCCGGGCCGCTCAGTCTCTG CCAGAGCGCAGGCATGGCGGTGCCGGGCCGCTCAGTCTCTG Direct Gain 0 0.568139553070068 Functional Gain 0.568139553070068 LAMC2 ENSG00000058085 UTR5 Human protein_coding chr1:183155482 chr1:183155482 . . 0 21 hPsi_associated_SNPs_215500 1 30048462 Heel bone mineral density 2e-11 GWAS_Catalog TagSNP rs684527 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
274 chr1 196642233 196642233 1 + G A rs800292 196642233 - 196642213 196642253 41 CTTCCTGCATACCATTATTACATTTCCAAGAGATCTATATC CTTCCTGCATACCATTATTATATTTCCAAGAGATCTATATC Direct Gain 0 0.999232172966003 Functional Gain 0.999232172966003 CFH ENSG00000000971 CDS Human protein_coding chr1:196642233 chr1:196642233 nonsynonymous SNV 0.028 0 21 hPsi_associated_SNPs_215568 6 29212897 Matrix metalloproteinase-8 levels 2e-35 GWAS_Catalog TagSNP rs800292 GCST005187 Genetic Variants Contributing to Circulating Matrix Metalloproteinase 8 Levels and Their Association With Cardiovascular Diseases: A Genome-Wide Analysis.
275 chr1 196887457 196887457 1 + G A rs10494745 196887457 - 196887437 196887477 41 CTGATGTATTCGCATTATATCCCAATTTACACATAAATTCA CTGATGTATTCGCATTATATTCCAATTTACACATAAATTCA Direct Gain 0 0.984317481517792 Functional Gain 0.984317481517792 CFHR4 ENSG00000134365 CDS Human protein_coding chr1:196887457 chr1:196887457 nonsynonymous SNV 0.001 1 21 hPsi_associated_SNPs_215582 0 28240269 Blood protein levels 2e-52 GWAS_Catalog TagSNP rs10494745 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
276 chr1 196967354 196967354 1 + G A rs35662416 196967354 - 196967334 196967374 41 AGATGTCTGAACATCTGTAACGTATTCTAGAATTATGATTA AGATGTCTGAACATCTGTAATGTATTCTAGAATTATGATTA Direct Gain 0 0.984440386295319 Functional Gain 0.984440386295319 CFHR5 ENSG00000134389 CDS Human protein_coding chr1:196967354 chr1:196967354 nonsynonymous SNV 0.016 0 21 hPsi_associated_SNPs_215587 1 29875488 Blood protein levels 4e-121 GWAS_Catalog TagSNP rs35662416 GCST005806 Genomic atlas of the human plasma proteome.
277 chr1 198663661 198663661 1 + G A rs10494783 198663661 - 198663641 198663681 41 ATCGTCCACTCTCACTCTTTCATTAGATGTGAATTACAAAC ATCGTCCACTCTCACTCTTTTATTAGATGTGAATTACAAAC Direct Gain 0 0.958643674850464 Functional Gain 0.958643674850464 PTPRC ENSG00000081237 UTR3 Human protein_coding chr1:198663661 chr1:198663661 . . 0 21 hPsi_associated_SNPs_215603 0 30595370 White blood cell count 5e-24 GWAS_Catalog TagSNP rs10494783 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
278 chr1 198664102 198664102 1 + G A rs3767747 198664102 - 198664082 198664122 41 AACTTCAATCTCTAGATTTTCATAACCAAATAACTCACAAA AACTTCAATCTCTAGATTTTTATAACCAAATAACTCACAAA Direct Gain 0 0.998011648654938 Functional Gain 0.998011648654938 PTPRC ENSG00000081237 UTR3 Human protein_coding chr1:198664102 chr1:198664102 . . 0 21 hPsi_associated_SNPs_215605 0 30595370 Mean corpuscular hemoglobin 1e-18 GWAS_Catalog TagSNP rs3767747 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
279 chr1 200143442 200143442 1 + T A rs1060061 200143442 - 200143422 200143462 41 GCAAGTTTTTAATTAGCGTTACTTGGAGCAGTTCAGAGTAC GCAAGTTTTTAATTAGCGTTTCTTGGAGCAGTTCAGAGTAC Direct Gain 0 0.987264037132263 Functional Gain 0.987264037132263 NR5A2 ENSG00000116833 UTR3 Human protein_coding chr1:200143442 chr1:200143442 . . 0 21 hPsi_associated_SNPs_215609 0 28440896 Nicotine dependence 4e-06 GWAS_Catalog TagSNP rs1060061 GCST004294 Genome-wide meta-analysis identifies a novel susceptibility signal at CACNA2D3 for nicotine dependence.
280 chr1 203651927 203651927 1 + T A rs1541252 203651927 - 203651907 203651947 41 CAACAACCAGCAACTGTAGTAGTAGACGTCAGGAGGAGGAA CAACAACCAGCAACTGTAGTTGTAGACGTCAGGAGGAGGAA Direct Gain 0 0.697556257247925 Functional Gain 0.697556257247925 ATP2B4 ENSG00000058668 UTR5 Human protein_coding chr1:203651927 chr1:203651927 . . 0 21 hPsi_associated_SNPs_215802 0 23263863 Mean corpuscular hemoglobin concentration 9e-08 GWAS_Catalog TagSNP rs1541252 GCST001782 GWAS of blood cell traits identifies novel associated loci and epistatic interactions in Caucasian and African-American children.
281 chr1 203667409 203667409 1 + T A rs2228445 203667409 - 203667389 203667429 41 GCTGCAATCTCCAGGATGATAAGCGTGACATCTTGAAGAGC GCTGCAATCTCCAGGATGATTAGCGTGACATCTTGAAGAGC Direct Gain 0 0.998428702354431 Functional Gain 0.998428702354431 ATP2B4 ENSG00000058668 CDS Human protein_coding chr1:203667409 chr1:203667409 synonymous SNV . 0 21 hPsi_associated_SNPs_215805 0 30595370 Red blood cell count 1e-27 GWAS_Catalog TagSNP rs2228445 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
282 chr1 204943947 204943947 1 + C A rs2246662 204943947 - 204943927 204943967 41 GAACCCTCTCCTTTACCTTTGACCTCCAGGCGGACTTGGTT GAACCCTCTCCTTTACCTTTTACCTCCAGGCGGACTTGGTT Direct Gain 0 0.97911536693573 Functional Gain 0.97911536693573 NFASC ENSG00000163531 CDS Human protein_coding chr1:204943947 chr1:204943947 synonymous SNV . 0 21 hPsi_associated_SNPs_215849 0 28240269 Blood protein levels 4e-11 GWAS_Catalog TagSNP rs2246662 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
283 chr1 221057662 221057662 1 + G A rs3738182 221057662 - 221057642 221057682 41 CTGGGGCTCCTCTCGTCCTGCTCGCCATCCGCAGCCGGGGC CTGGGGCTCCTCTCGTCCTGTTCGCCATCCGCAGCCGGGGC Direct Gain 0 0.998943030834198 Functional Gain 0.998943030834198 HLX ENSG00000136630 CDS Human protein_coding chr1:221057662 chr1:221057662 synonymous SNV . 0 21 hPsi_associated_SNPs_216134 0 30595370 White blood cell count 4e-08 GWAS_Catalog TagSNP rs3738182 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
284 chr1 248039294 248039294 1 + G A rs1339847 248039294 - 248039274 248039314 41 TCGCTCAGGGTTGTTGGGGACATCCCTCCATGGTTCTCCAT TCGCTCAGGGTTGTTGGGGATATCCCTCCATGGTTCTCCAT Direct Gain 0 0.963936567306519 Functional Gain 0.963936567306519 TRIM58 ENSG00000162722 CDS Human protein_coding chr1:248039294 chr1:248039294 nonsynonymous SNV 0.063 0 21 hPsi_associated_SNPs_216705 0 27863252 Reticulocyte fraction of red cells 1e-208 GWAS_Catalog TagSNP rs1339847 GCST004619 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
285 chr2 11738091 11738091 1 + T A rs1435547 11738091 - 11738071 11738111 41 CCCATACCTGAATGCCACACATGGAGCAGAGTCTGCTGGTA CCCATACCTGAATGCCACACTTGGAGCAGAGTCTGCTGGTA Direct Gain 0 0.994615793228149 Functional Gain 0.994615793228149 GREB1 ENSG00000196208 CDS Human protein_coding chr2:11738091 chr2:11738091 nonsynonymous SNV 0.785 2 21 hPsi_associated_SNPs_216917 0 25918132 Diisocyanate-induced asthma 1e-06 GWAS_Catalog TagSNP rs1435547 GCST002875 Genome-Wide Association Study Identifies Novel Loci Associated With Diisocyanate-Induced Occupational Asthma.
286 chr2 25380573 25380573 1 + G A rs1866146 25380573 - 25380553 25380593 41 GATGCTTTCTGCCGATCTGCCTCTTATCCATTCACCTGACT GATGCTTTCTGCCGATCTGCTTCTTATCCATTCACCTGACT Direct Gain 0 0.983873128890991 Functional Gain 0.983873128890991 EFR3B ENSG00000261452 ncRNA_exonic Human other chr2:25380573 chr2:25380573 . . 0 21 hPsi_associated_SNPs_217018 0 17554300 Multiple complex diseases 0.00058568 Johnson and O'Donnell TagSNP rs1866146 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
287 chr2 26799031 26799031 1 + G A rs2272464 26799031 - 26799011 26799051 41 CAGCTTACCTGGTAGAAATTCGTAAGCTCTGTGGAGCGATG CAGCTTACCTGGTAGAAATTTGTAAGCTCTGTGGAGCGATG Direct Gain 0 0.76418673992157 Functional Gain 0.76418673992157 C2orf70 ENSG00000173557 CDS Human protein_coding chr2:26799031 chr2:26799031 nonsynonymous SNV 0.000 0 21 hPsi_associated_SNPs_217046 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0008728 Johnson and O'Donnell TagSNP rs2272464 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
288 chr2 26929096 26929096 1 + G A rs74887298 26929096 - 26929076 26929116 41 TCTTGGCCACCTGGCTCACCCCAGGAGCTTTGGCTCGAGGA TCTTGGCCACCTGGCTCACCTCAGGAGCTTTGGCTCGAGGA Direct Gain 0 0.919741809368134 Functional Gain 0.919741809368134 KCNK3 ENSG00000171303 intronic Human protein_coding chr2:26929096 chr2:26929096 . . 0 21 hPsi_associated_SNPs_217055 0 30177863 Diverticular disease 8e-07 GWAS_Catalog TagSNP rs74887298 GCST006479 Genome-wide association analyses identify 39 new susceptibility loci for diverticular disease.
289 chr2 27851918 27851918 1 + G A rs3749147 27851918 - 27851898 27851938 41 CGGACGCCGCCATCTTCCTCCTGGCCCCACCCACCCGACCA CGGACGCCGCCATCTTCCTCTTGGCCCCACCCACCCGACCA Direct Gain 0 0.994174838066101 Functional Gain 0.994174838066101 GPN1 ENSG00000198522 CDS Human protein_coding chr2:27851918 chr2:27851918 nonsynonymous SNV 0.021 0 21 hPsi_associated_SNPs_217124 0 21386085 Waist Circumference - Triglycerides (WC-TG) 1e-09 GWAS_Catalog TagSNP rs3749147 GCST001006 A bivariate genome-wide approach to metabolic syndrome: STAMPEED consortium.
290 chr2 44547574 44547574 1 + G A rs698761 44547574 - 44547554 44547594 41 TTGGTACTTAACCTTATTCTCATTTTAGCGGGAAGGCCCGA TTGGTACTTAACCTTATTCTTATTTTAGCGGGAAGGCCCGA Direct Gain 0 0.993471920490265 Functional Gain 0.993471920490265 SLC3A1 ENSG00000138079 CDS Human protein_coding chr2:44547574 chr2:44547574 nonsynonymous SNV 0.557 1 21 hPsi_associated_SNPs_217337 1 26821981 antipsychotic drug dosage in schizophrenia or schizoaffective disorder 5e-06 GWAS_Catalog TagSNP rs698761 GCST003341 Genome-wide association analysis to predict optimal antipsychotic dosage in schizophrenia: a pilot study.
291 chr2 68962137 68962137 1 + G A rs10048745 68962137 - 68962117 68962157 41 TCTTAGATGAAAGGTCCATCCATCTGTCACTGGAGGATGGC TCTTAGATGAAAGGTCCATCTATCTGTCACTGGAGGATGGC Direct Gain 0 0.995579838752747 Functional Gain 0.995579838752747 ARHGAP25 ENSG00000163219 UTR5 Human protein_coding chr2:68962137 chr2:68962137 . . 0 21 hPsi_associated_SNPs_217572 0 27863252 Plateletcrit 5e-21 GWAS_Catalog TagSNP rs10048745 GCST004607 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
292 chr2 70038232 70038232 1 + C A rs6546550 70038232 - 70038212 70038252 41 CCAGCATCTCTGTCATGAAGGCTTTTCTTTGTTTCTACAAC CCAGCATCTCTGTCATGAAGTCTTTTCTTTGTTTCTACAAC Direct Gain 0 0.993589878082275 Functional Gain 0.993589878082275 ANXA4 ENSG00000196975 intronic Human protein_coding chr2:70038232 chr2:70038232 . . 0 21 hPsi_associated_SNPs_217589 0 28416818 Prevalent atrial fibrillation 1e-08 GWAS_Catalog TagSNP rs6546550 GCST004301 Large-scale analyses of common and rare variants identify 12 new loci associated with atrial fibrillation.
293 chr2 71680950 71680950 1 + C A rs6741336 71680950 - 71680930 71680970 41 AGGGGAACGGGCCACCCCCGGCTGCTCCAGTGGGCTAGGCT AGGGGAACGGGCCACCCCCGTCTGCTCCAGTGGGCTAGGCT Direct Gain 0 0.951397180557251 Functional Gain 0.951397180557251 DYSF ENSG00000135636 UTR5 Human protein_coding chr2:71680950 chr2:71680950 . . 0 21 hPsi_associated_SNPs_217650 0 30038396 Highest math class taken 3e-08 GWAS_Catalog TagSNP rs6741336 GCST006574 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
294 chr2 85046475 85046475 1 + G A rs7584208 85046475 - 85046455 85046495 41 GCAATCCAGTAGTCTTTGGACCGCTTGGAGGGTAACAGGAC GCAATCCAGTAGTCTTTGGATCGCTTGGAGGGTAACAGGAC Direct Gain 0 0.521807014942169 Functional Gain 0.521807014942169 DNAH6 ENSG00000115423 CDS Human protein_coding chr2:85046475 chr2:85046475 synonymous SNV . 0 21 hPsi_associated_SNPs_217794 0 17554300 Multiple complex diseases 0.000496122 Johnson and O'Donnell TagSNP rs7584208 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
295 chr2 85286519 85286519 1 + T A rs2272514 85286519 - 85286499 85286539 41 GATGTTATAAAAGGTAATCTATATCAAGGGTTCAGTACAAA GATGTTATAAAAGGTAATCTTTATCAAGGGTTCAGTACAAA Direct Gain 0 0.955871403217316 Functional Gain 0.955871403217316 KCMF1 ENSG00000176407 UTR3 Human protein_coding chr2:85286519 chr2:85286519 . . 0 21 hPsi_associated_SNPs_217800 0 17982456 Rheumatoid Arthritis, cyclic citrullinated peptide (CCP) positive 1e-04 Johnson and O'Donnell TagSNP rs2272514 . Two independent alleles at 6q23 associated with risk of rheumatoid arthritis.
296 chr2 113832333 113832333 1 + C A rs6743376 113832333 - 113832313 113832353 41 AAATGGGGACCTTGGTGCGGGCCAAGCCTCTGTTAGGAAGT AAATGGGGACCTTGGTGCGGTCCAAGCCTCTGTTAGGAAGT Direct Gain 0 0.998229563236237 Functional Gain 0.998229563236237 IL1F10 ENSG00000136697 CDS Human protein_coding chr2:113832333 chr2:113832333 nonsynonymous SNV 0.977 0 21 hPsi_associated_SNPs_218253 0 24182552 Inflammatory biomarkers 2e-26 GWAS_Catalog TagSNP rs6743376 GCST002255 Novel gene variants predict serum levels of the cytokines IL-18 and IL-1ra in older adults.
297 chr2 155713849 155713849 1 + G A rs75561433 155713849 - 155713829 155713869 41 AAAGACAAATTAAAATGACTCTCCAAAGTAAATTATGGCTC AAAGACAAATTAAAATGACTTTCCAAAGTAAATTATGGCTC Direct Gain 0 0.977967739105225 Functional Gain 0.977967739105225 KCNJ3 ENSG00000162989 UTR3 Human protein_coding chr2:155713849 chr2:155713849 . . 0 21 hPsi_associated_SNPs_218649 0 29771307 Rosacea symptom severity 5e-07 GWAS_Catalog TagSNP rs75561433 GCST005790 Assessment of rosacea symptom severity by genome-wide association study and expression analysis highlights immuno-inflammatory and skin pigmentation genes.
298 chr2 162280748 162280748 1 + G A rs890076 162280748 - 162280728 162280768 41 CCGCGGCGGGGCCGGGCGGGCAGGGGCGGCCTAGCTGTGCG CCGCGGCGGGGCCGGGCGGGTAGGGGCGGCCTAGCTGTGCG Direct Gain 0 0.994893908500671 Functional Gain 0.994893908500671 TBR1 ENSG00000251621 ncRNA_exonic Human 3prime_overlapping_ncRNA chr2:162280748 chr2:162280748 . . 0 21 hPsi_associated_SNPs_218687 0 30038396 Highest math class taken (MTAG) 2e-08 GWAS_Catalog TagSNP rs890076 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
299 chr2 166152389 166152389 1 + G A rs17183814 166152389 - 166152369 166152409 41 CAATAGCAGCAAGGGATTCCCTGGTAAAGAAGCGGAAGCTG CAATAGCAGCAAGGGATTCCTTGGTAAAGAAGCGGAAGCTG Direct Gain 0 0.994808554649353 Functional Gain 0.994808554649353 SCN2A ENSG00000136531 CDS Human protein_coding chr2:166152389 chr2:166152389 nonsynonymous SNV 1.000 2 21 hPsi_associated_SNPs_218690 3 31043756 Bipolar disorder 2e-09 GWAS_Catalog TagSNP rs17183814 GCST008103 Genome-wide association study identifies 30 loci associated with bipolar disorder.
300 chr2 171356274 171356274 1 + G A rs10185178 171356274 - 171356254 171356294 41 TCTCTCTCTTCTCTCTGACCCTTTTGTATCTCCTGGCTCCA TCTCTCTCTTCTCTCTGACCTTTTTGTATCTCCTGGCTCCA Direct Gain 0 0.502606689929962 Functional Gain 0.502606689929962 MYO3B ENSG00000071909 CDS Human protein_coding chr2:171356274 chr2:171356274 nonsynonymous SNV 0.980 1 21 hPsi_associated_SNPs_218764 0 17554300 Multiple complex diseases 1.03e-07 Johnson and O'Donnell TagSNP rs10185178 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
301 chr2 182994685 182994685 1 + T A rs12474446 182994685 - 182994665 182994705 41 ATTTACTTCTTTTATTTCTTATAAGTCATCTTAGTTTGAAG ATTTACTTCTTTTATTTCTTTTAAGTCATCTTAGTTTGAAG Direct Gain 0 0.99725329875946 Functional Gain 0.99725329875946 PPP1R1C ENSG00000150722 UTR3 Human protein_coding chr2:182994685 chr2:182994685 . . 0 21 hPsi_associated_SNPs_218923 0 30578418 Systolic blood pressure 5e-17 GWAS_Catalog TagSNP rs12474446 GCST007267 Trans-ethnic association study of blood pressure determinants in over 750,000 individuals.
302 chr2 198950240 198950240 1 + G A rs1064213 198950240 - 198950220 198950260 41 AGTCTGAAAATTCATTGCTACAATCTGACAGCCACAATTCC AGTCTGAAAATTCATTGCTATAATCTGACAGCCACAATTCC Direct Gain 0 0.999961614608765 Functional Gain 0.999961614608765 PLCL1 ENSG00000115896 CDS Human protein_coding chr2:198950240 chr2:198950240 nonsynonymous SNV 0.996 3 21 hPsi_associated_SNPs_219058 0 30595370 Morning person 1e-11 GWAS_Catalog TagSNP rs1064213 GCST007083 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
303 chr2 220136351 220136351 1 + G A rs3731892 220136351 - 220136331 220136371 41 AACAGCTGCTCGTGGTATACCTTTTCTGCAGAGATGACTGG AACAGCTGCTCGTGGTATACTTTTTCTGCAGAGATGACTGG Direct Gain 0 0.991911292076111 Functional Gain 0.991911292076111 TUBA4B ENSG00000243910 ncRNA_exonic Human protein_coding chr2:220136351 chr2:220136351 . . 0 21 hPsi_associated_SNPs_219427 0 29953918 Serum folate levels 5e-06 GWAS_Catalog TagSNP rs3731892 GCST006137 Identification of three novel loci of ALDH2 Gene for Serum Folate levels in a Male Chinese Population by Genome-Wide Association Study.
304 chr2 223917983 223917983 1 + T A rs12621643 223917983 - 223917963 223918003 41 TCCGAGGTCTCCTCCAGCTCATCGTCTGCCCCCTCCTCCTG TCCGAGGTCTCCTCCAGCTCTTCGTCTGCCCCCTCCTCCTG Direct Gain 0 0.996270596981049 Functional Gain 0.996270596981049 KCNE4 ENSG00000152049 CDS Human protein_coding chr2:223917983 chr2:223917983 nonsynonymous SNV 0.961 0 21 hPsi_associated_SNPs_219500 0 19684603 Acute lymphoblastic leukemia (childhood) 3e-06 GWAS_Catalog TagSNP rs12621643 GCST000464 Germline genomic variants associated with childhood acute lymphoblastic leukemia.
305 chr3 21447336 21447336 1 + G A rs409974 21447336 - 21447316 21447356 41 CCGGGGGAGACGTCGGCAGGCCTGGGGGTGTGGGTCGACCC CCGGGGGAGACGTCGGCAGGTCTGGGGGTGTGGGTCGACCC Direct Gain 0 0.54961371421814 Functional Gain 0.54961371421814 VENTXP7 ENSG00000236380 ncRNA_exonic Human processed_pseudogene chr3:21447336 chr3:21447336 . . 0 21 hPsi_associated_SNPs_220324 0 24324551 QRS duration in Tripanosoma cruzi seropositivity 9e-06 GWAS_Catalog TagSNP rs409974 GCST002284 Genome wide association study (GWAS) of Chagas cardiomyopathy in Trypanosoma cruzi seropositive subjects.
306 chr3 38442490 38442490 1 + G A rs2070488 38442490 - 38442470 38442510 41 CAAATGCTACAAACAAATTCCGATGGTCTCTCACCTGAGAA CAAATGCTACAAACAAATTCTGATGGTCTCTCACCTGAGAA Direct Gain 0 0.606729388237 Functional Gain 0.606729388237 XYLB ENSG00000093217 intronic Human protein_coding chr3:38442490 chr3:38442490 . . 0 21 hPsi_associated_SNPs_220454 0 19389651 Electrocardiographic conduction measures 4e-06 GWAS_Catalog TagSNP rs2070488 GCST000344 Genome-wide association study of electrocardiographic conduction measures in an isolated founder population: Kosrae.
307 chr3 46402018 46402018 1 + G A rs743660 46402018 - 46401998 46402038 41 AAGCTTTGATTAGAAGCCAACTTGATTTAGGAGTTCCCACT AAGCTTTGATTAGAAGCCAATTTGATTTAGGAGTTCCCACT Direct Gain 0 0.997084736824036 Functional Gain 0.997084736824036 CCR2 ENSG00000121807 UTR3 Human protein_coding chr3:46402018 chr3:46402018 . . 0 21 hPsi_associated_SNPs_220673 0 17554300 Multiple complex diseases 5.61e-06 Johnson and O'Donnell TagSNP rs743660 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
308 chr3 57994398 57994398 1 + G A rs142568031 57994398 - 57994378 57994418 41 CGGTCTGCAGGTTGCCGATGCGTTTGTTCACGCACTTGAGG CGGTCTGCAGGTTGCCGATGTGTTTGTTCACGCACTTGAGG Direct Gain 0 0.912395596504211 Functional Gain 0.912395596504211 FLNB ENSG00000136068 CDS Human protein_coding chr3:57994398 chr3:57994398 nonsynonymous SNV 0.999 5 21 hPsi_associated_SNPs_220944 0 31217584 Height 5e-11 GWAS_Catalog TagSNP rs142568031 GCST008053 Genetic analyses of diverse populations improves discovery for complex traits.
309 chr3 58292131 58292131 1 + C A rs17059150 58292131 - 58292111 58292151 41 CACCTACCCACTCTTCGTCGGACTAGCCTGACGCCTGACCA CACCTACCCACTCTTCGTCGTACTAGCCTGACGCCTGACCA Direct Gain 0 0.987635135650635 Functional Gain 0.987635135650635 HTD2;RPP14 ENSG00000163684 UTR5 Human protein_coding chr3:58292131 chr3:58292131 . . 0 21 hPsi_associated_SNPs_220956 0 17554300 Multiple complex diseases 0.000735845 Johnson and O'Donnell TagSNP rs17059150 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
310 chr3 121796768 121796768 1 + G A rs9282641 121796768 - 121796748 121796788 41 AGGAGTATTTGCGAGCTCCCCGTACCTCCTAAGGCTCCTTG AGGAGTATTTGCGAGCTCCCTGTACCTCCTAAGGCTCCTTG Direct Gain 0 0.680949151515961 Functional Gain 0.680949151515961 CD86 ENSG00000114013 UTR5 Human protein_coding chr3:121796768 chr3:121796768 . . 0 21 hPsi_associated_SNPs_221411 0 27694959 Gut microbiota (functional units) 2e-06 GWAS_Catalog TagSNP rs9282641 GCST003854 The effect of host genetics on the gut microbiome.
311 chr3 122003045 122003045 1 + G A rs2036400 122003045 - 122003025 122003065 41 TCCTGGTTGCGGTAGCTTGACGGGGGCGCGGTGTAGAGCCA TCCTGGTTGCGGTAGCTTGATGGGGGCGCGGTGTAGAGCCA Direct Gain 0 0.996500432491302 Functional Gain 0.996500432491302 CASR ENSG00000036828 CDS Human protein_coding chr3:122003045 chr3:122003045 synonymous SNV . 0 21 hPsi_associated_SNPs_221419 0 17554300 Multiple complex diseases 6.42429e-05 Johnson and O'Donnell TagSNP rs2036400 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
312 chr3 122056432 122056432 1 + C A rs17589 122056432 - 122056412 122056452 41 TGCACAGCTTCCAATTTTCCGTAAGTCTCATTTGTTTTTTC TGCACAGCTTCCAATTTTCCTTAAGTCTCATTTGTTTTTTC Direct Gain 0 0.994826674461365 Functional Gain 0.994826674461365 CSTA ENSG00000121552 CDS Human protein_coding chr3:122056432 chr3:122056432 stopgain 0.000 1 21 hPsi_associated_SNPs_221427 0 17554300 Multiple complex diseases 0.000776826 Johnson and O'Donnell TagSNP rs17589 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
313 chr3 124351316 124351316 1 + G A rs1708303 124351316 - 124351296 124351336 41 GGCTGGGCCTGCAGGTTGGCCACGGACTCGGACTTGCCTCC GGCTGGGCCTGCAGGTTGGCTACGGACTCGGACTTGCCTCC Direct Gain 0 1 Functional Gain 1 KALRN ENSG00000160145 CDS Human protein_coding chr3:124351316 chr3:124351316 synonymous SNV . 0 21 hPsi_associated_SNPs_221482 0 17554300 Multiple complex diseases 9.3848e-05 Johnson and O'Donnell TagSNP rs1708303 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
314 chr3 124467247 124467247 1 + C A rs689449 124467247 - 124467227 124467267 41 TGCGGCCTTCCTTTGGAAGGGTTATGGGGAAAACAAAGGGA TGCGGCCTTCCTTTGGAAGGTTTATGGGGAAAACAAAGGGA Direct Gain 0 0.972555994987488 Functional Gain 0.972555994987488 UMPS ENSG00000272947 upstream Human other chr3:124467247 chr3:124467247 . . 0 21 hPsi_associated_SNPs_221504 1 27863252 Mean platelet volume 1e-19 GWAS_Catalog TagSNP rs689449 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
315 chr3 126261202 126261202 1 + G A rs1056524 126261202 - 126261182 126261222 41 AAGGCCGCGTCCTCCGCCAGCGTCTCGAACTTGCCCACGAC AAGGCCGCGTCCTCCGCCAGTGTCTCGAACTTGCCCACGAC Direct Gain 0 0.538982212543488 Functional Gain 0.538982212543488 CHST13 ENSG00000180767 CDS Human protein_coding chr3:126261202 chr3:126261202 synonymous SNV 0.284 0 21 hPsi_associated_SNPs_221530 0 29875488 Blood protein levels 8e-26 GWAS_Catalog TagSNP rs1056524 GCST005806 Genomic atlas of the human plasma proteome.
316 chr3 138122122 138122122 1 + C A rs9818870 138122122 - 138122102 138122142 41 TTTGACGTGTCAGTGTATTCGTATCAGAGAGGCACCAAGCA TTTGACGTGTCAGTGTATTCTTATCAGAGAGGCACCAAGCA Direct Gain 0 0.994607090950012 Functional Gain 0.994607090950012 MRAS ENSG00000158186 UTR3 Human protein_coding chr3:138122122 chr3:138122122 . . 0 21 hPsi_associated_SNPs_221794 0 24262325 Coronary artery disease 1e-07 GWAS_Catalog TagSNP rs9818870 GCST002289 Shared genetic susceptibility to ischemic stroke and coronary artery disease: a genome-wide analysis of common variants.
317 chr3 138347957 138347957 1 + G A rs641320 138347957 - 138347937 138347977 41 ATTGCACCATACGTCCATAGCATCTTTTTCTGTAAAGGTAA ATTGCACCATACGTCCATAGTATCTTTTTCTGTAAAGGTAA Direct Gain 0 0.990576028823853 Functional Gain 0.990576028823853 FAIM ENSG00000158234 CDS Human protein_coding chr3:138347957 chr3:138347957 nonsynonymous SNV 0.993 0 21 hPsi_associated_SNPs_221806 0 30072576 Blood protein levels 8e-07 GWAS_Catalog TagSNP rs641320 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
318 chr3 150128392 150128392 1 + G A rs879634 150128392 - 150128372 150128412 41 CTGCGCGCCCACCGAGGAAGCATTCTGGCCGGTGCCCACGG CTGCGCGCCCACCGAGGAAGTATTCTGGCCGGTGCCCACGG Direct Gain 0 0.998121023178101 Functional Gain 0.998121023178101 TSC22D2 ENSG00000196428 CDS Human protein_coding chr3:150128392 chr3:150128392 nonsynonymous SNV 0.001 0 21 hPsi_associated_SNPs_221902 0 27618447 Systolic blood pressure 8e-06 GWAS_Catalog TagSNP rs879634 GCST006021 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
319 chr3 152018102 152018102 1 + G A rs74497536 152018102 - 152018082 152018122 41 TTTTCAACTTGGCAGCTTTTCGAAGGATGTGCAAATTTACA TTTTCAACTTGGCAGCTTTTTGAAGGATGTGCAAATTTACA Direct Gain 0 0.811775922775269 Functional Gain 0.811775922775269 MBNL1 ENSG00000152601 CDS Human protein_coding chr3:152018102 chr3:152018102 synonymous SNV . 0 21 hPsi_associated_SNPs_221932 0 30595370 White blood cell count 2e-09 GWAS_Catalog TagSNP rs74497536 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
320 chr3 190347681 190347681 1 + C A rs1024948 190347681 - 190347661 190347701 41 CAATCTTTTTTATGACTCTTGAAGTCTACCATGAATGATTT CAATCTTTTTTATGACTCTTTAAGTCTACCATGAATGATTT Direct Gain 0 0.995255589485168 Functional Gain 0.995255589485168 IL1RAP ENSG00000196083 UTR3 Human protein_coding chr3:190347681 chr3:190347681 . . 0 21 hPsi_associated_SNPs_222350 0 28240269 Blood protein levels 3e-165 GWAS_Catalog TagSNP rs1024948 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
321 chr4 1244218 1244218 1 + G A rs79407053 1244218 - 1244198 1244238 41 TGCCCCTCCCCCTACAAGGGCTCCACACGTGTTCCCTCCTT TGCCCCTCCCCCTACAAGGGTTCCACACGTGTTCCCTCCTT Direct Gain 0 0.864888906478882 Functional Gain 0.864888906478882 CTBP1-AS2 ENSG00000196810 ncRNA_exonic Human antisense chr4:1244218 chr4:1244218 . . 0 21 hPsi_associated_SNPs_222623 0 30718926 Type 2 diabetes 1e-24 GWAS_Catalog TagSNP rs79407053 GCST007847 Identification of 28 new susceptibility loci for type 2 diabetes in the Japanese population.
322 chr4 3444503 3444503 1 + G A rs2073505 3444503 - 3444483 3444523 41 GTCACCAGGATAGTGGGGATCGCAGGGGTCGCTGTGGCATT GTCACCAGGATAGTGGGGATTGCAGGGGTCGCTGTGGCATT Direct Gain 0 0.690006375312805 Functional Gain 0.690006375312805 HGFAC ENSG00000109758 CDS Human protein_coding chr4:3444503 chr4:3444503 synonymous SNV . 0 21 hPsi_associated_SNPs_222810 0 26192919 Inflammatory bowel disease 1e-07 GWAS_Catalog TagSNP rs2073505 GCST003043 Association analyses identify 38 susceptibility loci for inflammatory bowel disease and highlight shared genetic risk across populations.
323 chr4 6303022 6303022 1 + C A rs1801214 6303022 - 6303002 6303042 41 AGCAGGCACGGGACGCTGACGTTGAGGACGACCAGGTGGCC AGCAGGCACGGGACGCTGACTTTGAGGACGACCAGGTGGCC Direct Gain 0 0.923814713954926 Functional Gain 0.923814713954926 WFS1 ENSG00000109501 CDS Human protein_coding chr4:6303022 chr4:6303022 nonsynonymous SNV 0.009 2 21 hPsi_associated_SNPs_222906 0 22885922 Type 2 diabetes 3e-12 GWAS_Catalog TagSNP rs1801214 GCST005047 Large-scale association analysis provides insights into the genetic architecture and pathophysiology of type 2 diabetes.
324 chr4 31147874 31147874 1 + G A rs1044352 31147874 - 31147854 31147894 41 TGTTTTTGGATGGCTGTTTGCTTCTTGACAATTTCTTCTGG TGTTTTTGGATGGCTGTTTGTTTCTTGACAATTTCTTCTGG Direct Gain 0 0.827080249786377 Functional Gain 0.827080249786377 PCDH7 ENSG00000169851 UTR3 Human protein_coding chr4:31147874 chr4:31147874 . . 0 21 hPsi_associated_SNPs_223184 0 25087078 Epilepsy 2e-07 GWAS_Catalog TagSNP rs1044352 GCST002547 Genetic determinants of common epilepsies: a meta-analysis of genome-wide association studies.
325 chr4 39699701 39699701 1 + G A rs28450192 39699701 - 39699681 39699721 41 CCGGGCGGCGCAGCCGCTCCCGTTGGAGCCCCCATACGCCC CCGGGCGGCGCAGCCGCTCCTGTTGGAGCCCCCATACGCCC Direct Gain 0 0.885901749134064 Functional Gain 0.885901749134064 UBE2K ENSG00000078140 UTR5 Human protein_coding chr4:39699701 chr4:39699701 . . 0 21 hPsi_associated_SNPs_223252 0 30038396 Educational attainment (years of education) 3e-09 GWAS_Catalog TagSNP rs28450192 GCST006442 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
326 chr4 57798189 57798189 1 + G A rs2227901 57798189 - 57798169 57798209 41 CAAACAAAATCTCCCTTAGCCGCTTTGACTGCCAAGGCTTC CAAACAAAATCTCCCTTAGCTGCTTTGACTGCCAAGGCTTC Direct Gain 0 0.679011166095734 Functional Gain 0.679011166095734 REST ENSG00000084093 CDS Human protein_coding chr4:57798189 chr4:57798189 synonymous SNV . 0 21 hPsi_associated_SNPs_223426 0 25429064 Height 3e-09 GWAS_Catalog TagSNP rs2227901 GCST002702 Meta-analysis of genome-wide association studies of adult height in East Asians identifies 17 novel loci.
327 chr4 77675505 77675505 1 + C A rs3733242 77675505 - 77675485 77675525 41 GGGTGAGATGGTGGAAGAGCGGCAGCATCTCTTCTTGGCCT GGGTGAGATGGTGGAAGAGCTGCAGCATCTCTTCTTGGCCT Direct Gain 0 0.899533867835999 Functional Gain 0.899533867835999 SHROOM3 ENSG00000138771 CDS Human protein_coding chr4:77675505 chr4:77675505 nonsynonymous SNV 0.000 0 21 hPsi_associated_SNPs_223598 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 6.8e-06 Johnson and O'Donnell TagSNP rs3733242 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
328 chr4 102839287 102839287 1 + G A rs3733197 102839287 - 102839267 102839307 41 ATGCCTTTCAGCAATATGTGCGGGGTCTGAACCCTCCATAT ATGCCTTTCAGCAATATGTGTGGGGTCTGAACCCTCCATAT Direct Gain 0 0.938633561134338 Functional Gain 0.938633561134338 BANK1 ENSG00000153064 CDS Human protein_coding chr4:102839287 chr4:102839287 nonsynonymous SNV 0.004 1 21 hPsi_associated_SNPs_223847 0 18204447 Systemic lupus erythematosus 4.67e-05 Johnson and O'Donnell TagSNP rs3733197 . Functional variants in the B-cell gene BANK1 are associated with systemic lupus erythematosus.
329 chr4 111431444 111431444 1 + G A rs33966350 111431444 - 111431424 111431464 41 AAGCAAATCCTTCATTTAGCCACAAGTCTTCCCACCAGTCC AAGCAAATCCTTCATTTAGCTACAAGTCTTCCCACCAGTCC Direct Gain 0 0.983870148658752 Functional Gain 0.983870148658752 ENPEP ENSG00000138792 CDS Human protein_coding chr4:111431444 chr4:111431444 stopgain 1.000 1 21 hPsi_associated_SNPs_223928 0 28135244 Systolic blood pressure 2e-11 GWAS_Catalog TagSNP rs33966350 GCST004279 Genome-wide association analysis identifies novel blood pressure loci and offers biological insights into cardiovascular risk.
330 chr4 142654084 142654084 1 + C A rs10519613 142654084 - 142654064 142654104 41 CTTGTTTTGACAGCACATTTGAAATGCCGAGTGTTTTGTTA CTTGTTTTGACAGCACATTTTAAATGCCGAGTGTTTTGTTA Direct Gain 0 0.997726619243622 Functional Gain 0.997726619243622 IL15 ENSG00000164136 UTR3 Human protein_coding chr4:142654084 chr4:142654084 . . 0 21 hPsi_associated_SNPs_224162 0 17463246 Multiple continuous traits in DGI samples 0.0001129 Johnson and O'Donnell TagSNP rs10519613 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
331 chr5 14610309 14610309 1 + C A rs16903574 14610309 - 14610289 14610329 41 AAGTCTCTGGAGTTAAACTTGAACAGTCTGAACACTTTTAT AAGTCTCTGGAGTTAAACTTTAACAGTCTGAACACTTTTAT Direct Gain 0 0.531431257724762 Functional Gain 0.531431257724762 FAM105A ENSG00000145569 CDS Human protein_coding chr5:14610309 chr5:14610309 nonsynonymous SNV 1.000 0 21 hPsi_associated_SNPs_224700 0 30595370 Eczema 2e-09 GWAS_Catalog TagSNP rs16903574 GCST007075 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
332 chr5 38919158 38919158 1 + G A rs10941412 38919158 - 38919138 38919178 41 GAAAACAAACTCACTGTTTTCGGGGTCTGCAGAGATGACTA GAAAACAAACTCACTGTTTTTGGGGTCTGCAGAGATGACTA Direct Gain 0 0.739291667938232 Functional Gain 0.739291667938232 OSMR ENSG00000145623 CDS Human protein_coding chr5:38919158 chr5:38919158 nonsynonymous SNV 0.004 1 21 hPsi_associated_SNPs_224872 0 17554300 Multiple complex diseases 0.000342266 Johnson and O'Donnell TagSNP rs10941412 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
333 chr5 52096889 52096889 1 + C A rs1499280 52096889 - 52096869 52096909 41 CTTCACTGCTTGTTGAAACAGGTAGTCGCAGAACTGCTCCC CTTCACTGCTTGTTGAAACATGTAGTCGCAGAACTGCTCCC Direct Gain 0 0.722279191017151 Functional Gain 0.722279191017151 PELO ENSG00000152684 CDS Human protein_coding chr5:52096889 chr5:52096889 nonsynonymous SNV 1.000 0 21 hPsi_associated_SNPs_224923 0 27863252 Reticulocyte fraction of red cells 5e-33 GWAS_Catalog TagSNP rs1499280 GCST004619 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
334 chr5 52214581 52214581 1 + G A rs2279587 52214581 - 52214561 52214601 41 AAAATTCATGGTCACTTTAACTACGGCCACATCTCGGGACC AAAATTCATGGTCACTTTAATTACGGCCACATCTCGGGACC Direct Gain 0 0.997311055660248 Functional Gain 0.997311055660248 ITGA1 ENSG00000213949 CDS Human protein_coding chr5:52214581 chr5:52214581 nonsynonymous SNV 1.000 1 21 hPsi_associated_SNPs_224931 0 17641165 HIV-1 disease progression 0.0007962 Johnson and O'Donnell TagSNP rs2279587 . A whole-genome association study of major determinants for host control of HIV-1.
335 chr5 70834892 70834892 1 + C A rs35131626 70834892 - 70834872 70834912 41 CAGTTACCTGGTTCATCTTGGATATGTTCACTTGTGGTCAT CAGTTACCTGGTTCATCTTGTATATGTTCACTTGTGGTCAT Direct Gain 0 0.998444736003876 Functional Gain 0.998444736003876 BDP1 ENSG00000145734 CDS Human protein_coding chr5:70834892 chr5:70834892 synonymous SNV . 0 21 hPsi_associated_SNPs_225126 0 23251661 Obesity-related traits 9e-06 GWAS_Catalog TagSNP rs35131626 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
336 chr5 72112421 72112421 1 + T A rs34648 72112421 - 72112401 72112441 41 GCGGAGCCCGCGGCGGGAACATTCGGCGGCGGTCGCCTTGG GCGGAGCCCGCGGCGGGAACTTTCGGCGGCGGTCGCCTTGG Direct Gain 0 0.946169972419739 Functional Gain 0.946169972419739 TNPO1 ENSG00000083312 UTR5 Human protein_coding chr5:72112421 chr5:72112421 . . 0 21 hPsi_associated_SNPs_225151 0 30595370 White blood cell count 4e-08 GWAS_Catalog TagSNP rs34648 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
337 chr5 73153552 73153552 1 + G A rs115243197 73153552 - 73153532 73153572 41 TCATGAGGAAACTGAAAGTTCGACTCACTTTATATTTTTCA TCATGAGGAAACTGAAAGTTTGACTCACTTTATATTTTTCA Direct Gain 0 0.987031579017639 Functional Gain 0.987031579017639 ARHGEF28 ENSG00000214944 CDS Human protein_coding chr5:73153552 chr5:73153552 nonsynonymous SNV 0.997 3 21 hPsi_associated_SNPs_225179 1 30595370 Lung function (FEV1/FVC) 1e-10 GWAS_Catalog TagSNP rs115243197 GCST007080 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
338 chr5 77774498 77774498 1 + T A rs6874309 77774498 - 77774478 77774518 41 AACAGCAATAGGTAGCAAGGATAGAAATCAGAATACAAGTT AACAGCAATAGGTAGCAAGGTTAGAAATCAGAATACAAGTT Direct Gain 0 0.996824026107788 Functional Gain 0.996824026107788 SCAMP1 ENSG00000085365 UTR3 Human protein_coding chr5:77774498 chr5:77774498 . . 0 21 hPsi_associated_SNPs_225232 0 17463246 Multiple continuous traits in DGI samples 0.0007565 Johnson and O'Donnell TagSNP rs6874309 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
339 chr5 99897866 99897866 1 + G A rs6874840 99897866 - 99897846 99897886 41 GGATGATTGGCATCAAACAACGTGTTGTCATCATCCTCATC GGATGATTGGCATCAAACAATGTGTTGTCATCATCCTCATC Direct Gain 0 0.985507607460022 Functional Gain 0.985507607460022 FAM174A ENSG00000174132 CDS Human protein_coding chr5:99897866 chr5:99897866 synonymous SNV . 0 21 hPsi_associated_SNPs_225422 0 17554300 Multiple complex diseases 1.66e-05 Johnson and O'Donnell TagSNP rs6874840 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
340 chr5 122435627 122435627 1 + G A rs1008058 122435627 - 122435607 122435647 41 ATGCTGCGTGTTCCTCACGGCGCCTGCCTGCACCTTCTCTG ATGCTGCGTGTTCCTCACGGTGCCTGCCTGCACCTTCTCTG Direct Gain 0 0.755704283714294 Functional Gain 0.755704283714294 PRDM6 ENSG00000061455 CDS Human protein_coding chr5:122435627 chr5:122435627 nonsynonymous SNV 0.950 0 21 hPsi_associated_SNPs_225583 0 27618447 Diastolic blood pressure 7e-06 GWAS_Catalog TagSNP rs1008058 GCST006020 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
341 chr5 131656700 131656700 1 + T A rs270602 131656700 - 131656680 131656720 41 GCACCAGATGGGAGTCCAAGAACAAAGCTCCTTCTCTTGTC GCACCAGATGGGAGTCCAAGTACAAAGCTCCTTCTCTTGTC Direct Gain 0 0.999344646930695 Functional Gain 0.999344646930695 MIR3936HG ENSG00000233006 ncRNA_intronic Human processed_transcript chr5:131656700 chr5:131656700 . . 0 21 hPsi_associated_SNPs_225655 0 26068415 Acylcarnitine levels 2e-15 GWAS_Catalog TagSNP rs270602 GCST002961 Genome-wide association study identifies novel genetic variants contributing to variation in blood metabolite levels.
342 chr5 139545748 139545748 1 + G A rs4463213 139545748 - 139545728 139545768 41 GTCCTGCCCCCTCCCCTCCCCAGCCTGGAAGGTATGGAGTC GTCCTGCCCCCTCCCCTCCCTAGCCTGGAAGGTATGGAGTC Direct Gain 0 0.84667694568634 Functional Gain 0.84667694568634 LOC101929719 ENSG00000254363 ncRNA_exonic Human processed_transcript chr5:139545748 chr5:139545748 . . 0 21 hPsi_associated_SNPs_225784 0 30038396 Cognitive performance 3e-14 GWAS_Catalog TagSNP rs4463213 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
343 chr5 140552774 140552774 1 + G A rs17286891 140552774 - 140552754 140552794 41 GATGTCTCTGACCCATAGTTCAGCACGGAAAATCTGAAAAG GATGTCTCTGACCCATAGTTTAGCACGGAAAATCTGAAAAG Direct Gain 0 0.999166965484619 Functional Gain 0.999166965484619 PCDHB7 ENSG00000113212 CDS Human protein_coding chr5:140552774 chr5:140552774 nonsynonymous SNV 0.870 1 21 hPsi_associated_SNPs_225920 0 17634449 Coronary Artery Disease 0.0005744 Johnson and O'Donnell TagSNP rs17286891 . Genomewide association analysis of coronary artery disease.
344 chr5 148787469 148787469 1 + G A rs368510 148787469 - 148787449 148787489 41 GCTCAACCTCCAAAAGCTCCCACAGGACTTCATCTGCTTGG GCTCAACCTCCAAAAGCTCCTACAGGACTTCATCTGCTTGG Direct Gain 0 0.948595404624939 Functional Gain 0.948595404624939 CARMN ENSG00000253864 ncRNA_exonic Human other chr5:148787469 chr5:148787469 . . 0 21 hPsi_associated_SNPs_226189 0 28869591 Heel bone mineral density 9e-09 GWAS_Catalog TagSNP rs368510 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
345 chr5 148800089 148800089 1 + G A rs17796714 148800089 - 148800069 148800109 41 ACCTGTGCACTTGTTACAGCCGTTGCTCTCCTTGGGCTCCA ACCTGTGCACTTGTTACAGCTGTTGCTCTCCTTGGGCTCCA Direct Gain 0 0.601505160331726 Functional Gain 0.601505160331726 CARMN ENSG00000249669 ncRNA_exonic Human lincRNA chr5:148800089 chr5:148800089 . . 0 21 hPsi_associated_SNPs_226202 0 17998437 Alzheimer's disease 6.71e-05 Johnson and O'Donnell TagSNP rs17796714 . Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.
346 chr6 3114947 3114947 1 + G A rs17548315 3114947 - 3114927 3114967 41 TACCCAGGCCGAGATGCCGACAGTGGCAAGGCTGAGACAGC TACCCAGGCCGAGATGCCGATAGTGGCAAGGCTGAGACAGC Direct Gain 0 0.968091130256653 Functional Gain 0.968091130256653 RIPK1 ENSG00000137275 UTR3 Human protein_coding chr6:3114947 chr6:3114947 . . 0 21 hPsi_associated_SNPs_226854 0 30718454 Depressive symptoms x independent stressful life events interaction (1df test) 3e-06 GWAS_Catalog TagSNP rs17548315 GCST007412 Genome-wide by environment interaction studies of depressive symptoms and psychosocial stress in UK Biobank and Generation Scotland.
347 chr6 7216484 7216484 1 + G A rs1413700 7216484 - 7216464 7216504 41 GAATCTGAGGGAAATGTGCCCTCCTGGGCCCTGAACTCACC GAATCTGAGGGAAATGTGCCTTCCTGGGCCCTGAACTCACC Direct Gain 0 0.863165676593781 Functional Gain 0.863165676593781 RREB1 ENSG00000124782 intronic Human protein_coding chr6:7216484 chr6:7216484 . . 0 21 hPsi_associated_SNPs_226916 0 27629089 Multiple system atrophy 3e-06 GWAS_Catalog TagSNP rs1413700 GCST003784 A genome-wide association study in multiple system atrophy.
348 chr6 7231843 7231843 1 + G A rs9379084 7231843 - 7231823 7231863 41 CTCCCCGCTGGAGTCCAGGTCCACCCCGCCGCTGTTGGCGC CTCCCCGCTGGAGTCCAGGTTCACCCCGCCGCTGTTGGCGC Direct Gain 0 0.999772965908051 Functional Gain 0.999772965908051 RREB1 ENSG00000124782 CDS Human protein_coding chr6:7231843 chr6:7231843 nonsynonymous SNV 0.974 4 21 hPsi_associated_SNPs_226922 0 28869591 Heel bone mineral density 6e-09 GWAS_Catalog TagSNP rs9379084 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
349 chr6 7247344 7247344 1 + C A rs35742417 7247344 - 7247324 7247364 41 TGCTGGCCACGCTTTTGGGGGAGTCTGTCTTTGGTTTCTTG TGCTGGCCACGCTTTTGGGGTAGTCTGTCTTTGGTTTCTTG Direct Gain 0 0.999101400375366 Functional Gain 0.999101400375366 RREB1 ENSG00000124782 CDS Human protein_coding chr6:7247344 chr6:7247344 nonsynonymous SNV 0.953 1 21 hPsi_associated_SNPs_226926 0 25625282 Fasting blood glucose adjusted for BMI 8e-09 GWAS_Catalog TagSNP rs35742417 GCST007858 Identification and functional characterization of G6PC2 coding variants influencing glycemic traits define an effector transcript at the G6PC2-ABCB11 locus.
350 chr6 7581636 7581636 1 + G A rs6929069 7581636 - 7581616 7581656 41 TATCACTGTCCGCTTCGCTTCGTCCTCTCCTCAGGTCATCG TATCACTGTCCGCTTCGCTTTGTCCTCTCCTCAGGTCATCG Direct Gain 0 0.995080888271332 Functional Gain 0.995080888271332 DSP ENSG00000096696 CDS Human protein_coding chr6:7581636 chr6:7581636 nonsynonymous SNV 0.272 0 21 hPsi_associated_SNPs_226937 6 16252231 Parkinson's disease 0.009899 Johnson and O'Donnell TagSNP rs6929069 . High-resolution whole-genome association study of Parkinson disease.
351 chr6 12124855 12124855 1 + G A rs2228213 12124855 - 12124835 12124875 41 AGCAGAGGATGCGAATTAGACATGCTGTCAATTAATTTGGT AGCAGAGGATGCGAATTAGATATGCTGTCAATTAATTTGGT Direct Gain 0 0.999399065971375 Functional Gain 0.999399065971375 HIVEP1 ENSG00000095951 CDS Human protein_coding chr6:12124855 chr6:12124855 nonsynonymous SNV 0.002 0 21 hPsi_associated_SNPs_227003 0 28892062 Body mass index 1e-10 GWAS_Catalog TagSNP rs2228213 GCST004904 Genome-wide association study identifies 112 new loci for body mass index in the Japanese population.
352 chr6 26093141 26093141 1 + G A rs1800562 26093141 - 26093121 26093161 41 GGCCTGGGTGCTCCACCTGGCACGTATATCTCTGCTCTTCC GGCCTGGGTGCTCCACCTGGTACGTATATCTCTGCTCTTCC Direct Gain 0 0.957766890525818 Functional Gain 0.957766890525818 HFE ENSG00000010704 CDS Human protein_coding chr6:26093141 chr6:26093141 nonsynonymous SNV 0.895 5 21 hPsi_associated_SNPs_227169 13 21785125 Hepcidin levels 3e-07 GWAS_Catalog TagSNP rs1800562 GCST001174 Association of HFE and TMPRSS6 genetic variants with iron and erythrocyte parameters is only in part dependent on serum hepcidin concentrations.
353 chr6 26463574 26463574 1 + G A rs13195401 26463574 - 26463554 26463594 41 CCCCACCGTAGGGGTCCCTCCACACTGTGAGGGGCTTTGGG CCCCACCGTAGGGGTCCCTCTACACTGTGAGGGGCTTTGGG Direct Gain 0 0.984253883361816 Functional Gain 0.984253883361816 BTN2A1 ENSG00000112763 CDS Human protein_coding chr6:26463574 chr6:26463574 stopgain 0.050 1 21 hPsi_associated_SNPs_227238 0 30643256 Well-being spectrum (multivariate analysis) 5e-18 GWAS_Catalog TagSNP rs13195401 GCST007341 Multivariate genome-wide analyses of the well-being spectrum.
354 chr6 26468326 26468326 1 + G A rs3734542 26468326 - 26468306 26468346 41 TCCCTGAAGCGAAGCTCTCCCGGCCTAGGACACAAGGCTGA TCCCTGAAGCGAAGCTCTCCTGGCCTAGGACACAAGGCTGA Direct Gain 0 0.928436756134033 Functional Gain 0.928436756134033 BTN2A1 ENSG00000112763 CDS Human protein_coding chr6:26468326 chr6:26468326 nonsynonymous SNV 0.049 0 21 hPsi_associated_SNPs_227239 0 28604730 Lung cancer in ever smokers 3e-07 GWAS_Catalog TagSNP rs3734542 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
355 chr6 27777349 27777349 1 + G A rs116237381 27777349 - 27777329 27777369 41 GCAATACTGGACAGGACAGCCTTATACACCTGTCCCCTCAA GCAATACTGGACAGGACAGCTTTATACACCTGTCCCCTCAA Direct Gain 0 0.974221765995026 Functional Gain 0.974221765995026 HIST1H3H;HIST1H2AI ENSG00000203813;ENSG00000196747 upstream;downstream Human other chr6:27777349 chr6:27777349 . . 0 21 hPsi_associated_SNPs_227314 0 27989323 Fibroblast growth factor basic levels 1e-06 GWAS_Catalog TagSNP rs116237381 GCST004459 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
356 chr6 29696209 29696209 1 + G A rs1736921 29696209 - 29696189 29696229 41 GCTGACCTGATGAATATCAACATCCAATGCCCTGTAATGAA GCTGACCTGATGAATATCAATATCCAATGCCCTGTAATGAA Direct Gain 0 0.979673624038696 Functional Gain 0.979673624038696 HLA-F-AS1 ENSG00000214922 ncRNA_exonic Human processed_transcript chr6:29696209 chr6:29696209 . . 0 21 hPsi_associated_SNPs_227410 0 17554300 Multiple complex diseases 6.46e-06 Johnson and O'Donnell TagSNP rs1736921 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
357 chr6 30036471 30036471 1 + C A rs2074482 30036471 - 30036451 30036491 41 GCCAACAATTACTCACATTTGGATGAGCGGCGGCCCATGTG GCCAACAATTACTCACATTTTGATGAGCGGCGGCCCATGTG Direct Gain 0 0.899206399917603 Functional Gain 0.899206399917603 PPP1R11 ENSG00000204619 CDS Human protein_coding chr6:30036471 chr6:30036471 synonymous SNV . 0 21 hPsi_associated_SNPs_227506 0 17554300 Multiple complex diseases 2.17e-05 Johnson and O'Donnell TagSNP rs2074482 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
358 chr6 30139699 30139699 1 + G A rs929156 30139699 - 30139679 30139719 41 GCAGGGGGCTGTCTGGCAGGCTCTTCTTCTGCCGGGTGTAC GCAGGGGGCTGTCTGGCAGGTTCTTCTTCTGCCGGGTGTAC Direct Gain 0 0.889179587364197 Functional Gain 0.889179587364197 TRIM15 ENSG00000204610 CDS Human protein_coding chr6:30139699 chr6:30139699 nonsynonymous SNV 0.005 0 21 hPsi_associated_SNPs_227513 0 17804836 Rheumatoid Arthritis 2.95e-13 Johnson and O'Donnell TagSNP rs929156 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
359 chr6 30232953 30232953 1 + G A rs3094629 30232953 - 30232933 30232973 41 AAAGTCTAGAACTCCCTGGTCTATGTACCTTCTAGATGTGG AAAGTCTAGAACTCCCTGGTTTATGTACCTTCTAGATGTGG Direct Gain 0 0.645458579063416 Functional Gain 0.645458579063416 HLA-L ENSG00000243753 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr6:30232953 chr6:30232953 . . 0 21 hPsi_associated_SNPs_227519 0 17554300 Multiple complex diseases 1.5e-10 Johnson and O'Donnell TagSNP rs3094629 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
360 chr6 30234668 30234668 1 + T A rs2844764 30234668 - 30234648 30234688 41 GGAAAAAGGCTTTCAAGTAAACATTTTACCATCACACAATG GGAAAAAGGCTTTCAAGTAATCATTTTACCATCACACAATG Direct Gain 0 0.999977707862854 Functional Gain 0.999977707862854 HLA-L ENSG00000243753 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr6:30234668 chr6:30234668 . . 0 21 hPsi_associated_SNPs_227521 0 17554300 Multiple complex diseases 1.02e-07 Johnson and O'Donnell TagSNP rs2844764 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
361 chr6 30234721 30234721 1 + G A rs3129705 30234721 - 30234701 30234741 41 CCTCTGATGTCTTACAGATACGGGTTTTTAATCCTAGCAAG CCTCTGATGTCTTACAGATATGGGTTTTTAATCCTAGCAAG Direct Gain 0 0.672340095043182 Functional Gain 0.672340095043182 HLA-L ENSG00000243753 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr6:30234721 chr6:30234721 . . 0 21 hPsi_associated_SNPs_227522 0 17554300 Multiple complex diseases 2.37e-11 Johnson and O'Donnell TagSNP rs3129705 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
362 chr6 30920890 30920890 1 + G A rs2240804 30920890 - 30920870 30920910 41 GGCGCCTACTCCAAGATCACCGTGGGGAAGGGATCTGGCCC GGCGCCTACTCCAAGATCACTGTGGGGAAGGGATCTGGCCC Direct Gain 0 0.994390487670898 Functional Gain 0.994390487670898 DPCR1 ENSG00000168631 CDS Human protein_coding chr6:30920890 chr6:30920890 nonsynonymous SNV 0.309 0 21 hPsi_associated_SNPs_227565 0 17804836 Rheumatoid Arthritis 4.87e-12 Johnson and O'Donnell TagSNP rs2240804 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
363 chr6 31367865 31367865 1 + G A rs2523454 31367865 - 31367845 31367885 41 GCGTGATCTGGAATCCGGCTCTCTTGAAACAGCACCGCGGA GCGTGATCTGGAATCCGGCTTTCTTGAAACAGCACCGCGGA Direct Gain 0 0.998237133026123 Functional Gain 0.998237133026123 MICA ENSG00000206337 upstream Human sense_overlapping chr6:31367865 chr6:31367865 . . 0 21 hPsi_associated_SNPs_227609 0 17632545 Type I Diabetes 3.33e-16 Johnson and O'Donnell TagSNP rs2523454 . A genome-wide association study identifies KIAA0350 as a type 1 diabetes gene.
364 chr6 31497835 31497835 1 + G A rs3115537 31497835 - 31497815 31497855 41 CTGCCTGCCAATTGCCTGCGCTTTGTGGTCTCTTCCACTTT CTGCCTGCCAATTGCCTGCGTTTTGTGGTCTCTTCCACTTT Direct Gain 0 0.572629153728485 Functional Gain 0.572629153728485 MCCD1 ENSG00000204511 UTR3 Human protein_coding chr6:31497835 chr6:31497835 . . 0 21 hPsi_associated_SNPs_227638 0 17554300 Multiple complex diseases 1.34e-06 Johnson and O'Donnell TagSNP rs3115537 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
365 chr6 31556581 31556581 1 + T A rs1052248 31556581 - 31556561 31556601 41 ATAAGTTTTGATGATGATCAATTTGAACGGAGGCTCGAGAT ATAAGTTTTGATGATGATCATTTTGAACGGAGGCTCGAGAT Direct Gain 0 0.620721936225891 Functional Gain 0.620721936225891 LST1 ENSG00000204482 UTR3 Human protein_coding chr6:31556581 chr6:31556581 . . 0 21 hPsi_associated_SNPs_227645 0 28928442 Tonsillectomy 3e-17 GWAS_Catalog TagSNP rs1052248 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
366 chr6 31639757 31639757 1 + G A rs805267 31639757 - 31639737 31639777 41 TGACCAGGAGTTGCAATAATCGTACTGACAGCACTGGGCCT TGACCAGGAGTTGCAATAATTGTACTGACAGCACTGGGCCT Direct Gain 0 0.90628057718277 Functional Gain 0.90628057718277 LY6G5B ENSG00000240053;ENSG00000263020 CDS Human other chr6:31639757 chr6:31639757 nonsynonymous SNV 0.960 0 21 hPsi_associated_SNPs_227653 0 17554300 Multiple complex diseases 0.000255189 Johnson and O'Donnell TagSNP rs805267 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
367 chr6 31675765 31675765 1 + G A rs2242653 31675765 - 31675745 31675785 41 AGAAGGACTGAACACGGCCCCTCACGGGACCCTTCCCTTCC AGAAGGACTGAACACGGCCCTTCACGGGACCCTTCCCTTCC Direct Gain 0 0.795334815979004 Functional Gain 0.795334815979004 LY6G6F ENSG00000204424;ENSG00000250641 CDS Human other chr6:31675765 chr6:31675765 nonsynonymous SNV 0.540 0 21 hPsi_associated_SNPs_227655 0 17804836 Rheumatoid Arthritis 6.17e-11 Johnson and O'Donnell TagSNP rs2242653 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
368 chr6 31903804 31903804 1 + G A rs9332739 31903804 - 31903784 31903824 41 TTTTCCAGGCTGCTGATCACCTCAGTCATATCCCGGGAGTT TTTTCCAGGCTGCTGATCACTTCAGTCATATCCCGGGAGTT Direct Gain 0 0.999776721000671 Functional Gain 0.999776721000671 C2 ENSG00000166278 CDS Human protein_coding chr6:31903804 chr6:31903804 synonymous SNV . 0 21 hPsi_associated_SNPs_227671 0 22705344 Age-related macular degeneration (choroidal neovascularisation) 2e-08 GWAS_Catalog TagSNP rs9332739 GCST001579 Heritability and genome-wide association study to assess genetic differences between advanced age-related macular degeneration subtypes.
369 chr6 32134510 32134510 1 + G A rs3096697 32134510 - 32134490 32134530 41 GGGTCTGCTGAACCTCCCGCCTCACCTCCCGCCACATAACG GGGTCTGCTGAACCTCCCGCTTCACCTCCCGCCACATAACG Direct Gain 0 0.988263249397278 Functional Gain 0.988263249397278 EGFL8 ENSG00000241404 CDS Human protein_coding chr6:32134510 chr6:32134510 nonsynonymous SNV 0.994 0 21 hPsi_associated_SNPs_227694 0 21323541 Idiopathic membranous nephropathy 1e-41 GWAS_Catalog TagSNP rs3096697 GCST000984 Risk HLA-DQA1 and PLA(2)R1 alleles in idiopathic membranous nephropathy.
370 chr6 32612161 32612161 1 + C A rs9273062 32612161 - 32612141 32612181 41 GCTTCAAAGTACTGAGTCCTGGATTTGGATTTAGGGTTCTT GCTTCAAAGTACTGAGTCCTTGATTTGGATTTAGGGTTCTT Direct Gain 0 0.999125599861145 Functional Gain 0.999125599861145 HLA-DQA1 ENSG00000196735 downstream Human protein_coding chr6:32612161 chr6:32612161 . . 0 21 hPsi_associated_SNPs_227750 0 29534301 Response to hepatitis B vaccine 2e-10 GWAS_Catalog TagSNP rs9273062 GCST005606 Key HLA-DRB1-DQB1 haplotypes and role of the BTNL2 gene for response to a hepatitis B vaccine.
371 chr6 33055605 33055605 1 + G A rs9277555 33055605 - 33055585 33055625 41 TCTTTCCTGACTCCCTGACTCAGTCCAGCCTCTCTGCAGAC TCTTTCCTGACTCCCTGACTTAGTCCAGCCTCTCTGCAGAC Direct Gain 0 0.986810326576233 Functional Gain 0.986810326576233 HLA-DPB1 ENSG00000223865 downstream Human protein_coding chr6:33055605 chr6:33055605 . . 0 21 hPsi_associated_SNPs_227821 0 24586183 Thyroid peroxidase antibody levels 6e-07 GWAS_Catalog TagSNP rs9277555 GCST002373 Identification of novel genetic Loci associated with thyroid peroxidase antibodies and clinical thyroid disease.
372 chr6 33055899 33055899 1 + G A rs3128965 33055899 - 33055879 33055919 41 GAAATCATATTAATTTTATGCTGCATAGGTTTCTCACAAGT GAAATCATATTAATTTTATGTTGCATAGGTTTCTCACAAGT Direct Gain 0 0.991658568382263 Functional Gain 0.991658568382263 HLA-DPB1 ENSG00000223865 downstream Human protein_coding chr6:33055899 chr6:33055899 . . 0 21 hPsi_associated_SNPs_227822 0 17554300 Multiple complex diseases 2.1e-10 Johnson and O'Donnell TagSNP rs3128965 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
373 chr6 33055946 33055946 1 + G A rs3128966 33055946 - 33055926 33055966 41 CTTTCTGCTATTCTCATGACCTCCTTCCATCGTTGAATCCC CTTTCTGCTATTCTCATGACTTCCTTCCATCGTTGAATCCC Direct Gain 0 0.987387955188751 Functional Gain 0.987387955188751 HLA-DPB1 ENSG00000223865 downstream Human protein_coding chr6:33055946 chr6:33055946 . . 0 21 hPsi_associated_SNPs_227823 0 17554300 Multiple complex diseases 2.13e-10 Johnson and O'Donnell TagSNP rs3128966 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
374 chr6 33086249 33086249 1 + C A rs3117035 33086249 - 33086229 33086269 41 AGCCCCAACTGCAGCCCCCCGACACGACGCCCCTTTTCAGC AGCCCCAACTGCAGCCCCCCTACACGACGCCCCTTTTCAGC Direct Gain 0 0.982687890529633 Functional Gain 0.982687890529633 HLA-DPB2 ENSG00000224557 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr6:33086249 chr6:33086249 . . 0 21 hPsi_associated_SNPs_227828 0 20031603 RR interval (heart rate) 1e-06 GWAS_Catalog TagSNP rs3117035 GCST000451 A genome-wide association scan of RR and QT interval duration in 3 European genetically isolated populations: the EUROSPAN project.
375 chr6 33408542 33408542 1 + G A rs411136 33408542 - 33408522 33408562 41 TCTGCGCAGCGCAGCCGCCACGAAGCAAACACCTCCTTCAG TCTGCGCAGCGCAGCCGCCATGAAGCAAACACCTCCTTCAG Direct Gain 0 0.772916316986084 Functional Gain 0.772916316986084 SYNGAP1 ENSG00000197283 CDS Human protein_coding chr6:33408542 chr6:33408542 synonymous SNV . 0 21 hPsi_associated_SNPs_227851 1 17554300 Multiple complex diseases 5.31e-06 Johnson and O'Donnell TagSNP rs411136 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
376 chr6 43970827 43970827 1 + G A rs2295334 43970827 - 43970807 43970847 41 GGCCCAGCGCCGCGGAGCGCCGCGGATGACAGCGGCGGTGG GGCCCAGCGCCGCGGAGCGCTGCGGATGACAGCGGCGGTGG Direct Gain 0 0.796670258045197 Functional Gain 0.796670258045197 C6orf223 ENSG00000181577 CDS Human protein_coding chr6:43970827 chr6:43970827 synonymous SNV . 0 21 hPsi_associated_SNPs_228217 0 25629512 Exudative age-related macular degeneration 6e-18 GWAS_Catalog TagSNP rs2295334 GCST002766 New loci and coding variants confer risk for age-related macular degeneration in East Asians.
377 chr6 46107312 46107312 1 + G A rs11752816 46107312 - 46107292 46107332 41 TAATAACTTCATAATGAACACGTTGAAGGACAGCAATCAGG TAATAACTTCATAATGAACATGTTGAAGGACAGCAATCAGG Direct Gain 0 0.909355401992798 Functional Gain 0.909355401992798 ENPP4 ENSG00000001561 UTR5 Human protein_coding chr6:46107312 chr6:46107312 . . 0 21 hPsi_associated_SNPs_228253 0 17554300 Multiple complex diseases 0.000435079 Johnson and O'Donnell TagSNP rs11752816 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
378 chr6 79655477 79655477 1 + G A rs10943605 79655477 - 79655457 79655497 41 TAAACTACCTGAATTTAAATCACAGTACCCACACTAGCTAG TAAACTACCTGAATTTAAATTACAGTACCCACACTAGCTAG Direct Gain 0 0.992698550224304 Functional Gain 0.992698550224304 PHIP ENSG00000146243 UTR3 Human protein_coding chr6:79655477 chr6:79655477 . . 0 21 hPsi_associated_SNPs_228513 0 27618448 Diastolic blood pressure 3e-09 GWAS_Catalog TagSNP rs10943605 GCST006227 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
379 chr6 96660114 96660114 1 + G A rs7745248 96660114 - 96660094 96660134 41 TGGCATCTTCAGGATTATCTCATTTAAGGAACTGAAGGTGG TGGCATCTTCAGGATTATCTTATTTAAGGAACTGAAGGTGG Direct Gain 0 0.824131965637207 Functional Gain 0.824131965637207 FUT9 ENSG00000172461 UTR3 Human protein_coding chr6:96660114 chr6:96660114 . . 0 21 hPsi_associated_SNPs_228635 0 17554300 Multiple complex diseases 0.000663313 Johnson and O'Donnell TagSNP rs7745248 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
380 chr6 144081609 144081609 1 + C A rs2073214 144081609 - 144081589 144081629 41 TTTTTTGGGTTTAGGTTTGGGTCTAGGCTTAGGAGGAGCAG TTTTTTGGGTTTAGGTTTGGTTCTAGGCTTAGGAGGAGCAG Direct Gain 0 0.999996840953827 Functional Gain 0.999996840953827 PHACTR2 ENSG00000112419 CDS Human protein_coding chr6:144081609 chr6:144081609 nonsynonymous SNV 0.998 1 21 hPsi_associated_SNPs_229038 0 25886283 Magnesium levels 8e-06 GWAS_Catalog TagSNP rs2073214 GCST002860 Genome-wide association study of serum minerals levels in children of different ethnic background.
381 chr6 149539773 149539773 1 + G A rs2272901 149539773 - 149539753 149539793 41 AAGGAGTTCACCTCACTGAGCATTAGTCTTCTCATCTGTAA AAGGAGTTCACCTCACTGAGTATTAGTCTTCTCATCTGTAA Direct Gain 0 0.999291896820068 Functional Gain 0.999291896820068 TAB2 ENSG00000228408 ncRNA_exonic Human lincRNA chr6:149539773 chr6:149539773 . . 0 21 hPsi_associated_SNPs_229131 0 28585551 Diverticulitis 6e-07 GWAS_Catalog TagSNP rs2272901 GCST008256 Sequence variants in ARHGAP15, COLQ and FAM155A associate with diverticular disease and diverticulitis.
382 chr6 151936677 151936677 1 + G A rs6929137 151936677 - 151936657 151936697 41 GGTATCCAGTTCTGACTTGACAGACATGAGCTTTTTCTCAG GGTATCCAGTTCTGACTTGATAGACATGAGCTTTTTCTCAG Direct Gain 0 0.824342131614685 Functional Gain 0.824342131614685 CCDC170 ENSG00000120262 CDS Human protein_coding chr6:151936677 chr6:151936677 nonsynonymous SNV 0.483 0 21 hPsi_associated_SNPs_229224 1 19079262 Bone mineral density (spine) 2e-10 GWAS_Catalog TagSNP rs6929137 GCST000295 New sequence variants associated with bone mineral density.
383 chr6 158910698 158910698 1 + G A rs12206717 158910698 - 158910678 158910718 41 TCTTGGCAGCCCAGTCATCACTCAGCTCAATGTCACTGGAG TCTTGGCAGCCCAGTCATCATTCAGCTCAATGTCACTGGAG Direct Gain 0 0.996225416660309 Functional Gain 0.996225416660309 TULP4 ENSG00000130338 CDS Human protein_coding chr6:158910698 chr6:158910698 nonsynonymous SNV 1.000 1 21 hPsi_associated_SNPs_229325 0 30598549 Heel bone mineral density 1e-13 GWAS_Catalog TagSNP rs12206717 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
384 chr6 158929442 158929442 1 + T A rs9456307 158929442 - 158929422 158929462 41 AGTGATGTCATGTCATCTTGATCTGGGAAAAAAATGGGTCG AGTGATGTCATGTCATCTTGTTCTGGGAAAAAAATGGGTCG Direct Gain 0 0.577388286590576 Functional Gain 0.577388286590576 TULP4 ENSG00000130338 UTR3 Human protein_coding chr6:158929442 chr6:158929442 . . 0 21 hPsi_associated_SNPs_229336 0 20881960 Height 2e-09 GWAS_Catalog TagSNP rs9456307 GCST000817 Hundreds of variants clustered in genomic loci and biological pathways affect human height.
385 chr6 160551204 160551204 1 + G A rs683369 160551204 - 160551184 160551224 41 CCAACACCGAGAGAGCCAAACAAGAAGCCCGCATTCAAACA CCAACACCGAGAGAGCCAAATAAGAAGCCCGCATTCAAACA Direct Gain 0 0.955960929393768 Functional Gain 0.955960929393768 SLC22A1 ENSG00000175003 CDS Human protein_coding chr6:160551204 chr6:160551204 synonymous SNV . 0 21 hPsi_associated_SNPs_229391 0 22179738 Gout 1e-07 GWAS_Catalog TagSNP rs683369 GCST001356 Gout and type 2 diabetes have a mutual inter-dependent effect on genetic risk factors and higher incidences.
386 chr7 2754118 2754118 1 + G A rs56399783 2754118 - 2754098 2754138 41 CCCCTCCCAGGTCACTGTTACGCCTTTTTGAAGCTACGCAA CCCCTCCCAGGTCACTGTTATGCCTTTTTGAAGCTACGCAA Direct Gain 0 0.997279286384583 Functional Gain 0.997279286384583 AMZ1 ENSG00000174945 UTR3 Human protein_coding chr7:2754118 chr7:2754118 . . 0 21 hPsi_associated_SNPs_229718 0 28928442 Childhood ear infection 5e-06 GWAS_Catalog TagSNP rs56399783 GCST005013 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
387 chr7 6178931 6178931 1 + G A rs6973832 6178931 - 6178911 6178951 41 GCCAAAAGGTAAAGTGAACACTGTTCTGTGTGCTTCCAACA GCCAAAAGGTAAAGTGAACATTGTTCTGTGTGCTTCCAACA Direct Gain 0 0.996113896369934 Functional Gain 0.996113896369934 USP42 ENSG00000106346 UTR3 Human protein_coding chr7:6178931 chr7:6178931 . . 0 21 hPsi_associated_SNPs_229878 0 17554300 Multiple complex diseases 0.000118482 Johnson and O'Donnell TagSNP rs6973832 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
388 chr7 6749758 6749758 1 + G A rs6967414 6749758 - 6749738 6749778 41 AGTTGGCAGTTGTTTTTCAACTGCCATGGATCCGTGGGTTG AGTTGGCAGTTGTTTTTCAATTGCCATGGATCCGTGGGTTG Direct Gain 0 0.832263588905334 Functional Gain 0.832263588905334 ZNF12;PMS2CL ENSG00000187953 upstream Human transcribed_unprocessed_pseudogene chr7:6749758 chr7:6749758 . . 0 21 hPsi_associated_SNPs_229897 0 27863252 Hematocrit 1e-10 GWAS_Catalog TagSNP rs6967414 GCST004604 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
389 chr7 18706918 18706918 1 + G A rs801524 18706918 - 18706898 18706938 41 GTGTTTTTTGCAATTGTAGACACAATATTGTATCTGATTGG GTGTTTTTTGCAATTGTAGATACAATATTGTATCTGATTGG Direct Gain 0 0.988717496395111 Functional Gain 0.988717496395111 HDAC9 ENSG00000048052 UTR3 Human protein_coding chr7:18706918 chr7:18706918 . . 0 21 hPsi_associated_SNPs_229999 0 17463246 Multiple continuous traits in DGI samples 0.0001261 Johnson and O'Donnell TagSNP rs801524 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
390 chr7 20767954 20767954 1 + G A rs17143304 20767954 - 20767934 20767974 41 ACAGCTTCCAATAATCTGTGCTTTCTTCGAGGTATTTCTGG ACAGCTTCCAATAATCTGTGTTTTCTTCGAGGTATTTCTGG Direct Gain 0 0.921040415763855 Functional Gain 0.921040415763855 ABCB5 ENSG00000004846 CDS Human protein_coding chr7:20767954 chr7:20767954 nonsynonymous SNV 0.996 4 21 hPsi_associated_SNPs_230023 0 17554300 Multiple complex diseases 0.000656585 Johnson and O'Donnell TagSNP rs17143304 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
391 chr7 44622286 44622286 1 + G A rs217358 44622286 - 44622266 44622306 41 TTACGAGTCAGATAGGTGGACACGCAAAGCAAAACATCACA TTACGAGTCAGATAGGTGGATACGCAAAGCAAAACATCACA Direct Gain 0 0.931134343147278 Functional Gain 0.931134343147278 TMED4 ENSG00000158604 upstream Human protein_coding chr7:44622286 chr7:44622286 . . 0 21 hPsi_associated_SNPs_230449 0 17554300 Multiple complex diseases 0.000165477 Johnson and O'Donnell TagSNP rs217358 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
392 chr7 55277964 55277964 1 + G A rs6593211 55277964 - 55277944 55277984 41 CCAGACATGTCTAGTTTATACTGGTAAATGCATATCAATTG CCAGACATGTCTAGTTTATATTGGTAAATGCATATCAATTG Direct Gain 0 0.948151111602783 Functional Gain 0.948151111602783 EGFR;ELDR ENSG00000146648 UTR3 Human protein_coding chr7:55277964 chr7:55277964 . . 0 21 hPsi_associated_SNPs_230598 0 17846125 Type II Diabetes Mellitus 0.00060554 Johnson and O'Donnell TagSNP rs6593211 . A search for variants associated with young-onset type 2 diabetes in American Indians in a 100K genotyping array.
393 chr7 75616105 75616105 1 + G A rs17685 75616105 - 75616085 75616125 41 TTTACACTCACTGGAAATCACGTGGAGGGGCTGGGCCCAGC TTTACACTCACTGGAAATCATGTGGAGGGGCTGGGCCCAGC Direct Gain 0 0.697764098644257 Functional Gain 0.697764098644257 POR ENSG00000127948 UTR3 Human protein_coding chr7:75616105 chr7:75616105 . . 0 21 hPsi_associated_SNPs_230806 1 25288136 Coffee consumption 1e-09 GWAS_Catalog TagSNP rs17685 GCST002651 Genome-wide meta-analysis identifies six novel loci associated with habitual coffee consumption.
394 chr7 98611561 98611561 1 + C A rs170185 98611561 - 98611541 98611581 41 AGCTGTAATCATCATTCCGTGGTAGCCTGGAACAATGGAGG AGCTGTAATCATCATTCCGTTGTAGCCTGGAACAATGGAGG Direct Gain 0 0.870327830314636 Functional Gain 0.870327830314636 LOC101927550 ENSG00000242687 ncRNA_exonic Human antisense chr7:98611561 chr7:98611561 . . 0 21 hPsi_associated_SNPs_231070 0 17982456 Rheumatoid Arthritis, cyclic citrullinated peptide (CCP) positive 3e-05 Johnson and O'Donnell TagSNP rs170185 . Two independent alleles at 6q23 associated with risk of rheumatoid arthritis.
395 chr7 99130834 99130834 1 + G A rs34670419 99130834 - 99130814 99130854 41 AGCTGCAATGCAAACTGAAACTCATTCTGTATATCACCACT AGCTGCAATGCAAACTGAAATTCATTCTGTATATCACCACT Direct Gain 0 0.999629139900208 Functional Gain 0.999629139900208 ZKSCAN5 ENSG00000196652 UTR3 Human protein_coding chr7:99130834 chr7:99130834 . . 0 21 hPsi_associated_SNPs_231092 0 29499414 Femoral neck bone mineral density 8e-06 GWAS_Catalog TagSNP rs34670419 GCST005795 Joint study of two genome-wide association meta-analyses identified 20p12.1 and 20q13.33 for bone mineral density.
396 chr7 99591418 99591418 1 + G A rs6465760 99591418 - 99591398 99591438 41 ATCTGCACTGGGAAGTCATCCGCAAGGACGTGGTGGCTGGA ATCTGCACTGGGAAGTCATCTGCAAGGACGTGGTGGCTGGA Direct Gain 0 0.872507989406586 Functional Gain 0.872507989406586 AZGP1P1;ZKSCAN1 ENSG00000235713 downstream Human unprocessed_pseudogene chr7:99591418 chr7:99591418 . . 0 21 hPsi_associated_SNPs_231122 0 17554300 Multiple complex diseases 5.3e-05 Johnson and O'Donnell TagSNP rs6465760 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
397 chr7 99956436 99956436 1 + T A rs11771799 99956436 - 99956416 99956456 41 ATATTCTCACGTTGGGAACTATGGCTAACTCCCAGGGGTAA ATATTCTCACGTTGGGAACTTTGGCTAACTCCCAGGGGTAA Direct Gain 0 0.868643641471863 Functional Gain 0.868643641471863 PILRB ENSG00000121716 CDS Human protein_coding chr7:99956436 chr7:99956436 nonsynonymous SNV 0.000 0 21 hPsi_associated_SNPs_231153 0 29875488 Blood protein levels 5e-31 GWAS_Catalog TagSNP rs11771799 GCST005806 Genomic atlas of the human plasma proteome.
398 chr7 100453208 100453208 1 + T A rs314370 100453208 - 100453188 100453228 41 CCAGCCATGTGGCTTTGCCCAAGTCACTCATATCCTCTGAG CCAGCCATGTGGCTTTGCCCTAGTCACTCATATCCTCTGAG Direct Gain 0 0.898363828659058 Functional Gain 0.898363828659058 SLC12A9 ENSG00000146828 intronic Human protein_coding chr7:100453208 chr7:100453208 . . 0 21 hPsi_associated_SNPs_231203 0 20639392 Resting heart rate 6e-10 GWAS_Catalog TagSNP rs314370 GCST000731 Genome-wide association analysis identifies multiple loci related to resting heart rate.
399 chr7 105658460 105658460 1 + C A rs73195662 105658460 - 105658440 105658480 41 TTCTGAGAATATAGATGGGGGTTGTTTCACAGTCCACTTTA TTCTGAGAATATAGATGGGGTTTGTTTCACAGTCCACTTTA Direct Gain 0 0.975462317466736 Functional Gain 0.975462317466736 CDHR3 ENSG00000128536 CDS Human protein_coding chr7:105658460 chr7:105658460 nonsynonymous SNV 0.438 0 21 hPsi_associated_SNPs_231400 0 30450575 PEG-asparaginase hypersensitivity without enzyme activity in childhood acute lymphoblastic leukaemia 1e-06 GWAS_Catalog TagSNP rs73195662 GCST007540 Genetic predisposition to PEG-asparaginase hypersensitivity in children treated according to NOPHO ALL2008.
400 chr7 128410012 128410012 1 + G A rs1043595 128410012 - 128409992 128410032 41 AAATGTATGCCCCGAAAACACTTGTATTTTTCCTTTAGTTT AAATGTATGCCCCGAAAACATTTGTATTTTTCCTTTAGTTT Direct Gain 0 0.998198986053467 Functional Gain 0.998198986053467 CALU ENSG00000128595 UTR3 Human protein_coding chr7:128410012 chr7:128410012 . . 0 21 hPsi_associated_SNPs_231624 0 30038396 Cognitive performance 4e-11 GWAS_Catalog TagSNP rs1043595 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
401 chr7 128695646 128695646 1 + C A rs3757384 128695646 - 128695626 128695666 41 GTAAAGGGGAGCTGAACAAAGATTCTAGGCATTTTGGATTT GTAAAGGGGAGCTGAACAAATATTCTAGGCATTTTGGATTT Direct Gain 0 0.999803006649017 Functional Gain 0.999803006649017 TPI1P2 ENSG00000064419;ENSG00000230359 upstream Human other chr7:128695646 chr7:128695646 . . 0 21 hPsi_associated_SNPs_231653 0 30019117 Adolescent idiopathic scoliosis 1e-24 GWAS_Catalog TagSNP rs3757384 GCST006287 The coexistence of copy number variations (CNVs) and single nucleotide polymorphisms (SNPs) at a locus can result in distorted calculations of the significance in associating SNPs to disease.
402 chr7 128695983 128695983 1 + C A rs13239597 128695983 - 128695963 128696003 41 TTGTTAGGCGGATTAAATGAGATCTTGTAACTACAGTGTTT TTGTTAGGCGGATTAAATGATATCTTGTAACTACAGTGTTT Direct Gain 0 0.855939030647278 Functional Gain 0.855939030647278 TPI1P2 ENSG00000064419;ENSG00000230359 upstream Human other chr7:128695983 chr7:128695983 . . 0 21 hPsi_associated_SNPs_231655 0 23740937 Systemic lupus erythematosus and Systemic sclerosis 1e-29 GWAS_Catalog TagSNP rs13239597 GCST002069 A systemic sclerosis and systemic lupus erythematosus pan-meta-GWAS reveals new shared susceptibility loci.
403 chr7 134215403 134215403 1 + T A rs1722883 134215403 - 134215383 134215423 41 ACTGCTTCTTTCACTTTGCCAAGAGGAGACTGAAAGGCAAA ACTGCTTCTTTCACTTTGCCTAGAGGAGACTGAAAGGCAAA Direct Gain 0 0.996118426322937 Functional Gain 0.996118426322937 AKR1B10 ENSG00000198074 CDS Human protein_coding chr7:134215403 chr7:134215403 synonymous SNV . 0 21 hPsi_associated_SNPs_231727 0 31015401 Medication use (agents acting on the renin-angiotensin system) 4e-10 GWAS_Catalog TagSNP rs1722883 GCST007930 Genome-wide association study of medication-use and associated disease in the UK Biobank.
404 chr7 138489883 138489883 1 + G A rs2034507 138489883 - 138489863 138489903 41 ACAAGAAATCCATCCCGTTGCACTGATTCAACATCTGAGAT ACAAGAAATCCATCCCGTTGTACTGATTCAACATCTGAGAT Direct Gain 0 0.531713664531708 Functional Gain 0.531713664531708 TMEM213 ENSG00000214128 UTR3 Human protein_coding chr7:138489883 chr7:138489883 . . 0 21 hPsi_associated_SNPs_231772 0 17634449 Coronary Artery Disease 0.0004517 Johnson and O'Donnell TagSNP rs2034507 . Genomewide association analysis of coronary artery disease.
405 chr7 142334744 142334744 1 + C A rs17211 142334744 - 142334724 142334764 41 TGCCATCAGCATGAGACTCTGTTTCGGGAACTGACGATACC TGCCATCAGCATGAGACTCTTTTTCGGGAACTGACGATACC Direct Gain 0 0.999149680137634 Functional Gain 0.999149680137634 TRY2P;MTRNR2L6 ENSG00000211747 CDS Human TR_V_gene chr7:142334744 chr7:142334744 nonsynonymous SNV . 0 21 hPsi_associated_SNPs_231842 0 28754779 Alcoholic chronic pancreatitis 7e-07 GWAS_Catalog TagSNP rs17211 GCST004860 Genome-wide association study identifies inversion in the CTRB1-CTRB2 locus to modify risk for alcoholic and non-alcoholic chronic pancreatitis.
406 chr7 142459290 142459290 1 + C A rs3857776 142459290 - 142459270 142459310 41 CTCCTTGAAGTTTTCCCAGCGTTCTTCACCCCAGGCCTTTG CTCCTTGAAGTTTTCCCAGCTTTCTTCACCCCAGGCCTTTG Direct Gain 0 0.857803583145142 Functional Gain 0.857803583145142 PRSS1 ENSG00000204983 intronic Human protein_coding chr7:142459290 chr7:142459290 . . 0 21 hPsi_associated_SNPs_231855 0 28754779 Alcoholic chronic pancreatitis 2e-22 GWAS_Catalog TagSNP rs3857776 GCST004860 Genome-wide association study identifies inversion in the CTRB1-CTRB2 locus to modify risk for alcoholic and non-alcoholic chronic pancreatitis.
407 chr7 150696111 150696111 1 + T A rs1799983 150696111 - 150696091 150696131 41 AGAAGGAAGAGTTCTGGGGGATCATCTGGGGCCTGCAGCAG AGAAGGAAGAGTTCTGGGGGTTCATCTGGGGCCTGCAGCAG Direct Gain 0 0.988826394081116 Functional Gain 0.988826394081116 NOS3 ENSG00000164867 CDS Human protein_coding chr7:150696111 chr7:150696111 nonsynonymous SNV 0.954 0 21 hPsi_associated_SNPs_232102 0 30383316 Stroke 2e-08 GWAS_Catalog TagSNP rs1799983 GCST007248 Genome-Wide Meta-analysis identifies three novel loci associated with stroke.
408 chr7 150761314 150761314 1 + G A rs2303929 150761314 - 150761294 150761334 41 GCTCGGGGAACCCAGGCGTCCCAGGGCCCAAGCTCTCTGGC GCTCGGGGAACCCAGGCGTCTCAGGGCCCAAGCTCTCTGGC Direct Gain 0 0.607966184616089 Functional Gain 0.607966184616089 SLC4A2 ENSG00000164889 CDS Human protein_coding chr7:150761314 chr7:150761314 nonsynonymous SNV 0.043 1 21 hPsi_associated_SNPs_232122 0 30038396 Educational attainment (years of education) 4e-08 GWAS_Catalog TagSNP rs2303929 GCST006442 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
409 chr8 8092025 8092025 1 + G A rs2980436 8092025 - 8092005 8092045 41 TCGTACAGCTCATCCAAAGGCTCCGTGTGGACAGCCTCGTG TCGTACAGCTCATCCAAAGGTTCCGTGTGGACAGCCTCGTG Direct Gain 0 0.939043998718262 Functional Gain 0.939043998718262 FAM86B3P ENSG00000173295 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr8:8092025 chr8:8092025 . . 0 21 hPsi_associated_SNPs_232475 0 28991256 Schizophrenia 2e-08 GWAS_Catalog TagSNP rs2980436 GCST004946 Genome-wide association analysis identifies 30 new susceptibility loci for schizophrenia.
410 chr8 18258316 18258316 1 + G A rs1208 18258316 - 18258296 18258336 41 AGGAAATCTTAAATATATTTCTCAGCACTTCTTCAACCTCT AGGAAATCTTAAATATATTTTTCAGCACTTCTTCAACCTCT Direct Gain 0 0.982172966003418 Functional Gain 0.982172966003418 NAT2 ENSG00000156006 CDS Human protein_coding chr8:18258316 chr8:18258316 nonsynonymous SNV 0.455 0 21 hPsi_associated_SNPs_232731 1 25798622 Insulin resistance/response 3e-06 GWAS_Catalog TagSNP rs1208 GCST002825 Identification and validation of N-acetyltransferase 2 as an insulin sensitivity gene.
411 chr8 32405979 32405979 1 + T A rs7820838 32405979 - 32405959 32405999 41 GGAAGTCGTCGATGGGTCCCACCGCTGGCGGCTCGCGTCCT GGAAGTCGTCGATGGGTCCCTCCGCTGGCGGCTCGCGTCCT Direct Gain 0 0.980756819248199 Functional Gain 0.980756819248199 NRG1 ENSG00000157168 UTR5 Human protein_coding chr8:32405979 chr8:32405979 . . 0 21 hPsi_associated_SNPs_233011 0 28604730 Lung cancer 4e-06 GWAS_Catalog TagSNP rs7820838 GCST004748 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
412 chr8 64692560 64692560 1 + G A rs6472122 64692560 - 64692540 64692580 41 ACGTAAACAAAGTTGTGATGCAACGTGGTAAGTTCTATGAA ACGTAAACAAAGTTGTGATGTAACGTGGTAAGTTCTATGAA Direct Gain 0 0.963225960731506 Functional Gain 0.963225960731506 LINC01289 ENSG00000253734 ncRNA_exonic Human lincRNA chr8:64692560 chr8:64692560 . . 0 21 hPsi_associated_SNPs_233295 0 17463246 Multiple continuous traits in DGI samples 0.0004987 Johnson and O'Donnell TagSNP rs6472122 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
413 chr8 110478822 110478822 1 + C A rs73313124 110478822 - 110478802 110478842 41 ATGAGCTGTGTGGAATGACGGTATGTCCTTTGTGCCCTGGG ATGAGCTGTGTGGAATGACGTTATGTCCTTTGTGCCCTGGG Direct Gain 0 0.988487482070923 Functional Gain 0.988487482070923 PKHD1L1 ENSG00000205038 CDS Human protein_coding chr8:110478822 chr8:110478822 nonsynonymous SNV 0.950 2 21 hPsi_associated_SNPs_233671 0 23251661 Obesity-related traits 3e-06 GWAS_Catalog TagSNP rs73313124 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
414 chr8 121061879 121061879 1 + G A rs4871827 121061879 - 121061859 121061899 41 GGCCCGTCAGAATCAGATTGCTCACGGTCCGGTAGTCTACA GGCCCGTCAGAATCAGATTGTTCACGGTCCGGTAGTCTACA Direct Gain 0 0.951722800731659 Functional Gain 0.951722800731659 DEPTOR ENSG00000155792 CDS Human protein_coding chr8:121061879 chr8:121061879 nonsynonymous SNV 1.000 1 21 hPsi_associated_SNPs_233703 0 30598549 Heel bone mineral density 1e-09 GWAS_Catalog TagSNP rs4871827 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
415 chr8 124191933 124191933 1 + G A rs10505430 124191933 - 124191913 124191953 41 AGCCCTGCTTCTGTTCCCAGCTCTTGGTCTTCACACAGACC AGCCCTGCTTCTGTTCCCAGTTCTTGGTCTTCACACAGACC Direct Gain 0 0.824492454528809 Functional Gain 0.824492454528809 FAM83A ENSG00000147689 UTR5 Human protein_coding chr8:124191933 chr8:124191933 . . 0 21 hPsi_associated_SNPs_233744 0 17554300 Multiple complex diseases 0.000854119 Johnson and O'Donnell TagSNP rs10505430 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
416 chr9 894714 894714 1 + C A rs16925457 894714 - 894694 894734 41 GGTCCAGCTCAACAGTGACCGAATTCCTTTTCTTACCTTTC GGTCCAGCTCAACAGTGACCTAATTCCTTTTCTTACCTTTC Direct Gain 0 0.920092821121216 Functional Gain 0.920092821121216 DMRT1 ENSG00000137090 intronic Human protein_coding chr9:894714 chr9:894714 . . 0 21 hPsi_associated_SNPs_234143 0 17554300 Multiple complex diseases 0.000511783 Johnson and O'Donnell TagSNP rs16925457 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
417 chr9 4860980 4860980 1 + G A rs1053889 4860980 - 4860960 4861000 41 ATTTTCTCATGGAGATAGCACTTACATCACAGAGCTATTGT ATTTTCTCATGGAGATAGCATTTACATCACAGAGCTATTGT Direct Gain 0 0.893346309661865 Functional Gain 0.893346309661865 RCL1 ENSG00000120158 UTR3 Human protein_coding chr9:4860980 chr9:4860980 . . 0 21 hPsi_associated_SNPs_234195 0 17463246 Multiple continuous traits in DGI samples 0.0009282 Johnson and O'Donnell TagSNP rs1053889 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
418 chr9 5774661 5774661 1 + G A rs10975277 5774661 - 5774641 5774681 41 CAGGTAGCTCAAGTACCTGACAGACTATAGCAAGCACCTTA CAGGTAGCTCAAGTACCTGATAGACTATAGCAAGCACCTTA Direct Gain 0 0.713301658630371 Functional Gain 0.713301658630371 RIC1 ENSG00000107036 UTR3 Human protein_coding chr9:5774661 chr9:5774661 . . 0 21 hPsi_associated_SNPs_234217 0 30595370 Respiratory diseases 7e-08 GWAS_Catalog TagSNP rs10975277 GCST007076 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
419 chr9 22029445 22029445 1 + G A rs10965215 22029445 - 22029425 22029465 41 CTTGGAATCCTTTGAAATGTCGTGGCAAATAGTCCTGCAAA CTTGGAATCCTTTGAAATGTTGTGGCAAATAGTCCTGCAAA Direct Gain 0 0.980359733104706 Functional Gain 0.980359733104706 CDKN2B-AS1 ENSG00000264545 CDS Human protein_coding chr9:22029445 chr9:22029445 nonsynonymous SNV . 0 21 hPsi_associated_SNPs_234337 0 17554300 Multiple complex diseases 5.15e-10 Johnson and O'Donnell TagSNP rs10965215 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
420 chr9 37510072 37510072 1 + G A rs76582507 37510072 - 37510052 37510092 41 CAAAGTGCTGGGATTACAAACATGAGCCACTGTGCCTGGCC CAAAGTGCTGGGATTACAAATATGAGCCACTGTGCCTGGCC Direct Gain 0 0.99523514509201 Functional Gain 0.99523514509201 FBXO10 ENSG00000234160 ncRNA_intronic Human antisense chr9:37510072 chr9:37510072 . . 0 21 hPsi_associated_SNPs_234498 0 27989323 Macrophage inflammatory protein 1b levels 3e-06 GWAS_Catalog TagSNP rs76582507 GCST004433 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
421 chr9 80020874 80020874 1 + C A rs117983287 80020874 - 80020854 80020894 41 AATGCGCAATCTTCTCCCATGAACAATGAATGGCTCTTTGG AATGCGCAATCTTCTCCCATTAACAATGAATGGCTCTTTGG Direct Gain 0 0.551492512226105 Functional Gain 0.551492512226105 VPS13A ENSG00000197969 CDS Human protein_coding chr9:80020874 chr9:80020874 nonsynonymous SNV 1.000 0 21 hPsi_associated_SNPs_234690 0 27639821 Mortality in sepsis 8e-08 GWAS_Catalog TagSNP rs117983287 GCST003817 Genetic Factors of the Disease Course after Sepsis: A Genome-Wide Study for 28Day Mortality.
422 chr9 84391174 84391174 1 + T A rs10081631 84391174 - 84391154 84391194 41 GAACTCATGGAACAATTTGTATGATGAGCCAGGTGGACAGA GAACTCATGGAACAATTTGTTTGATGAGCCAGGTGGACAGA Direct Gain 0 0.762274622917175 Functional Gain 0.762274622917175 LOC101927502 ENSG00000233926 ncRNA_exonic Human lincRNA chr9:84391174 chr9:84391174 . . 0 21 hPsi_associated_SNPs_234703 0 29921221 Forehead morphology 7e-06 GWAS_Catalog TagSNP rs10081631 GCST006106 Identification of five novel genetic loci related to facial morphology by genome-wide association studies.
423 chr9 93926650 93926650 1 + G A rs7045740 93926650 - 93926630 93926670 41 TGGAGGCTGGAGCTGCCTGTCCAAGCTGGTGGCCTGACACT TGGAGGCTGGAGCTGCCTGTTCAAGCTGGTGGCCTGACACT Direct Gain 0 0.992627024650574 Functional Gain 0.992627024650574 LINC00484 ENSG00000235641 ncRNA_exonic Human lincRNA chr9:93926650 chr9:93926650 . . 0 21 hPsi_associated_SNPs_234846 0 30595370 White blood cell count 4e-11 GWAS_Catalog TagSNP rs7045740 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
424 chr9 95375448 95375448 1 + G A rs72754495 95375448 - 95375428 95375468 41 CGCAGCATCTTCATCCTCCACGTTCACTGTTTTGGAACTAG CGCAGCATCTTCATCCTCCATGTTCACTGTTTTGGAACTAG Direct Gain 0 0.873927116394043 Functional Gain 0.873927116394043 CENPP ENSG00000188312 UTR3 Human protein_coding chr9:95375448 chr9:95375448 . . 0 21 hPsi_associated_SNPs_234858 0 29924316 Familial squamous cell lung carcinoma 8e-08 GWAS_Catalog TagSNP rs72754495 GCST006088 Genome-Wide Association Study of Familial Lung Cancer.
425 chr9 95380726 95380726 1 + G A rs2148537 95380726 - 95380706 95380746 41 AAAGGCCGCTGAAGGACAGACATGTTACTCACCTCGTCTAG AAAGGCCGCTGAAGGACAGATATGTTACTCACCTCGTCTAG Direct Gain 0 0.915308952331543 Functional Gain 0.915308952331543 LOC100128361 ENSG00000188312 UTR3 Human protein_coding chr9:95380726 chr9:95380726 . . 0 21 hPsi_associated_SNPs_234862 0 17463246 Multiple continuous traits in DGI samples 0.0001206 Johnson and O'Donnell TagSNP rs2148537 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
426 chr9 102732237 102732237 1 + T A rs9556 102732237 - 102732217 102732257 41 GCGGTTTGAGATAGACATGCAGTTGGGCTGGGCCATGCTTG GCGGTTTGAGATAGACATGCTGTTGGGCTGGGCCATGCTTG Direct Gain 0 0.996582746505737 Functional Gain 0.996582746505737 STX17 ENSG00000136874 UTR3 Human protein_coding chr9:102732237 chr9:102732237 . . 0 21 hPsi_associated_SNPs_235015 0 30595370 Hair color 7e-09 GWAS_Catalog TagSNP rs9556 GCST007082 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
427 chr9 125866070 125866070 1 + G A rs700082 125866070 - 125866050 125866090 41 GCCAAACCCAAAACCTGCACCATACAGTTTAACAGAACCAG GCCAAACCCAAAACCTGCACTATACAGTTTAACAGAACCAG Direct Gain 0 0.999598622322083 Functional Gain 0.999598622322083 RABGAP1 ENSG00000011454 UTR3 Human protein_coding chr9:125866070 chr9:125866070 . . 0 21 hPsi_associated_SNPs_235323 0 30578418 Pulse pressure 2e-10 GWAS_Catalog TagSNP rs700082 GCST007269 Trans-ethnic association study of blood pressure determinants in over 750,000 individuals.
428 chr9 138012070 138012070 1 + G A rs11103684 138012070 - 138012050 138012090 41 GGCAGCAGTTTCACAGGAGTCCCTTTGTGGTGAGGACGTGG GGCAGCAGTTTCACAGGAGTTCCTTTGTGGTGAGGACGTGG Direct Gain 0 0.671477556228638 Functional Gain 0.671477556228638 OLFM1 ENSG00000130558 UTR3 Human protein_coding chr9:138012070 chr9:138012070 . . 0 21 hPsi_associated_SNPs_235900 0 26148204 6-month creatinine clearance change response to tenofovir treatment in HIV infection (treatment arm interaction) 3e-06 GWAS_Catalog TagSNP rs11103684 GCST006072 Genomewide association study of tenofovir pharmacokinetics and creatinine clearance in AIDS Clinical Trials Group protocol A5202.
429 chr9 139316916 139316916 1 + G A rs10870166 139316916 - 139316896 139316936 41 CAGGTTTTAAGCCTGTCCCCCAGAAGAGTCCGATGCACATA CAGGTTTTAAGCCTGTCCCCTAGAAGAGTCCGATGCACATA Direct Gain 0 0.581670939922333 Functional Gain 0.581670939922333 PMPCA ENSG00000165688 UTR3 Human protein_coding chr9:139316916 chr9:139316916 . . 0 21 hPsi_associated_SNPs_235980 0 17554300 Multiple complex diseases 4.4528e-05 Johnson and O'Donnell TagSNP rs10870166 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
430 chr10 18331992 18331992 1 + G A rs11012350 18331992 - 18331972 18332012 41 TACTTTTTAAAAAGCAAGAGCTTCATCATGGTGTTGGAAAC TACTTTTTAAAAAGCAAGAGTTTCATCATGGTGTTGGAAAC Direct Gain 0 0.875655353069305 Functional Gain 0.875655353069305 SLC39A12 ENSG00000148482 UTR3 Human protein_coding chr10:18331992 chr10:18331992 . . 0 21 hPsi_associated_SNPs_236446 0 27082954 Peripheral arterial disease (traffic-related air pollution interaction) 2e-06 GWAS_Catalog TagSNP rs11012350 GCST004482 Genetic Variants in the Bone Morphogenic Protein Gene Family Modify the Association between Residential Exposure to Traffic and Peripheral Arterial Disease.
431 chr10 21463740 21463740 1 + C A rs145215398 21463740 - 21463720 21463760 41 AAGCGCGGGGTCTGGGAGCCGGTGAGAGAAGGCTCTTTCTC AAGCGCGGGGTCTGGGAGCCTGTGAGAGAAGGCTCTTTCTC Direct Gain 0 0.609521925449371 Functional Gain 0.609521925449371 NEBL-AS1 ENSG00000231920 ncRNA_exonic Human antisense chr10:21463740 chr10:21463740 . . 0 21 hPsi_associated_SNPs_236466 0 30348214 DNA methylation variation (age effect) 1e-08 GWAS_Catalog TagSNP rs145215398 GCST006660 Genotype effects contribute to variation in longitudinal methylome patterns in older people.
432 chr10 44124361 44124361 1 + G A rs4078412 44124361 - 44124341 44124381 41 CATGCCAAAAAGGCCCCACACATGCAAACTCAAAGGAACAT CATGCCAAAAAGGCCCCACATATGCAAACTCAAAGGAACAT Direct Gain 0 0.598693490028381 Functional Gain 0.598693490028381 ZNF32-AS3 ENSG00000223910 ncRNA_exonic Human antisense chr10:44124361 chr10:44124361 . . 0 21 hPsi_associated_SNPs_236695 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0004051 Johnson and O'Donnell TagSNP rs4078412 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
433 chr10 50824117 50824117 1 + G A rs1880676 50824117 - 50824097 50824137 41 TACTGTGCTCAGTGCTTCATCTCTGCATTCCGGCCACATCT TACTGTGCTCAGTGCTTCATTTCTGCATTCCGGCCACATCT Direct Gain 0 0.99509060382843 Functional Gain 0.99509060382843 CHAT ENSG00000070748 CDS Human protein_coding chr10:50824117 chr10:50824117 nonsynonymous SNV 0.007 2 21 hPsi_associated_SNPs_236802 1 17463246 Multiple continuous traits in DGI samples 0.00042 Johnson and O'Donnell TagSNP rs1880676 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
434 chr10 73115942 73115942 1 + G A rs2252996 73115942 - 73115922 73115962 41 CATGCAGAGCACGAGGAAGACAGTGGCCGTCAGGAAGAAGG CATGCAGAGCACGAGGAAGATAGTGGCCGTCAGGAAGAAGG Direct Gain 0 0.927466869354248 Functional Gain 0.927466869354248 SLC29A3 ENSG00000198246 CDS Human protein_coding chr10:73115942 chr10:73115942 nonsynonymous SNV 0.000 0 21 hPsi_associated_SNPs_237004 2 23273568 Systemic lupus erythematosus 3e-06 GWAS_Catalog TagSNP rs2252996 GCST001795 Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians.
435 chr10 87407163 87407163 1 + C A rs17105747 87407163 - 87407143 87407183 41 TCATGCCTCGCTGCCTTTCTGCATTTCAGGACTTTCCAGGA TCATGCCTCGCTGCCTTTCTTCATTTCAGGACTTTCCAGGA Direct Gain 0 0.999971628189087 Functional Gain 0.999971628189087 GRID1 ENSG00000270002 ncRNA_exonic Human antisense chr10:87407163 chr10:87407163 . . 0 21 hPsi_associated_SNPs_237306 0 17554300 Multiple complex diseases 0.000840085 Johnson and O'Donnell TagSNP rs17105747 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
436 chr10 91066460 91066460 1 + T A rs954439 91066460 - 91066440 91066480 41 AACTTGGCTGCACTGCGAAGAACATCTGTTACACCTGGGGC AACTTGGCTGCACTGCGAAGTACATCTGTTACACCTGGGGC Direct Gain 0 1 Functional Gain 1 IFIT2 ENSG00000119922 CDS Human protein_coding chr10:91066460 chr10:91066460 synonymous SNV . 0 21 hPsi_associated_SNPs_237416 0 17554300 Multiple complex diseases 0.000956462 Johnson and O'Donnell TagSNP rs954439 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
437 chr10 96443723 96443723 1 + C A rs56113807 96443723 - 96443703 96443743 41 TTGGTTAAGGATTTGCTCATGTCCTTAACATCTAACTGCAG TTGGTTAAGGATTTGCTCATTTCCTTAACATCTAACTGCAG Direct Gain 0 0.998610317707062 Functional Gain 0.998610317707062 CYP2C18 ENSG00000108242 CDS Human protein_coding chr10:96443723 chr10:96443723 nonsynonymous SNV 0.011 0 21 hPsi_associated_SNPs_237512 0 29206233 Common carotid intima-media thickness in HIV negative individuals 5e-06 GWAS_Catalog TagSNP rs56113807 GCST005182 Genome-wide admixture and association study of subclinical atherosclerosis in the Women's Interagency HIV Study (WIHS).
438 chr10 96495793 96495793 1 + C A rs1326830 96495793 - 96495773 96495813 41 TCTTATGGATGATTGTTCCAGTATTTCCCTACAGGTTACAG TCTTATGGATGATTGTTCCATTATTTCCCTACAGGTTACAG Direct Gain 0 0.772351384162903 Functional Gain 0.772351384162903 CYP2C18 ENSG00000108242 UTR3 Human protein_coding chr10:96495793 chr10:96495793 . . 0 21 hPsi_associated_SNPs_237516 0 17554300 Multiple complex diseases 0.000399852 Johnson and O'Donnell TagSNP rs1326830 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
439 chr10 101287764 101287764 1 + G A rs10883365 101287764 - 101287744 101287784 41 GGGGGTCACGTTGGCACAAACACCTTCAAACCGTCTGAGAA GGGGGTCACGTTGGCACAAATACCTTCAAACCGTCTGAGAA Direct Gain 0 0.998901963233948 Functional Gain 0.998901963233948 LINC01475 ENSG00000228778;ENSG00000257582 ncRNA_exonic Human other chr10:101287764 chr10:101287764 . . 0 21 hPsi_associated_SNPs_237618 0 17554300 Crohn's disease 6e-08 GWAS_Catalog TagSNP rs10883365 GCST000042 Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
440 chr10 103922063 103922063 1 + G A rs1049466 103922063 - 103922043 103922083 41 TGGAGAAAGTAAGTAGTCTCCGATCATCACCCTTGCTTCAC TGGAGAAAGTAAGTAGTCTCTGATCATCACCCTTGCTTCAC Direct Gain 0 0.866017460823059 Functional Gain 0.866017460823059 NOLC1 ENSG00000166197 UTR3 Human protein_coding chr10:103922063 chr10:103922063 . . 0 21 hPsi_associated_SNPs_237696 0 17554300 Multiple complex diseases 0.000513943 Johnson and O'Donnell TagSNP rs1049466 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
441 chr10 104837816 104837816 1 + G A rs1046411 104837816 - 104837796 104837836 41 GCAAGGACCAGGGAGGTGGGCGACGACACTCTGTGAGCTTA GCAAGGACCAGGGAGGTGGGTGACGACACTCTGTGAGCTTA Direct Gain 0 0.849875807762146 Functional Gain 0.849875807762146 CNNM2 ENSG00000148842 UTR3 Human protein_coding chr10:104837816 chr10:104837816 . . 0 21 hPsi_associated_SNPs_237743 1 30595370 Mean corpuscular hemoglobin 2e-41 GWAS_Catalog TagSNP rs1046411 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
442 chr10 118187444 118187444 1 + C A rs41284366 118187444 - 118187424 118187464 41 CTCACTATAAAATACTAAGTGGTTTTCCTCACAATGATGCA CTCACTATAAAATACTAAGTTGTTTTCCTCACAATGATGCA Direct Gain 0 0.776792287826538 Functional Gain 0.776792287826538 PNLIPRP3 ENSG00000203837 UTR5 Human protein_coding chr10:118187444 chr10:118187444 . . 0 21 hPsi_associated_SNPs_237899 0 26379185 Influenza A (H1N1) infection 3e-08 GWAS_Catalog TagSNP rs41284366 GCST003125 No Major Host Genetic Risk Factor Contributed to A(H1N1)2009 Influenza Severity.
443 chr11 831883 831883 1 + G A rs35694355 831883 - 831863 831903 41 GCAGAGGGCACACACGGGACCCTGGCCACTCCCGGGACCCT GCAGAGGGCACACACGGGACTCTGGCCACTCCCGGGACCCT Direct Gain 0 0.869697332382202 Functional Gain 0.869697332382202 CRACR2B ENSG00000255108 ncRNA_intronic Human antisense chr11:831883 chr11:831883 . . 0 21 hPsi_associated_SNPs_238388 0 23251661 Obesity-related traits 3e-06 GWAS_Catalog TagSNP rs35694355 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
444 chr11 1892585 1892585 1 + G A rs4980389 1892585 - 1892565 1892605 41 AGCACCCTTGTCCCGCTCTGCAGCTGTTTCACATCTCTGCC AGCACCCTTGTCCCGCTCTGTAGCTGTTTCACATCTCTGCC Direct Gain 0 0.986552953720093 Functional Gain 0.986552953720093 LSP1 ENSG00000130592 UTR5 Human protein_coding chr11:1892585 chr11:1892585 . . 0 21 hPsi_associated_SNPs_238526 0 29912962 Systolic blood pressure x alcohol consumption interaction (2df test) 7e-40 GWAS_Catalog TagSNP rs4980389 GCST006434 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
445 chr11 1995223 1995223 1 + G A rs217719 1995223 - 1995203 1995243 41 ACCACAGAACAGCATCTGGGCACCTACCTGTTGGCCATGGG ACCACAGAACAGCATCTGGGTACCTACCTGTTGGCCATGGG Direct Gain 0 0.999986529350281 Functional Gain 0.999986529350281 MRPL23;MRPL23-AS1 ENSG00000214026 intronic Human protein_coding chr11:1995223 chr11:1995223 . . 0 21 hPsi_associated_SNPs_238537 0 29912962 Systolic blood pressure x alcohol consumption interaction (2df test) 3e-18 GWAS_Catalog TagSNP rs217719 GCST006434 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
446 chr11 43877934 43877934 1 + C A rs1061810 43877934 - 43877914 43877954 41 AATACAAATCTACTGGTGCTGAAAACTCAGAGCTTAGGAAA AATACAAATCTACTGGTGCTTAAAACTCAGAGCTTAGGAAA Direct Gain 0 0.630815207958221 Functional Gain 0.630815207958221 HSD17B12 ENSG00000246250 ncRNA_intronic Human antisense chr11:43877934 chr11:43877934 . . 0 21 hPsi_associated_SNPs_239210 0 28566273 Type 2 diabetes 4e-10 GWAS_Catalog TagSNP rs1061810 GCST004773 An Expanded Genome-Wide Association Study of Type 2 Diabetes in Europeans.
447 chr11 46695483 46695483 1 + G A rs56349329 46695483 - 46695463 46695503 41 GGTCCCCGCCAGAGCCTGCTCCAATCCTCAGAAGTCAGCCT GGTCCCCGCCAGAGCCTGCTTCAATCCTCAGAAGTCAGCCT Direct Gain 0 0.934081852436066 Functional Gain 0.934081852436066 ATG13 ENSG00000175224 UTR3 Human protein_coding chr11:46695483 chr11:46695483 . . 0 21 hPsi_associated_SNPs_239303 0 29397368 Headache 4e-08 GWAS_Catalog TagSNP rs56349329 GCST005337 A Genome-Wide Association Study Finds Genetic Associations with Broadly-Defined Headache in UK Biobank (N=223,773).
448 chr11 61722645 61722645 1 + C A rs1109748 61722645 - 61722625 61722665 41 AAGGAAATGGGGATGAGCTGGATGTAGCTGTCGCAATACAG AAGGAAATGGGGATGAGCTGTATGTAGCTGTCGCAATACAG Direct Gain 0 0.99572229385376 Functional Gain 0.99572229385376 BEST1 ENSG00000167995 CDS Human protein_coding chr11:61722645 chr11:61722645 synonymous SNV . 0 21 hPsi_associated_SNPs_239655 5 21829377 Plasma omega-3 polyunsaturated fatty acid level (eicosapentaenoic acid) 5e-09 GWAS_Catalog TagSNP rs1109748 GCST001178 Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium.
449 chr11 67192555 67192555 1 + G A rs1626067 67192555 - 67192535 67192575 41 ACCAAGTTTCCAGCAGGCTTCAGAGCTATCCTAGAATTTGG ACCAAGTTTCCAGCAGGCTTTAGAGCTATCCTAGAATTTGG Direct Gain 0 0.996101260185242 Functional Gain 0.996101260185242 CARNS1 ENSG00000172508 UTR3 Human protein_coding chr11:67192555 chr11:67192555 . . 0 21 hPsi_associated_SNPs_240050 0 30595370 Sunburns 2e-11 GWAS_Catalog TagSNP rs1626067 GCST007086 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
450 chr11 68174189 68174189 1 + G A rs4988321 68174189 - 68174169 68174209 41 GCCCGTGAGCGGGATGGCCACGTCGTTGTTATTGGTCTCGA GCCCGTGAGCGGGATGGCCATGTCGTTGTTATTGGTCTCGA Direct Gain 0 0.858036816120148 Functional Gain 0.858036816120148 LRP5 ENSG00000162337 CDS Human protein_coding chr11:68174189 chr11:68174189 nonsynonymous SNV 0.978 3 21 hPsi_associated_SNPs_240096 3 28869591 Heel bone mineral density 7e-15 GWAS_Catalog TagSNP rs4988321 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
451 chr11 68700701 68700701 1 + G A rs645436 68700701 - 68700681 68700721 41 AGTCCAGGTGTGAACCACAGCAAGTGAGGAGGACAGGCCCC AGTCCAGGTGTGAACCACAGTAAGTGAGGAGGACAGGCCCC Direct Gain 0 0.82301139831543 Functional Gain 0.82301139831543 IGHMBP2 ENSG00000132740 intronic Human protein_coding chr11:68700701 chr11:68700701 . . 0 21 hPsi_associated_SNPs_240111 0 17554300 Multiple complex diseases 0.000148738 Johnson and O'Donnell TagSNP rs645436 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
452 chr11 68831364 68831364 1 + G A rs72928978 68831364 - 68831344 68831384 41 GATGGCCAGCAGCAGCCCGACGCTGGGGGAGAGCACGGCAC GATGGCCAGCAGCAGCCCGATGCTGGGGGAGAGCACGGCAC Direct Gain 0 0.99752151966095 Functional Gain 0.99752151966095 TPCN2 ENSG00000162341 CDS Human protein_coding chr11:68831364 chr11:68831364 nonsynonymous SNV 0.799 4 21 hPsi_associated_SNPs_240122 0 30531825 Brown vs. black hair color 6e-48 GWAS_Catalog TagSNP rs72928978 GCST006989 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
453 chr11 70118489 70118489 1 + G A rs546502 70118489 - 70118469 70118509 41 GGAATCTCTTTCATGACCAACCTCGTGTAACTTCCCCTGGG GGAATCTCTTTCATGACCAATCTCGTGTAACTTCCCCTGGG Direct Gain 0 0.789444208145142 Functional Gain 0.789444208145142 PPFIA1 ENSG00000131626 CDS Human protein_coding chr11:70118489 chr11:70118489 nonsynonymous SNV 0.997 0 21 hPsi_associated_SNPs_240172 0 17554300 Multiple complex diseases 0.000800498 Johnson and O'Donnell TagSNP rs546502 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
454 chr11 72947934 72947934 1 + G A rs11235688 72947934 - 72947914 72947954 41 TCCCTTTCCAAAGGCTAGGGCGGGGCCCTGTCCAGCTGAGC TCCCTTTCCAAAGGCTAGGGTGGGGCCCTGTCCAGCTGAGC Direct Gain 0 0.792257189750671 Functional Gain 0.792257189750671 P2RY2 ENSG00000175591 downstream Human protein_coding chr11:72947934 chr11:72947934 . . 0 21 hPsi_associated_SNPs_240274 0 27863252 Mean platelet volume 5e-11 GWAS_Catalog TagSNP rs11235688 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
455 chr11 72952496 72952496 1 + G A rs10898909 72952496 - 72952476 72952516 41 CCTCACTGCATTGTCTCTGTCTAGTAAACCGGGAAAAGAGG CCTCACTGCATTGTCTCTGTTTAGTAAACCGGGAAAAGAGG Direct Gain 0 0.993155419826508 Functional Gain 0.993155419826508 P2RY2 ENSG00000260401 ncRNA_exonic Human sense_overlapping chr11:72952496 chr11:72952496 . . 0 21 hPsi_associated_SNPs_240286 0 25524916 Glucose homeostasis traits 4e-06 GWAS_Catalog TagSNP rs10898909 GCST002726 Genetic Variants Associated With Quantitative Glucose Homeostasis Traits Translate to Type 2 Diabetes in Mexican Americans: The GUARDIAN (Genetics Underlying Diabetes in Hispanics) Consortium.
456 chr11 74883577 74883577 1 + G A rs12422149 74883577 - 74883557 74883597 41 CTGTGACTGCTAAGACCTTTCGCCGAAACTGAAGCTCACGT CTGTGACTGCTAAGACCTTTTGCCGAAACTGAAGCTCACGT Direct Gain 0 0.855331480503082 Functional Gain 0.855331480503082 SLCO2B1 ENSG00000137491 CDS Human protein_coding chr11:74883577 chr11:74883577 nonsynonymous SNV 0.088 0 21 hPsi_associated_SNPs_240354 0 17998437 Alzheimer's disease 0.000344 Johnson and O'Donnell TagSNP rs12422149 . Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.
457 chr11 76125330 76125330 1 + C A rs7927515 76125330 - 76125310 76125350 41 GTCTTGAAGAGAGTATAGAAGTTCCCAGTTCCACAAAGGTT GTCTTGAAGAGAGTATAGAATTTCCCAGTTCCACAAAGGTT Direct Gain 0 0.848893046379089 Functional Gain 0.848893046379089 LOC100506127 ENSG00000179240;ENSG00000255135 intergenic Human other chr11:76125330 chr11:76125330 . . 0 21 hPsi_associated_SNPs_240410 0 27841878 Systolic blood pressure 4e-09 GWAS_Catalog TagSNP rs7927515 GCST007099 Genome-wide association analyses using electronic health records identify new loci influencing blood pressure variation.
458 chr11 89868755 89868755 1 + G A rs10734123 89868755 - 89868735 89868775 41 TGATAGCGCACAGAAGTGGTCGTTTCTTTGAGAGGCTTAAT TGATAGCGCACAGAAGTGGTTGTTTCTTTGAGAGGCTTAAT Direct Gain 0 0.992293000221252 Functional Gain 0.992293000221252 NAALAD2 ENSG00000077616 CDS Human protein_coding chr11:89868755 chr11:89868755 synonymous SNV . 0 21 hPsi_associated_SNPs_240543 0 17052657 Parkinson's disease 0.000138585 Johnson and O'Donnell TagSNP rs10734123 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
459 chr11 102707305 102707305 1 + G A rs569444 102707305 - 102707285 102707325 41 AAGTGGAGAATTTATCTGATCGGAAGCAGAATAACCCTGTA AAGTGGAGAATTTATCTGATTGGAAGCAGAATAACCCTGTA Direct Gain 0 0.57329249382019 Functional Gain 0.57329249382019 WTAPP1 ENSG00000255282 ncRNA_exonic Human transcribed_processed_pseudogene chr11:102707305 chr11:102707305 . . 0 21 hPsi_associated_SNPs_240674 0 26634245 Post bronchodilator FEV1/FVC ratio 2e-07 GWAS_Catalog TagSNP rs569444 GCST003264 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
460 chr11 108175462 108175462 1 + G A rs1801516 108175462 - 108175442 108175482 41 TCTCCATGATTCATTTGTATCTTGGAGTAAAATATCATGAA TCTCCATGATTCATTTGTATTTTGGAGTAAAATATCATGAA Direct Gain 0 0.878481090068817 Functional Gain 0.878481090068817 ATM ENSG00000149311 CDS Human protein_coding chr11:108175462 chr11:108175462 nonsynonymous SNV 1.000 1 21 hPsi_associated_SNPs_240721 3 21983787 Melanoma 3e-09 GWAS_Catalog TagSNP rs1801516 GCST001267 Genome-wide association study identifies three new melanoma susceptibility loci.
461 chr12 6954864 6954864 1 + G A rs5442 6954864 - 6954844 6954884 41 GAAGGCCACGGACGTGATGCCGCAGATGATGCTCTCGTGGG GAAGGCCACGGACGTGATGCTGCAGATGATGCTCTCGTGGG Direct Gain 0 0.734683394432068 Functional Gain 0.734683394432068 GNB3 ENSG00000111664 CDS Human protein_coding chr12:6954864 chr12:6954864 nonsynonymous SNV 0.966 4 21 hPsi_associated_SNPs_241472 0 27182965 Myopia 2e-14 GWAS_Catalog TagSNP rs5442 GCST003997 Detection and interpretation of shared genetic influences on 42 human traits.
462 chr12 12618690 12618690 1 + G A rs3751262 12618690 - 12618670 12618710 41 CTACAGCCTGAGCTCGCGGTCGGGCTTCATGCTGAAGGGCT CTACAGCCTGAGCTCGCGGTTGGGCTTCATGCTGAAGGGCT Direct Gain 0 0.558545649051666 Functional Gain 0.558545649051666 BORCS5 ENSG00000165714 CDS Human protein_coding chr12:12618690 chr12:12618690 nonsynonymous SNV 0.070 2 21 hPsi_associated_SNPs_241652 0 17463248 Type II Diabetes Mellitus 0.022 Johnson and O'Donnell TagSNP rs3751262 . A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants.
463 chr12 48512285 48512285 1 + C A rs4760682 48512285 - 48512265 48512305 41 CCTCTTCCTCTTGCTTACTTGTATCTCTACCTCTGCACATT CCTCTTCCTCTTGCTTACTTTTATCTCTACCTCTGCACATT Direct Gain 0 0.982985019683838 Functional Gain 0.982985019683838 PFKM ENSG00000152556 CDS Human protein_coding chr12:48512285 chr12:48512285 nonsynonymous SNV 0.028 1 21 hPsi_associated_SNPs_242026 0 27863252 Hematocrit 4e-34 GWAS_Catalog TagSNP rs4760682 GCST004604 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
464 chr12 49373410 49373410 1 + T A rs61758378 49373410 - 49373390 49373430 41 CACTTGCACTCGCGCACGGCACTCTGCAGCCCCCCACTCAC CACTTGCACTCGCGCACGGCTCTCTGCAGCCCCCCACTCAC Direct Gain 0 0.958238065242767 Functional Gain 0.958238065242767 WNT1 ENSG00000125084 CDS Human protein_coding chr12:49373410 chr12:49373410 nonsynonymous SNV 0.984 1 21 hPsi_associated_SNPs_242049 1 30598549 Heel bone mineral density 1e-19 GWAS_Catalog TagSNP rs61758378 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
465 chr12 50366300 50366300 1 + G A rs2849266 50366300 - 50366280 50366320 41 ACAGAATGCAGATGTGAATACAGTCGACTTTACCAAGGACG ACAGAATGCAGATGTGAATATAGTCGACTTTACCAAGGACG Direct Gain 0 0.999521553516388 Functional Gain 0.999521553516388 AQP6 ENSG00000086159 UTR5 Human protein_coding chr12:50366300 chr12:50366300 . . 0 21 hPsi_associated_SNPs_242104 0 17554300 Multiple complex diseases 0.000167267 Johnson and O'Donnell TagSNP rs2849266 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
466 chr12 52381026 52381026 1 + C A rs2252518 52381026 - 52381006 52381046 41 CTGCATGAATCCCGTGCTATGCGCACCGGGGCACTCCCCGC CTGCATGAATCCCGTGCTATTCGCACCGGGGCACTCCCCGC Direct Gain 0 0.987523317337036 Functional Gain 0.987523317337036 ACVR1B ENSG00000135503 UTR3 Human protein_coding chr12:52381026 chr12:52381026 . . 0 21 hPsi_associated_SNPs_242188 0 24939585 Age-related hearing impairment 5e-07 GWAS_Catalog TagSNP rs2252518 GCST002491 Genome-wide association analysis demonstrates the highly polygenic character of age-related hearing impairment.
467 chr12 53442956 53442956 1 + G A rs12369033 53442956 - 53442936 53442976 41 GACTGGACAGGAGGTCCCCCCTCCCAACACATACTCCACCC GACTGGACAGGAGGTCCCCCTTCCCAACACATACTCCACCC Direct Gain 0 0.999791443347931 Functional Gain 0.999791443347931 TNS2 ENSG00000111077 CDS Human protein_coding chr12:53442956 chr12:53442956 nonsynonymous SNV 0.944 1 21 hPsi_associated_SNPs_242231 0 30595370 Systolic blood pressure 7e-17 GWAS_Catalog TagSNP rs12369033 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
468 chr12 56115585 56115585 1 + C A rs3138142 56115585 - 56115565 56115605 41 AGCAGGGCAAGGGTGACCCCGATGGGACCCATTGTGTTCAC AGCAGGGCAAGGGTGACCCCTATGGGACCCATTGTGTTCAC Direct Gain 0 0.984013617038727 Functional Gain 0.984013617038727 RDH5 ENSG00000135437 CDS Human protein_coding chr12:56115585 chr12:56115585 synonymous SNV . 0 21 hPsi_associated_SNPs_242348 0 27020472 Spherical equivalent (joint analysis main effects and education interaction) 1e-08 GWAS_Catalog TagSNP rs3138142 GCST003455 Meta-analysis of gene-environment-wide association scans accounting for education level identifies additional loci for refractive error.
469 chr12 56115778 56115778 1 + C A rs3138141 56115778 - 56115758 56115798 41 TCTGCTGGCCCACGTTTGTTGAGTGGGCTGCTGTTAGTCCT TCTGCTGGCCCACGTTTGTTTAGTGGGCTGCTGTTAGTCCT Direct Gain 0 0.864477753639221 Functional Gain 0.864477753639221 BLOC1S1-RDH5 ENSG00000258311 UTR3 Human protein_coding chr12:56115778 chr12:56115778 . . 0 21 hPsi_associated_SNPs_242349 0 27182965 Myopia 2e-51 GWAS_Catalog TagSNP rs3138141 GCST003997 Detection and interpretation of shared genetic influences on 42 human traits.
470 chr12 56435929 56435929 1 + C A rs1131017 56435929 - 56435909 56435949 41 TTGGAGGCACGGACCGGAGAGAGGAGACGGTGCCTGGCAGG TTGGAGGCACGGACCGGAGATAGGAGACGGTGCCTGGCAGG Direct Gain 0 0.987475872039795 Functional Gain 0.987475872039795 RPS26 ENSG00000197728 UTR5 Human protein_coding chr12:56435929 chr12:56435929 . . 0 21 hPsi_associated_SNPs_242370 0 30038396 Cognitive performance 4e-09 GWAS_Catalog TagSNP rs1131017 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
471 chr12 66359752 66359752 1 + C A rs8756 66359752 - 66359732 66359772 41 AGTTAAATGTCCAGTCTTATGTAGCTGCGACCAACAACAGC AGTTAAATGTCCAGTCTTATTTAGCTGCGACCAACAACAGC Direct Gain 0 0.862411618232727 Functional Gain 0.862411618232727 HMGA2 ENSG00000149948 UTR3 Human protein_coding chr12:66359752 chr12:66359752 . . 0 21 hPsi_associated_SNPs_242544 0 20397748 Height 4e-07 GWAS_Catalog TagSNP rs8756 GCST000644 Genome-wide association study of height and body mass index in Australian twin families.
472 chr12 69744014 69744014 1 + C A rs1800973 69744014 - 69743994 69744034 41 AGGCATTAACTGCTCCTGGGGTTTTGCCATCATTACACCAG AGGCATTAACTGCTCCTGGGTTTTTGCCATCATTACACCAG Direct Gain 0 0.91220223903656 Functional Gain 0.91220223903656 LYZ ENSG00000090382 CDS Human protein_coding chr12:69744014 chr12:69744014 nonsynonymous SNV 0.760 4 21 hPsi_associated_SNPs_242578 1 27863252 Monocyte count 1e-53 GWAS_Catalog TagSNP rs1800973 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
473 chr12 93155535 93155535 1 + G A rs1504907 93155535 - 93155515 93155555 41 AGATAAACATCTAGGAATCTCGTGCTTTCTGAGGAAAAAAA AGATAAACATCTAGGAATCTTGTGCTTTCTGAGGAAAAAAA Direct Gain 0 0.512098550796509 Functional Gain 0.512098550796509 PLEKHG7 ENSG00000187510 CDS Human protein_coding chr12:93155535 chr12:93155535 synonymous SNV . 0 21 hPsi_associated_SNPs_242745 0 17848626 Type II Diabetes Mellitus 4e-05 Johnson and O'Donnell TagSNP rs1504907 . A 100K genome-wide association scan for diabetes and related traits in the Framingham Heart Study: replication and integration with other genome-wide datasets.
474 chr12 93164936 93164936 1 + G A rs10507017 93164936 - 93164916 93164956 41 CTTTGATGCAATAATCTGACCCTAAGAACTAGTTCCTTGAA CTTTGATGCAATAATCTGACTCTAAGAACTAGTTCCTTGAA Direct Gain 0 0.936635911464691 Functional Gain 0.936635911464691 PLEKHG7 ENSG00000102189;ENSG00000187510 UTR3 Human other chr12:93164936 chr12:93164936 . . 0 21 hPsi_associated_SNPs_242746 0 26242244 Exploratory eye movement dysfunction in schizophrenia (responsive search score) 3e-06 GWAS_Catalog TagSNP rs10507017 GCST003065 Association of chromosome 5q21.3 polymorphisms with the exploratory eye movement dysfunction in schizophrenia.
475 chr12 102742243 102742243 1 + C A rs35638230 102742243 - 102742223 102742263 41 GACTAAACCAACTCTGTAAGGATTCAGAGCTTGTTATGTGA GACTAAACCAACTCTGTAAGTATTCAGAGCTTGTTATGTGA Direct Gain 0 0.902884840965271 Functional Gain 0.902884840965271 PMCH;IGF1 ENSG00000258142;ENSG00000017427 intergenic Human other chr12:102742243 chr12:102742243 . . 0 21 hPsi_associated_SNPs_242998 0 30595370 Lung function (FEV1/FVC) 4e-08 GWAS_Catalog TagSNP rs35638230 GCST007080 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
476 chr12 107713696 107713696 1 + G A rs111260184 107713696 - 107713676 107713716 41 GTGGTGGTTGGCGGCGGCTGCCGGCGGGACTGCGGCGGCCG GTGGTGGTTGGCGGCGGCTGTCGGCGGGACTGCGGCGGCCG Direct Gain 0 0.999248385429382 Functional Gain 0.999248385429382 BTBD11 ENSG00000151136 CDS Human protein_coding chr12:107713696 chr12:107713696 nonsynonymous SNV 0.121 1 21 hPsi_associated_SNPs_243103 0 30595370 Body mass index 3e-09 GWAS_Catalog TagSNP rs111260184 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
477 chr12 112241766 112241766 1 + G A rs671 112241766 - 112241746 112241786 41 CACACTCACAGTTTTCACTTCAGTGTATGCCTGCAGCCCGT CACACTCACAGTTTTCACTTTAGTGTATGCCTGCAGCCCGT Direct Gain 0 0.777458369731903 Functional Gain 0.777458369731903 ALDH2 ENSG00000111275 CDS Human protein_coding chr12:112241766 chr12:112241766 nonsynonymous SNV 0.952 4 21 hPsi_associated_SNPs_243222 5 21971053 Coronary heart disease 2e-34 GWAS_Catalog TagSNP rs671 GCST001260 Genome-wide association study of coronary artery disease in the Japanese.
478 chr12 113410316 113410316 1 + G A rs10744791 113410316 - 113410296 113410336 41 AGAACTTTAGCGTCAACTTACCTGGTTCCATCGAAAAGCAT AGAACTTTAGCGTCAACTTATCTGGTTCCATCGAAAAGCAT Direct Gain 0 0.543502748012543 Functional Gain 0.543502748012543 OAS3 ENSG00000257452 ncRNA_intronic Human antisense chr12:113410316 chr12:113410316 . . 0 21 hPsi_associated_SNPs_243256 0 17554300 Multiple complex diseases 0.000864757 Johnson and O'Donnell TagSNP rs10744791 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
479 chr12 113448652 113448652 1 + C A rs13311 113448652 - 113448632 113448672 41 GTTGGAAGCACCGAGAGCAAGATCACAGAGTTATGAGAACC GTTGGAAGCACCGAGAGCAATATCACAGAGTTATGAGAACC Direct Gain 0 0.788759231567383 Functional Gain 0.788759231567383 OAS2 ENSG00000257452 ncRNA_intronic Human antisense chr12:113448652 chr12:113448652 . . 0 21 hPsi_associated_SNPs_243262 0 17463246 Multiple continuous traits in DGI samples 0.0009216 Johnson and O'Donnell TagSNP rs13311 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
480 chr12 121176083 121176083 1 + G A rs1799958 121176083 - 121176063 121176103 41 GACCAGGAAGGCACTGATGCCCTGAAAGGAGAGGCGGGTGG GACCAGGAAGGCACTGATGCTCTGAAAGGAGAGGCGGGTGG Direct Gain 0 0.984606862068176 Functional Gain 0.984606862068176 ACADS ENSG00000122971 CDS Human protein_coding chr12:121176083 chr12:121176083 nonsynonymous SNV 0.963 3 21 hPsi_associated_SNPs_243382 3 29545352 Serum metabolite ratios in chronic kidney disease 2e-33 GWAS_Catalog TagSNP rs1799958 GCST005650 Genome-Wide Association Studies of Metabolites in Patients with CKD Identify Multiple Loci and Illuminate Tubular Transport Mechanisms.
481 chr12 121435587 121435587 1 + G A rs2259816 121435587 - 121435567 121435607 41 GACACCCTCAATCACGGAAACACACTTGTCCCAGAGACACA GACACCCTCAATCACGGAAATACACTTGTCCCAGAGACACA Direct Gain 0 0.861435353755951 Functional Gain 0.861435353755951 HNF1A ENSG00000135100 CDS Human protein_coding chr12:121435587 chr12:121435587 synonymous SNV . 0 21 hPsi_associated_SNPs_243389 0 22939635 C-reactive protein 3e-10 GWAS_Catalog TagSNP rs2259816 GCST001650 Genome-wide association and population genetic analysis of C-reactive protein in African American and Hispanic American women.
482 chr12 121439433 121439433 1 + G A rs1169310 121439433 - 121439413 121439453 41 AGAACAAGGCCACGCTGATCCAGGGCCTCTCAGAGCTCAGC AGAACAAGGCCACGCTGATCTAGGGCCTCTCAGAGCTCAGC Direct Gain 0 0.985739946365356 Functional Gain 0.985739946365356 HNF1A ENSG00000135100 UTR3 Human protein_coding chr12:121439433 chr12:121439433 . . 0 21 hPsi_associated_SNPs_243394 1 18439552 C-reactive protein 2e-08 GWAS_Catalog TagSNP rs1169310 GCST000179 Polymorphisms of the HNF1A gene encoding hepatocyte nuclear factor-1 alpha are associated with C-reactive protein.
483 chr12 122186317 122186317 1 + G A rs28655666 122186317 - 122186297 122186337 41 GGGCAGGTAGGCCTCCATGTCGAAGAAGACGTCCTGCCGCT GGGCAGGTAGGCCTCCATGTTGAAGAAGACGTCCTGCCGCT Direct Gain 0 0.905516505241394 Functional Gain 0.905516505241394 TMEM120B ENSG00000188735 CDS Human protein_coding chr12:122186317 chr12:122186317 nonsynonymous SNV 0.995 1 21 hPsi_associated_SNPs_243413 0 29500382 Experiencing mood swings 6e-10 GWAS_Catalog TagSNP rs28655666 GCST006944 Item-level analyses reveal genetic heterogeneity in neuroticism.
484 chr12 123070218 123070218 1 + G A rs36117464 123070218 - 123070198 123070238 41 AAGAAGTCACTGTAAGACCACTCTTCATATGGATCTTTATG AAGAAGTCACTGTAAGACCATTCTTCATATGGATCTTTATG Direct Gain 0 0.93618768453598 Functional Gain 0.93618768453598 KNTC1 ENSG00000184445 CDS Human protein_coding chr12:123070218 chr12:123070218 synonymous SNV . 0 21 hPsi_associated_SNPs_243458 0 30038396 Cognitive performance (MTAG) 3e-08 GWAS_Catalog TagSNP rs36117464 GCST006570 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
485 chr12 126143346 126143346 1 + G A rs1043607 126143346 - 126143326 126143366 41 CAGTGCATTTCATGATGTTACTAGGTCTCAAATGTTTTTCC CAGTGCATTTCATGATGTTATTAGGTCTCAAATGTTTTTCC Direct Gain 0 0.980990827083588 Functional Gain 0.980990827083588 TMEM132B ENSG00000139364 UTR3 Human protein_coding chr12:126143346 chr12:126143346 . . 0 21 hPsi_associated_SNPs_243586 0 24322204 Bipolar disorder (body mass index interaction) 4e-06 GWAS_Catalog TagSNP rs1043607 GCST002306 Genome-wide association study of bipolar disorder accounting for effect of body mass index identifies a new risk allele in TCF7L2.
486 chr12 129100757 129100757 1 + C A rs117965239 129100757 - 129100737 129100777 41 ATGGGCTGAGTCCCTGAAAGGCTGCTGAAACTGGCTATTTC ATGGGCTGAGTCCCTGAAAGTCTGCTGAAACTGGCTATTTC Direct Gain 0 0.994749069213867 Functional Gain 0.994749069213867 TMEM132C ENSG00000181234 CDS Human protein_coding chr12:129100757 chr12:129100757 nonsynonymous SNV 0.991 2 21 hPsi_associated_SNPs_243606 0 29875488 Blood protein levels 4e-12 GWAS_Catalog TagSNP rs117965239 GCST005806 Genomic atlas of the human plasma proteome.
487 chr12 132325239 132325239 1 + G A rs6598163 132325239 - 132325219 132325259 41 GTCGATCTGGATGTCGGCGGCGCTGCCCGCCACCTCGTGGA GTCGATCTGGATGTCGGCGGTGCTGCCCGCCACCTCGTGGA Direct Gain 0 0.868162274360657 Functional Gain 0.868162274360657 MMP17 ENSG00000198598 CDS Human protein_coding chr12:132325239 chr12:132325239 nonsynonymous SNV 0.001 0 21 hPsi_associated_SNPs_243653 0 22683712 Migraine 5e-07 GWAS_Catalog TagSNP rs6598163 GCST001563 Genome-wide association analysis identifies susceptibility loci for migraine without aura.
488 chr12 133487774 133487774 1 + G A rs77927866 133487774 - 133487754 133487794 41 CGAGGTCAGGAGATCAAGACCAGCCTGGCCAACATGGTGAA CGAGGTCAGGAGATCAAGACTAGCCTGGCCAACATGGTGAA Direct Gain 0 0.980495572090149 Functional Gain 0.980495572090149 LOC101928530;ZNF605 ENSG00000072609 intronic Human protein_coding chr12:133487774 chr12:133487774 . . 0 21 hPsi_associated_SNPs_243751 0 30595370 Body mass index 3e-10 GWAS_Catalog TagSNP rs77927866 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
489 chr12 133780309 133780309 1 + G A rs36127550 133780309 - 133780289 133780329 41 TGTACAATGAGCTGGGACTTCAAACTAAAGGTTTTTGCACA TGTACAATGAGCTGGGACTTTAAACTAAAGGTTTTTGCACA Direct Gain 0 0.988925218582153 Functional Gain 0.988925218582153 ZNF268 ENSG00000090612 CDS Human protein_coding chr12:133780309 chr12:133780309 synonymous SNV . 0 21 hPsi_associated_SNPs_243762 0 30595370 Waist-hip ratio 1e-10 GWAS_Catalog TagSNP rs36127550 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
490 chr13 24553861 24553861 1 + G A rs9510982 24553861 - 24553841 24553881 41 GGCCCAGGACCGCAGCGAATCAGTCTCTGGCTCCCCGCCCA GGCCCAGGACCGCAGCGAATTAGTCTCTGGCTCCCCGCCCA Direct Gain 0 0.99986070394516 Functional Gain 0.99986070394516 SPATA13 ENSG00000273167 UTR5 Human protein_coding chr13:24553861 chr13:24553861 . . 0 21 hPsi_associated_SNPs_243834 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 3.1e-05 Johnson and O'Donnell TagSNP rs9510982 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
491 chr13 28009031 28009031 1 + G A rs7323 28009031 - 28009011 28009051 41 TTCTCTTGGACAGCGACATACATCCCTTTCTGGGGCATGAG TTCTCTTGGACAGCGACATATATCCCTTTCTGGGGCATGAG Direct Gain 0 0.606233358383179 Functional Gain 0.606233358383179 GTF3A ENSG00000122034 CDS Human protein_coding chr13:28009031 chr13:28009031 nonsynonymous SNV 0.433 1 21 hPsi_associated_SNPs_243901 0 17463246 Multiple continuous traits in DGI samples 0.0002991 Johnson and O'Donnell TagSNP rs7323 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
492 chr13 31903834 31903834 1 + G A rs1060709 31903834 - 31903814 31903854 41 AGTCTCCAGTTCATTCCCTGCGCAGGCTAGGCGCACAGGTC AGTCTCCAGTTCATTCCCTGTGCAGGCTAGGCGCACAGGTC Direct Gain 0 0.520539879798889 Functional Gain 0.520539879798889 B3GLCT ENSG00000187676 UTR3 Human protein_coding chr13:31903834 chr13:31903834 . . 0 21 hPsi_associated_SNPs_243952 0 30038396 Highest math class taken (MTAG) 3e-13 GWAS_Catalog TagSNP rs1060709 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
493 chr13 50963685 50963685 1 + G A rs41284828 50963685 - 50963665 50963705 41 ATTCAGACAACACACACCACCAACGCTGAAATGTAGAGCTC ATTCAGACAACACACACCACTAACGCTGAAATGTAGAGCTC Direct Gain 0 0.999915182590485 Functional Gain 0.999915182590485 DLEU1 ENSG00000221198;ENSG00000229323 intergenic Human other chr13:50963685 chr13:50963685 . . 0 21 hPsi_associated_SNPs_244188 0 30595370 Body mass index 3e-09 GWAS_Catalog TagSNP rs41284828 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
494 chr13 113537448 113537448 1 + G A rs3742233 113537448 - 113537428 113537468 41 GGGACAAGGGGACGAGAGGACGTGGGGATGAGGAGACGAGG GGGACAAGGGGACGAGAGGATGTGGGGATGAGGAGACGAGG Direct Gain 0 0.907974898815155 Functional Gain 0.907974898815155 ATP11A ENSG00000068650 UTR3 Human protein_coding chr13:113537448 chr13:113537448 . . 0 21 hPsi_associated_SNPs_244577 0 29739929 Low tan response 1e-16 GWAS_Catalog TagSNP rs3742233 GCST005897 Genome-wide association study in 176,678 Europeans reveals genetic loci for tanning response to sun exposure.
495 chr13 114623821 114623821 1 + G A rs41284486 114623821 - 114623801 114623841 41 CACAGGAGCGATGCAGTGGGCACAGGTCACCACGCATGGCC CACAGGAGCGATGCAGTGGGTACAGGTCACCACGCATGGCC Direct Gain 0 0.977488279342651 Functional Gain 0.977488279342651 LINC00452 ENSG00000229373 ncRNA_exonic Human lincRNA chr13:114623821 chr13:114623821 . . 0 21 hPsi_associated_SNPs_244647 0 30595370 Cardiovascular disease 1e-07 GWAS_Catalog TagSNP rs41284486 GCST007072 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
496 chr13 115002305 115002305 1 + G A rs8002514 115002305 - 115002285 115002325 41 TGTGCTGTCAGGTAAAGACACTGAGCCAACCAATAGATGTC TGTGCTGTCAGGTAAAGACATTGAGCCAACCAATAGATGTC Direct Gain 0 0.989061594009399 Functional Gain 0.989061594009399 CDC16 ENSG00000130177 CDS Human protein_coding chr13:115002305 chr13:115002305 synonymous SNV . 0 21 hPsi_associated_SNPs_244657 0 30595370 Height 3e-42 GWAS_Catalog TagSNP rs8002514 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
497 chr13 115047305 115047305 1 + G A rs3752105 115047305 - 115047285 115047325 41 CCACCTTGCTCAGGGCCGTCCTCTTCTCCTCGCGAGGTTTG CCACCTTGCTCAGGGCCGTCTTCTTCTCCTCGCGAGGTTTG Direct Gain 0 0.996402382850647 Functional Gain 0.996402382850647 UPF3A ENSG00000169062 CDS Human protein_coding chr13:115047305 chr13:115047305 nonsynonymous SNV 0.979 0 21 hPsi_associated_SNPs_244660 0 30595370 Cardiovascular disease 8e-09 GWAS_Catalog TagSNP rs3752105 GCST007072 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
498 chr14 23313633 23313633 1 + G A rs17880989 23313633 - 23313613 23313653 41 CGCCAGAACTGGCCAATGGGCATTGGGTATCCATCCATCAC CGCCAGAACTGGCCAATGGGTATTGGGTATCCATCCATCAC Direct Gain 0 0.551300704479218 Functional Gain 0.551300704479218 MMP14 ENSG00000157227 CDS Human protein_coding chr14:23313633 chr14:23313633 nonsynonymous SNV 1.000 2 21 hPsi_associated_SNPs_244838 0 30595370 Height 5e-15 GWAS_Catalog TagSNP rs17880989 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
499 chr14 23779877 23779877 1 + C A rs3210043 23779877 - 23779857 23779897 41 AGAGACCCCCCACCCCAACTGCTTGCCACAAGCTGGCTCTG AGAGACCCCCCACCCCAACTTCTTGCCACAAGCTGGCTCTG Direct Gain 0 0.877217471599579 Functional Gain 0.877217471599579 BCL2L2 ENSG00000129473 UTR3 Human protein_coding chr14:23779877 chr14:23779877 . . 0 21 hPsi_associated_SNPs_244865 0 28552196 Height 4e-09 GWAS_Catalog TagSNP rs3210043 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
500 chr14 24771285 24771285 1 + G A rs4280164 24771285 - 24771265 24771305 41 CTACTGAGGAACCGCGAGTACTCAGGTAGCCAATCACAGCA CTACTGAGGAACCGCGAGTATTCAGGTAGCCAATCACAGCA Direct Gain 0 0.821530759334564 Functional Gain 0.821530759334564 NOP9 ENSG00000196943 CDS Human protein_coding chr14:24771285 chr14:24771285 nonsynonymous SNV 0.852 1 21 hPsi_associated_SNPs_244932 0 24571439 Parent of origin effect on language impairment (paternal) 4e-08 GWAS_Catalog TagSNP rs4280164 GCST002371 Genome-wide association analyses of child genotype effects and parent-of-origin effects in specific language impairment.
501 chr14 57280046 57280046 1 + C A rs61997667 57280046 - 57280026 57280066 41 CTGCTACCAACTGCTGCAGAGTCTGGGCAGAATTCCTCTAG CTGCTACCAACTGCTGCAGATTCTGGGCAGAATTCCTCTAG Direct Gain 0 0.932320594787598 Functional Gain 0.932320594787598 OTX2-AS1 ENSG00000248550 ncRNA_exonic Human lincRNA chr14:57280046 chr14:57280046 . . 0 21 hPsi_associated_SNPs_245222 0 30038396 Educational attainment (MTAG) 2e-13 GWAS_Catalog TagSNP rs61997667 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
502 chr14 59971039 59971039 1 + T A rs7560 59971039 - 59971019 59971059 41 ACAGCTGAACTGTTGAGAGAAGCAAGGGCTTCCTAGCGGCC ACAGCTGAACTGTTGAGAGATGCAAGGGCTTCCTAGCGGCC Direct Gain 0 0.697589933872223 Functional Gain 0.697589933872223 JKAMP ENSG00000258782 ncRNA_intronic Human processed_transcript chr14:59971039 chr14:59971039 . . 0 21 hPsi_associated_SNPs_245251 0 17052657 Parkinson's disease 0.000948623 Johnson and O'Donnell TagSNP rs7560 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
503 chr14 60976537 60976537 1 + C A rs33912345 60976537 - 60976517 60976557 41 GTACCACTCGCGTAGCAGGTGCCGCGTGCGCTCCTTGAAGC GTACCACTCGCGTAGCAGGTTCCGCGTGCGCTCCTTGAAGC Direct Gain 0 0.982121348381042 Functional Gain 0.982121348381042 SIX6 ENSG00000184302 CDS Human protein_coding chr14:60976537 chr14:60976537 nonsynonymous SNV 0.961 2 21 hPsi_associated_SNPs_245275 2 26752265 Glaucoma (high intraocular pressure) 1e-09 GWAS_Catalog TagSNP rs33912345 GCST003344 Genome-wide association analysis identifies TXNRD2, ATXN2 and FOXC1 as susceptibility loci for primary open-angle glaucoma.
504 chr14 69708241 69708241 1 + G A rs1043254 69708241 - 69708221 69708261 41 AGCCTTTGGAAGAACTTTTTCTCCCCTCCTAACAGGACCGA AGCCTTTGGAAGAACTTTTTTTCCCCTCCTAACAGGACCGA Direct Gain 0 0.509287297725677 Functional Gain 0.509287297725677 EXD2 ENSG00000258520 ncRNA_intronic Human lincRNA chr14:69708241 chr14:69708241 . . 0 21 hPsi_associated_SNPs_245417 0 30038396 Cognitive performance 7e-09 GWAS_Catalog TagSNP rs1043254 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
505 chr14 71374702 71374702 1 + G A rs2526882 71374702 - 71374682 71374722 41 ACCATGTAGAGGGTGAAGGGCAGGCCCAGCAGAAAGAGCCA ACCATGTAGAGGGTGAAGGGTAGGCCCAGCAGAAAGAGCCA Direct Gain 0 0.999035000801086 Functional Gain 0.999035000801086 PCNX1 ENSG00000100731 CDS Human protein_coding chr14:71374702 chr14:71374702 synonymous SNV . 0 21 hPsi_associated_SNPs_245474 0 28991256 Schizophrenia 1e-06 GWAS_Catalog TagSNP rs2526882 GCST004946 Genome-wide association analysis identifies 30 new susceptibility loci for schizophrenia.
506 chr14 103377321 103377321 1 + G A rs10133111 103377321 - 103377301 103377341 41 TGTGCAGCGTCGACACTGCCCTCCACACTTCACAGACCTTC TGTGCAGCGTCGACACTGCCTTCCACACTTCACAGACCTTC Direct Gain 0 0.999997735023499 Functional Gain 0.999997735023499 TRAF3 ENSG00000131323 UTR3 Human protein_coding chr14:103377321 chr14:103377321 . . 0 21 hPsi_associated_SNPs_246077 0 19023125 Brain imaging in schizophrenia (dorsolateral prefrontal cortex interaction) 5e-06 GWAS_Catalog TagSNP rs10133111 GCST000271 A genome-wide association study of schizophrenia using brain activation as a quantitative phenotype.
507 chr15 29033909 29033909 1 + G A rs56166703 29033909 - 29033889 29033929 41 TGCAGGCCCAGCACCCATGGCTGCGGCCGCGGCGTCGCCCT TGCAGGCCCAGCACCCATGGTTGCGGCCGCGGCGTCGCCCT Direct Gain 0 0.93231862783432 Functional Gain 0.93231862783432 LOC100289656 ENSG00000232431 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr15:29033909 chr15:29033909 . . 0 21 hPsi_associated_SNPs_246463 0 30595370 Hair color 1e-245 GWAS_Catalog TagSNP rs56166703 GCST007082 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
508 chr15 44063859 44063859 1 + G A rs3087657 44063859 - 44063839 44063879 41 TAGCCATATTTCAGATGCTCCGTAGCTACCTGTACTGAACA TAGCCATATTTCAGATGCTCTGTAGCTACCTGTACTGAACA Direct Gain 0 0.996949195861816 Functional Gain 0.996949195861816 PDIA3 ENSG00000167004 UTR3 Human protein_coding chr15:44063859 chr15:44063859 . . 0 21 hPsi_associated_SNPs_246822 0 30038396 Self-reported math ability (MTAG) 1e-09 GWAS_Catalog TagSNP rs3087657 GCST006569 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
509 chr15 51975608 51975608 1 + G A rs2305710 51975608 - 51975588 51975628 41 GAAATTTATGATCCAATCCACTCTTAGTAGAGTCATAATCA GAAATTTATGATCCAATCCATTCTTAGTAGAGTCATAATCA Direct Gain 0 0.996233522891998 Functional Gain 0.996233522891998 SCG3 ENSG00000104112 CDS Human protein_coding chr15:51975608 chr15:51975608 nonsynonymous SNV 0.998 1 21 hPsi_associated_SNPs_246948 0 29875488 Blood protein levels 2e-13 GWAS_Catalog TagSNP rs2305710 GCST005806 Genomic atlas of the human plasma proteome.
510 chr15 58834741 58834741 1 + G A rs690 58834741 - 58834721 58834761 41 ACATGGCTTCGAGAGAGTTGCACAGATTCCTGGAAGACAGC ACATGGCTTCGAGAGAGTTGTACAGATTCCTGGAAGACAGC Direct Gain 0 0.795048475265503 Functional Gain 0.795048475265503 LIPC ENSG00000166035 CDS Human protein_coding chr15:58834741 chr15:58834741 synonymous SNV . 0 21 hPsi_associated_SNPs_247022 0 17463246 Multiple continuous traits in DGI samples 0.0001843 Johnson and O'Donnell TagSNP rs690 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
511 chr15 63433766 63433766 1 + G A rs2729835 63433766 - 63433746 63433786 41 ACGAACCATACGTTTGTTTCCTTTCCACAACACCCCACGCC ACGAACCATACGTTTGTTTCTTTTCCACAACACCCCACGCC Direct Gain 0 0.995814621448517 Functional Gain 0.995814621448517 LACTB ENSG00000103642 CDS Human protein_coding chr15:63433766 chr15:63433766 nonsynonymous SNV 0.998 0 21 hPsi_associated_SNPs_247098 0 27618447 Systolic blood pressure 2e-06 GWAS_Catalog TagSNP rs2729835 GCST006021 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
512 chr15 63891961 63891961 1 + G A rs57017013 63891961 - 63891941 63891981 41 CTAATGGGCCGGGGCCTTGGCTCCCCGCAGCCAGAGGGAGC CTAATGGGCCGGGGCCTTGGTTCCCCGCAGCCAGAGGGAGC Direct Gain 0 0.564900636672974 Functional Gain 0.564900636672974 USP3-AS1 ENSG00000259248 ncRNA_intronic Human antisense chr15:63891961 chr15:63891961 . . 0 21 hPsi_associated_SNPs_247111 0 24324551 QRS duration in Tripanosoma cruzi seropositivity 2e-06 GWAS_Catalog TagSNP rs57017013 GCST002284 Genome wide association study (GWAS) of Chagas cardiomyopathy in Trypanosoma cruzi seropositive subjects.
513 chr15 69561518 69561518 1 + G A rs3865014 69561518 - 69561498 69561538 41 CTTGACAAATTCTTTGAAGACTGGGGACTCATCAATGGTAC CTTGACAAATTCTTTGAAGATTGGGGACTCATCAATGGTAC Direct Gain 0 0.982080519199371 Functional Gain 0.982080519199371 GLCE ENSG00000138604 CDS Human protein_coding chr15:69561518 chr15:69561518 nonsynonymous SNV 0.660 0 21 hPsi_associated_SNPs_247241 0 30072576 Blood protein levels 2e-229 GWAS_Catalog TagSNP rs3865014 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
514 chr15 78833450 78833450 1 + C A rs59133824 78833450 - 78833430 78833470 41 CCAATGGGGCTCCTCTGAATGATTCCCAAGGCCCACAGGAA CCAATGGGGCTCCTCTGAATTATTCCCAAGGCCCACAGGAA Direct Gain 0 0.995339393615723 Functional Gain 0.995339393615723 PSMA4 ENSG00000041357 intronic Human protein_coding chr15:78833450 chr15:78833450 . . 0 21 hPsi_associated_SNPs_247485 0 26634245 Post bronchodilator FEV1/FVC ratio 3e-07 GWAS_Catalog TagSNP rs59133824 GCST003264 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
515 chr15 78857896 78857896 1 + T A rs503464 78857896 - 78857876 78857916 41 CCCGCCGGGACAGCAGCCTCAGCCTAGCAGCTTCTGGCGGG CCCGCCGGGACAGCAGCCTCTGCCTAGCAGCTTCTGGCGGG Direct Gain 0 0.806677222251892 Functional Gain 0.806677222251892 CHRNA5 ENSG00000169684 UTR5 Human protein_coding chr15:78857896 chr15:78857896 . . 0 21 hPsi_associated_SNPs_247489 0 26030696 Emphysema imaging phenotypes 3e-07 GWAS_Catalog TagSNP rs503464 GCST002945 A Genome-Wide Association Study of Emphysema and Airway Quantitative Imaging Phenotypes.
516 chr15 78882925 78882925 1 + G A rs16969968 78882925 - 78882905 78882945 41 TGTAATGTAGCGAATAGAATCGAGCGCAGCTTCCAATGTGT TGTAATGTAGCGAATAGAATTGAGCGCAGCTTCCAATGTGT Direct Gain 0 0.858148694038391 Functional Gain 0.858148694038391 CHRNA5 ENSG00000169684 CDS Human protein_coding chr15:78882925 chr15:78882925 nonsynonymous SNV 0.039 0 21 hPsi_associated_SNPs_247491 2 26634245 Pre bronchodilator FEV1 2e-09 GWAS_Catalog TagSNP rs16969968 GCST003266 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
517 chr15 80472526 80472526 1 + C A rs11555096 80472526 - 80472506 80472546 41 AGCCAGGAGGTCCCCCGGCCGCAGGTTGCAGCCGTTGACAG AGCCAGGAGGTCCCCCGGCCTCAGGTTGCAGCCGTTGACAG Direct Gain 0 0.787297904491425 Functional Gain 0.787297904491425 FAH ENSG00000103876 CDS Human protein_coding chr15:80472526 chr15:80472526 synonymous SNV . 0 21 hPsi_associated_SNPs_247529 0 29875488 Blood protein levels 2e-121 GWAS_Catalog TagSNP rs11555096 GCST005806 Genomic atlas of the human plasma proteome.
518 chr15 81587757 81587757 1 + T A rs17875496 81587757 - 81587737 81587777 41 GCAGTCAATGCAGCTTTACAACTTAGAACAGCACAAATGTG GCAGTCAATGCAGCTTTACATCTTAGAACAGCACAAATGTG Direct Gain 0 0.908666968345642 Functional Gain 0.908666968345642 IL16 ENSG00000172349 UTR3 Human protein_coding chr15:81587757 chr15:81587757 . . 0 21 hPsi_associated_SNPs_247568 0 28928442 Number of common colds 9e-06 GWAS_Catalog TagSNP rs17875496 GCST005019 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
519 chr15 82387862 82387862 1 + G A rs3087595 82387862 - 82387842 82387882 41 TGGGCAGCACTTTTCAGTTCCTCGATGGCATCTTGGAAAAT TGGGCAGCACTTTTCAGTTCTTCGATGGCATCTTGGAAAAT Direct Gain 0 0.999335944652557 Functional Gain 0.999335944652557 LINC01583 ENSG00000259518 CDS Human lincRNA chr15:82387862 chr15:82387862 nonsynonymous SNV . 0 21 hPsi_associated_SNPs_247579 0 30595370 Red blood cell count 8e-11 GWAS_Catalog TagSNP rs3087595 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
520 chr15 91426560 91426560 1 + G A rs4702 91426560 - 91426540 91426580 41 ATCACTGTGCACCAACCCAGCATCTTACAAAACCAGCCGGG ATCACTGTGCACCAACCCAGTATCTTACAAAACCAGCCGGG Direct Gain 0 0.999988913536072 Functional Gain 0.999988913536072 FURIN ENSG00000140564 UTR3 Human protein_coding chr15:91426560 chr15:91426560 . . 0 21 hPsi_associated_SNPs_247838 0 29500382 Feeling hurt 2e-09 GWAS_Catalog TagSNP rs4702 GCST006951 Item-level analyses reveal genetic heterogeneity in neuroticism.
521 chr15 93007974 93007974 1 + G A rs2290492 93007974 - 93007954 93007994 41 TCGCCATTCATCCATGAGCCCAAAGATCCCTCCAAGCCAGG TCGCCATTCATCCATGAGCCTAAAGATCCCTCCAAGCCAGG Direct Gain 0 0.992117762565613 Functional Gain 0.992117762565613 ST8SIA2 ENSG00000140557 UTR3 Human protein_coding chr15:93007974 chr15:93007974 . . 0 21 hPsi_associated_SNPs_247887 0 29170203 Fractures (vertebral) 3e-07 GWAS_Catalog TagSNP rs2290492 GCST005097 Identification of a novel locus on chromosome 2q13, which predisposes to clinical vertebral fractures independently of bone density.
522 chr15 93448222 93448222 1 + G A rs7179364 93448222 - 93448202 93448242 41 TGACCTGAGTTTTTCTCCATCAAATGCCAACTGAGAAAATG TGACCTGAGTTTTTCTCCATTAAATGCCAACTGAGAAAATG Direct Gain 0 0.884625732898712 Functional Gain 0.884625732898712 CHD2 ENSG00000173575 CDS Human protein_coding chr15:93448222 chr15:93448222 nonsynonymous SNV 0.938 0 21 hPsi_associated_SNPs_247904 0 30595370 Mean corpuscular hemoglobin 9e-08 GWAS_Catalog TagSNP rs7179364 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
523 chr16 1250559 1250559 1 + T A rs8044363 1250559 - 1250539 1250579 41 CCGCCCACCTGGAAGATGGCAATCCAGGCGTAGCCGATGTT CCGCCCACCTGGAAGATGGCTATCCAGGCGTAGCCGATGTT Direct Gain 0 0.92028820514679 Functional Gain 0.92028820514679 CACNA1H ENSG00000196557 CDS Human protein_coding chr16:1250559 chr16:1250559 synonymous SNV . 0 21 hPsi_associated_SNPs_248280 0 30038396 Self-reported math ability 8e-10 GWAS_Catalog TagSNP rs8044363 GCST006573 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
524 chr16 1291597 1291597 1 + C A rs144979264 1291597 - 1291577 1291617 41 GTGTGGACGTGGCTGGAGACGTTCACCGGCTCCTCCAGCTC GTGTGGACGTGGCTGGAGACTTTCACCGGCTCCTCCAGCTC Direct Gain 0 0.999965071678162 Functional Gain 0.999965071678162 TPSAB1 ENSG00000172236 CDS Human protein_coding chr16:1291597 chr16:1291597 nonsynonymous SNV 0.004 1 21 hPsi_associated_SNPs_248300 0 29875488 Blood protein levels 0 GWAS_Catalog TagSNP rs144979264 GCST005806 Genomic atlas of the human plasma proteome.
525 chr16 1838836 1838836 1 + C A rs1065656 1838836 - 1838816 1838856 41 TGGTCGGGGAGAAGCTCTCCGGCTGACGCTGCCTGGGCCTG TGGTCGGGGAGAAGCTCTCCTGCTGACGCTGCCTGGGCCTG Direct Gain 0 0.927844762802124 Functional Gain 0.927844762802124 NUBP2 ENSG00000095906 UTR3 Human protein_coding chr16:1838836 chr16:1838836 . . 0 21 hPsi_associated_SNPs_248385 0 21216879 Insulin-like growth factors 1e-11 GWAS_Catalog TagSNP rs1065656 GCST000937 A genome-wide association study identifies novel loci associated with circulating IGF-I and IGFBP-3.
526 chr16 2512523 2512523 1 + G A rs3810794 2512523 - 2512503 2512543 41 CCCAGGACCCACTGACCTGCCGAGAGCTCCTCCCTCATGCG CCCAGGACCCACTGACCTGCTGAGAGCTCCTCCCTCATGCG Direct Gain 0 0.801524877548218 Functional Gain 0.801524877548218 C16orf59 ENSG00000162062 CDS Human protein_coding chr16:2512523 chr16:2512523 synonymous SNV . 0 21 hPsi_associated_SNPs_248477 0 28552196 Height 1e-06 GWAS_Catalog TagSNP rs3810794 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
527 chr16 13002359 13002359 1 + T A rs9938751 13002359 - 13002339 13002379 41 GGAAAGAAATCTGTGCCTCCATAAACAGCAGATTGTCATAG GGAAAGAAATCTGTGCCTCCTTAAACAGCAGATTGTCATAG Direct Gain 0 0.776102542877197 Functional Gain 0.776102542877197 SHISA9 ENSG00000237515 CDS Human protein_coding chr16:13002359 chr16:13002359 nonsynonymous SNV 0.002 1 21 hPsi_associated_SNPs_248894 0 28076899 Sjögren's syndrome 1e-06 GWAS_Catalog TagSNP rs9938751 GCST004061 Genome-Wide Association Analysis Reveals Genetic Heterogeneity of Sjögren's Syndrome According to Ancestry.
528 chr16 15130351 15130351 1 + G A rs1741 15130351 - 15130331 15130371 41 ATGGTAACTTAGGGAAAAGTCGTAGTAGGACAGCAAACGTG ATGGTAACTTAGGGAAAAGTTGTAGTAGGACAGCAAACGTG Direct Gain 0 0.948709845542908 Functional Gain 0.948709845542908 PDXDC1 ENSG00000179889 UTR3 Human protein_coding chr16:15130351 chr16:15130351 . . 0 21 hPsi_associated_SNPs_248940 0 24823311 Plasma omega-6 polyunsaturated fatty acid levels (arachidonic acid) 2e-10 GWAS_Catalog TagSNP rs1741 GCST002449 Genome-wide association study of plasma N6 polyunsaturated fatty acids within the cohorts for heart and aging research in genomic epidemiology consortium.
529 chr16 24788645 24788645 1 + T A rs11639856 24788645 - 24788625 24788665 41 CTGTTCTGCACCTCTCCGTTATTTTGTGGCTGTTGATTTGT CTGTTCTGCACCTCTCCGTTTTTTTGTGGCTGTTGATTTGT Direct Gain 0 0.50395268201828 Functional Gain 0.50395268201828 TNRC6A ENSG00000090905 CDS Human protein_coding chr16:24788645 chr16:24788645 nonsynonymous SNV 1.000 0 21 hPsi_associated_SNPs_249156 0 27618448 Systolic blood pressure 1e-08 GWAS_Catalog TagSNP rs11639856 GCST006228 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
530 chr16 28915527 28915527 1 + G A rs10499 28915527 - 28915507 28915547 41 GAGGACAGAGCAAAAGGATGCTCACTTCCTTCTTTCATCTT GAGGACAGAGCAAAAGGATGTTCACTTCCTTCTTTCATCTT Direct Gain 0 0.743228495121002 Functional Gain 0.743228495121002 ATP2A1 ENSG00000196296 UTR3 Human protein_coding chr16:28915527 chr16:28915527 . . 0 21 hPsi_associated_SNPs_249248 2 30150663 Cannabis use 1e-09 GWAS_Catalog TagSNP rs10499 GCST006421 GWAS of lifetime cannabis use reveals new risk loci, genetic overlap with psychiatric traits, and a causal influence of schizophrenia.
531 chr16 31121793 31121793 1 + G A rs14235 31121793 - 31121773 31121813 41 TCATGCAGCGCCAGGTGATGCGTGGCCAACATGCGGATTCC TCATGCAGCGCCAGGTGATGTGTGGCCAACATGCGGATTCC Direct Gain 0 0.905270934104919 Functional Gain 0.905270934104919 BCKDK ENSG00000103507 CDS Human protein_coding chr16:31121793 chr16:31121793 synonymous SNV . 0 21 hPsi_associated_SNPs_249412 1 28892059 Parkinson's disease 5e-12 GWAS_Catalog TagSNP rs14235 GCST004902 A meta-analysis of genome-wide association studies identifies 17 new Parkinson's disease risk loci.
532 chr16 47735030 47735030 1 + G A rs7202866 47735030 - 47735010 47735050 41 CTCCATGGACTTCATGCTTACGTTTTTTTCAGGCATTAGTT CTCCATGGACTTCATGCTTATGTTTTTTTCAGGCATTAGTT Direct Gain 0 0.995082020759583 Functional Gain 0.995082020759583 PHKB ENSG00000102893 UTR3 Human protein_coding chr16:47735030 chr16:47735030 . . 0 21 hPsi_associated_SNPs_249497 1 17554300 Multiple complex diseases 0.000835566 Johnson and O'Donnell TagSNP rs7202866 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
533 chr16 50106594 50106594 1 + T A rs2287197 50106594 - 50106574 50106614 41 GCCAGGTCAACATTGGTAGGAAACCTACTTAAATACTTTAA GCCAGGTCAACATTGGTAGGTAACCTACTTAAATACTTTAA Direct Gain 0 0.989808201789856 Functional Gain 0.989808201789856 HEATR3 ENSG00000155393 CDS Human protein_coding chr16:50106594 chr16:50106594 nonsynonymous SNV 0.994 2 21 hPsi_associated_SNPs_249512 0 30595370 Red cell distribution width 2e-30 GWAS_Catalog TagSNP rs2287197 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
534 chr16 50350210 50350210 1 + G A rs1872691 50350210 - 50350190 50350230 41 GGCAAGGCTCTGCTGCTCCCCGCCTTCTTGCTGTGACCACA GGCAAGGCTCTGCTGCTCCCTGCCTTCTTGCTGTGACCACA Direct Gain 0 0.909841179847717 Functional Gain 0.909841179847717 ADCY7 ENSG00000121281;ENSG00000166164 UTR3 Human other chr16:50350210 chr16:50350210 . . 0 21 hPsi_associated_SNPs_249527 0 31015401 Medication use (thyroid preparations) 5e-10 GWAS_Catalog TagSNP rs1872691 GCST007932 Genome-wide association study of medication-use and associated disease in the UK Biobank.
535 chr16 50744624 50744624 1 + C A rs2066842 50744624 - 50744604 50744644 41 GGCTGGGCTCTTCTGCGGGGGTCCAGCCATGCCCACATCTG GGCTGGGCTCTTCTGCGGGGTTCCAGCCATGCCCACATCTG Direct Gain 0 0.543751120567322 Functional Gain 0.543751120567322 NOD2 ENSG00000167207 CDS Human protein_coding chr16:50744624 chr16:50744624 nonsynonymous SNV 0.000 0 21 hPsi_associated_SNPs_249537 0 17804789 Crohn's disease 3.49e-07 Johnson and O'Donnell TagSNP rs2066842 . Genome-wide association study for Crohn's disease in the Quebec Founder Population identifies multiple validated disease loci.
536 chr16 50757276 50757276 1 + G A rs5743291 50757276 - 50757256 50757296 41 CCAGAGTTCTTCTAGCATGACGTTCTTTGCCAGCATCAGTG CCAGAGTTCTTCTAGCATGATGTTCTTTGCCAGCATCAGTG Direct Gain 0 0.537872076034546 Functional Gain 0.537872076034546 NOD2 ENSG00000167207 CDS Human protein_coding chr16:50757276 chr16:50757276 nonsynonymous SNV 0.005 1 21 hPsi_associated_SNPs_249541 3 17804789 Crohn's disease 1e-20 Johnson and O'Donnell TagSNP rs5743291 . Genome-wide association study for Crohn's disease in the Quebec Founder Population identifies multiple validated disease loci.
537 chr16 56969148 56969148 1 + G A rs2217332 56969148 - 56969128 56969168 41 TTAACCTCTGGTCCTCTGGACGCTGATCATGGAAAGAAAGA TTAACCTCTGGTCCTCTGGATGCTGATCATGGAAAGAAAGA Direct Gain 0 0.989262223243713 Functional Gain 0.989262223243713 HERPUD1 ENSG00000051108 CDS Human protein_coding chr16:56969148 chr16:56969148 nonsynonymous SNV 0.570 0 21 hPsi_associated_SNPs_249638 0 20694148 Metabolic syndrome 3e-06 GWAS_Catalog TagSNP rs2217332 GCST000753 A genome-wide association study of the metabolic syndrome in Indian Asian men.
538 chr16 56995908 56995908 1 + T A rs34119551 56995908 - 56995888 56995928 41 CCAGCAGGGCCAGGGTCAGGACTGTGGCAGCCAGCATGGTT CCAGCAGGGCCAGGGTCAGGTCTGTGGCAGCCAGCATGGTT Direct Gain 0 0.968173027038574 Functional Gain 0.968173027038574 CETP ENSG00000087237 CDS Human protein_coding chr16:56995908 chr16:56995908 nonsynonymous SNV 0.140 1 21 hPsi_associated_SNPs_249642 0 24507774 HDL cholesterol 2e-19 GWAS_Catalog TagSNP rs34119551 GCST007850 Association of low-frequency and rare coding-sequence variants with blood lipids and coronary heart disease in 56,000 whites and blacks.
539 chr16 57016092 57016092 1 + G A rs5882 57016092 - 57016072 57016112 41 TGACTGCAGGAAGCTCTGGACGGACTCGGAGCTGCTCTGCC TGACTGCAGGAAGCTCTGGATGGACTCGGAGCTGCTCTGCC Direct Gain 0 0.981952309608459 Functional Gain 0.981952309608459 CETP ENSG00000087237 CDS Human protein_coding chr16:57016092 chr16:57016092 nonsynonymous SNV 0.000 0 21 hPsi_associated_SNPs_249644 2 18193046 HDL cholesterol 7.8e-09 Johnson and O'Donnell TagSNP rs5882 . Genome-wide scan identifies variation in MLXIPL associated with plasma triglycerides.
540 chr16 57017319 57017319 1 + G A rs1800777 57017319 - 57017299 57017339 41 GGGGCTTTGTACTCACATCTCGAGTGATAATCTCAGGGTTG GGGGCTTTGTACTCACATCTTGAGTGATAATCTCAGGGTTG Direct Gain 0 0.9878910779953 Functional Gain 0.9878910779953 CETP ENSG00000087237 CDS Human protein_coding chr16:57017319 chr16:57017319 nonsynonymous SNV 0.047 0 21 hPsi_associated_SNPs_249646 1 18193046 HDL cholesterol 2.8e-18 Johnson and O'Donnell TagSNP rs1800777 . Genome-wide scan identifies variation in MLXIPL associated with plasma triglycerides.
541 chr16 66638245 66638245 1 + G A rs35320143 66638245 - 66638225 66638265 41 TGTCGGCTCCGCAACCCATGCCCTCTCTTTTTCTTGGGGGC TGTCGGCTCCGCAACCCATGTCCTCTCTTTTTCTTGGGGGC Direct Gain 0 0.804233551025391 Functional Gain 0.804233551025391 CMTM3 ENSG00000140931 UTR5 Human protein_coding chr16:66638245 chr16:66638245 . . 0 21 hPsi_associated_SNPs_249785 0 25742292 Number of children (6+ vs. 0 or 1) 9e-06 GWAS_Catalog TagSNP rs35320143 GCST002800 Genome-wide association study of parity in Bangladeshi women.
542 chr16 72130815 72130815 1 + C A rs1050362 72130815 - 72130795 72130835 41 GGCATAGACACCATGTTCCCGCCGCTCCCGCTCTCTCTGCC GGCATAGACACCATGTTCCCTCCGCTCCCGCTCTCTCTGCC Direct Gain 0 0.995365560054779 Functional Gain 0.995365560054779 DHX38 ENSG00000140829 CDS Human protein_coding chr16:72130815 chr16:72130815 synonymous SNV . 0 21 hPsi_associated_SNPs_250050 0 29212778 Coronary artery disease 3e-11 GWAS_Catalog TagSNP rs1050362 GCST005196 Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease.
543 chr16 84900645 84900645 1 + G A rs149615348 84900645 - 84900625 84900665 41 GAGGACGGCCTAGACTCACTCATGTAGTTGACCGCAGAGGT GAGGACGGCCTAGACTCACTTATGTAGTTGACCGCAGAGGT Direct Gain 0 0.999971210956573 Functional Gain 0.999971210956573 CRISPLD2 ENSG00000103196 CDS Human protein_coding chr16:84900645 chr16:84900645 nonsynonymous SNV 0.980 3 21 hPsi_associated_SNPs_250268 0 29875488 Blood protein levels 3e-17 GWAS_Catalog TagSNP rs149615348 GCST005806 Genomic atlas of the human plasma proteome.
544 chr16 89985918 89985918 1 + C A rs1805006 89985918 - 89985898 89985938 41 TTGCTCCCGCTCACCAGCAGGTCCGACAAGGCCAGGCAGCA TTGCTCCCGCTCACCAGCAGTTCCGACAAGGCCAGGCAGCA Direct Gain 0 0.98612254858017 Functional Gain 0.98612254858017 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89985918 chr16:89985918 nonsynonymous SNV 0.816 4 21 hPsi_associated_SNPs_250621 3 30531825 Red vs. brown/black hair color 2e-308 GWAS_Catalog TagSNP rs1805006 GCST006986 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
545 chr16 89985940 89985940 1 + G A rs2228479 89985940 - 89985920 89985960 41 GATGACGGCCGTCTCCAGCACGTTGCTCCCGCTCACCAGCA GATGACGGCCGTCTCCAGCATGTTGCTCCCGCTCACCAGCA Direct Gain 0 0.513153910636902 Functional Gain 0.513153910636902 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89985940 chr16:89985940 nonsynonymous SNV 0.138 0 21 hPsi_associated_SNPs_250622 4 17999355 Skin pigmentation 0.00068 Johnson and O'Donnell TagSNP rs2228479 . A genomewide association study of skin pigmentation in a South Asian population.
546 chr16 89986154 89986154 1 + G A rs885479 89986154 - 89986134 89986174 41 CCCAGATGGCCGCAACGGCTCGCCGCGCCCGCGGCAGGGTC CCCAGATGGCCGCAACGGCTTGCCGCGCCCGCGGCAGGGTC Direct Gain 0 0.8446946144104 Functional Gain 0.8446946144104 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89986154 chr16:89986154 nonsynonymous SNV 0.001 0 21 hPsi_associated_SNPs_250623 2 30531825 Blond vs. brown/black hair color 4e-08 GWAS_Catalog TagSNP rs885479 GCST006988 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
547 chr16 89998794 89998794 1 + G A rs2302898 89998794 - 89998774 89998814 41 AAATTGCCATAATAAATATGCACCTCCACACCTACACGTCC AAATTGCCATAATAAATATGTACCTCCACACCTACACGTCC Direct Gain 0 0.999976277351379 Functional Gain 0.999976277351379 TUBB3 ENSG00000258947 UTR5 Human protein_coding chr16:89998794 chr16:89998794 . . 0 21 hPsi_associated_SNPs_250629 0 30531825 Red vs. brown/black hair color 3e-103 GWAS_Catalog TagSNP rs2302898 GCST006986 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
548 chr17 2883588 2883588 1 + C A rs17762452 2883588 - 2883568 2883608 41 CCGCTCATGTACCGTCTTCAGTTTGGACCTGCACAAGACGG CCGCTCATGTACCGTCTTCATTTTGGACCTGCACAAGACGG Direct Gain 0 0.709229826927185 Functional Gain 0.709229826927185 RAP1GAP2 ENSG00000132359 CDS Human protein_coding chr17:2883588 chr17:2883588 nonsynonymous SNV 0.998 1 21 hPsi_associated_SNPs_250812 0 27863252 Lymphocyte counts 8e-14 GWAS_Catalog TagSNP rs17762452 GCST004627 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
549 chr17 3214106 3214106 1 + C A rs9911226 3214106 - 3214086 3214126 41 GGGGCCACAGAAGTTAAGAGGAGACAGGGCAACAGTTTGGG GGGGCCACAGAAGTTAAGAGTAGACAGGGCAACAGTTTGGG Direct Gain 0 0.972959399223328 Functional Gain 0.972959399223328 OR3A4P ENSG00000180068 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr17:3214106 chr17:3214106 . . 0 21 hPsi_associated_SNPs_250836 0 17554300 Multiple complex diseases 0.000959449 Johnson and O'Donnell TagSNP rs9911226 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
550 chr17 4441309 4441309 1 + C A rs10521140 4441309 - 4441289 4441329 41 GCGCCCAGCTTCATTTGCCAGGTTGCGTCCAATATCCCCAA GCGCCCAGCTTCATTTGCCATGTTGCGTCCAATATCCCCAA Direct Gain 0 0.993776381015778 Functional Gain 0.993776381015778 SPNS2 ENSG00000183018 UTR3 Human protein_coding chr17:4441309 chr17:4441309 . . 0 21 hPsi_associated_SNPs_250864 0 17641165 HIV-1 disease progression 0.0006096 Johnson and O'Donnell TagSNP rs10521140 . A whole-genome association study of major determinants for host control of HIV-1.
551 chr17 5323228 5323228 1 + C A rs1806269 5323228 - 5323208 5323248 41 CAGGCTCTCCCCAGGTGCTAGATTTCCAGCAGCACCACCAT CAGGCTCTCCCCAGGTGCTATATTTCCAGCAGCACCACCAT Direct Gain 0 0.997510433197021 Functional Gain 0.997510433197021 RPAIN ENSG00000108559;ENSG00000129197 UTR5 Human other chr17:5323228 chr17:5323228 . . 0 21 hPsi_associated_SNPs_250942 0 17463246 Multiple continuous traits in DGI samples 0.0006369 Johnson and O'Donnell TagSNP rs1806269 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
552 chr17 7185062 7185062 1 + C A rs5417 7185062 - 7185042 7185082 41 AGTGGGGCTCCCGCGGATCTGGTGGAGCGGGGCTGGGGGAA AGTGGGGCTCCCGCGGATCTTGTGGAGCGGGGCTGGGGGAA Direct Gain 0 0.613599717617035 Functional Gain 0.613599717617035 SLC2A4 ENSG00000181856 UTR5 Human protein_coding chr17:7185062 chr17:7185062 . . 0 21 hPsi_associated_SNPs_251014 0 28135244 Diastolic blood pressure 1e-13 GWAS_Catalog TagSNP rs5417 GCST004280 Genome-wide association analysis identifies novel blood pressure loci and offers biological insights into cardiovascular risk.
553 chr17 7462555 7462555 1 + G A rs11552708 7462555 - 7462535 7462575 41 CTGGGAGGGGCCTCCTGTCCCCTGCAGCCGGCTCACCTCTC CTGGGAGGGGCCTCCTGTCCTCTGCAGCCGGCTCACCTCTC Direct Gain 0 0.722619891166687 Functional Gain 0.722619891166687 TNFSF13 ENSG00000161955 CDS Human protein_coding chr17:7462555 chr17:7462555 nonsynonymous SNV 0.980 0 21 hPsi_associated_SNPs_251062 0 23118916 IgM levels 4e-09 GWAS_Catalog TagSNP rs11552708 GCST001724 Genome-wide scan identifies variant in TNFSF13 associated with serum IgM in a healthy Chinese male population.
554 chr17 7534678 7534678 1 + C A rs6258 7534678 - 7534658 7534698 41 ACCCCTGGGGTGTAGTTACCGGCAACCGAAGGTTGGAAGCG ACCCCTGGGGTGTAGTTACCTGCAACCGAAGGTTGGAAGCG Direct Gain 0 0.962187886238098 Functional Gain 0.962187886238098 SHBG ENSG00000129214 CDS Human protein_coding chr17:7534678 chr17:7534678 nonsynonymous SNV 0.984 3 21 hPsi_associated_SNPs_251075 0 21998597 Testosterone levels 2e-22 GWAS_Catalog TagSNP rs6258 GCST001264 Genetic determinants of serum testosterone concentrations in men.
555 chr17 7606722 7606722 1 + C A rs7640 7606722 - 7606702 7606742 41 CAGGGATGCTGGAGTCTGGCGCCCCCCCACACCACCAGAGC CAGGGATGCTGGAGTCTGGCTCCCCCCCACACCACCAGAGC Direct Gain 0 0.858519554138184 Functional Gain 0.858519554138184 WRAP53 ENSG00000141499 CDS Human protein_coding chr17:7606722 chr17:7606722 nonsynonymous SNV 0.009 1 21 hPsi_associated_SNPs_251085 0 28093568 Cognitive function 7e-07 GWAS_Catalog TagSNP rs7640 GCST004077 GWAS meta-analysis reveals novel loci and genetic correlates for general cognitive function: a report from the COGENT consortium.
556 chr17 7758522 7758522 1 + C A rs2270518 7758522 - 7758502 7758542 41 TAGCACCAGCACCAGCAGGAGAAGATTGAAGGCAGCCACCA TAGCACCAGCACCAGCAGGATAAGATTGAAGGCAGCCACCA Direct Gain 0 0.993200719356537 Functional Gain 0.993200719356537 TMEM88 ENSG00000167874 CDS Human protein_coding chr17:7758522 chr17:7758522 nonsynonymous SNV 0.992 0 21 hPsi_associated_SNPs_251115 0 25429064 Height 8e-10 GWAS_Catalog TagSNP rs2270518 GCST002702 Meta-analysis of genome-wide association studies of adult height in East Asians identifies 17 novel loci.
557 chr17 13928401 13928401 1 + G A rs2286351 13928401 - 13928381 13928421 41 TTCAGTTCCAGGGTTAGGGCCAGTGGCTACAGTACGTGCCG TTCAGTTCCAGGGTTAGGGCTAGTGGCTACAGTACGTGCCG Direct Gain 0 0.949615716934204 Functional Gain 0.949615716934204 CDRT15P1 ENSG00000141028;ENSG00000236088 ncRNA_intronic Human other chr17:13928401 chr17:13928401 . . 0 21 hPsi_associated_SNPs_251253 0 29394082 Chronic obstructive pulmonary disease 2e-08 GWAS_Catalog TagSNP rs2286351 GCST005417 A Genome-wide Association Study in Hispanics/Latinos Identifies Novel Signals for Lung Function. The Hispanic Community Health Study/Study of Latinos.
558 chr17 17068182 17068182 1 + G A rs61744862 17068182 - 17068162 17068202 41 GTGCTCTGCGAGCCTGCGCACGCTGGCCTCTCGTGCCTCCA GTGCTCTGCGAGCCTGCGCATGCTGGCCTCTCGTGCCTCCA Direct Gain 0 0.95620059967041 Functional Gain 0.95620059967041 MPRIP ENSG00000133030 CDS Human protein_coding chr17:17068182 chr17:17068182 unknown . 0 21 hPsi_associated_SNPs_251330 0 23251661 Obesity-related traits 7e-08 GWAS_Catalog TagSNP rs61744862 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
559 chr17 17326363 17326363 1 + G A rs35590625 17326363 - 17326343 17326383 41 ACTCTTTATCCTTCGAAGAACACTCAAAGCTCGATTATTTT ACTCTTTATCCTTCGAAGAATACTCAAAGCTCGATTATTTT Direct Gain 0 0.577879130840302 Functional Gain 0.577879130840302 NT5M;MED9 ENSG00000227158 ncRNA_exonic Human processed_pseudogene chr17:17326363 chr17:17326363 . . 0 21 hPsi_associated_SNPs_251348 0 17554300 Multiple complex diseases 5.61e-16 Johnson and O'Donnell TagSNP rs35590625 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
560 chr17 29161845 29161845 1 + G A rs17826219 29161845 - 29161825 29161865 41 CTGCTTCAGTTACGTTATCTCTAGAGTTTGCATGGCTTGTA CTGCTTCAGTTACGTTATCTTTAGAGTTTGCATGGCTTGTA Direct Gain 0 0.981667518615723 Functional Gain 0.981667518615723 ATAD5 ENSG00000176208 CDS Human protein_coding chr17:29161845 chr17:29161845 nonsynonymous SNV 0.010 0 21 hPsi_associated_SNPs_251678 0 28892062 Body mass index 3e-08 GWAS_Catalog TagSNP rs17826219 GCST004904 Genome-wide association study identifies 112 new loci for body mass index in the Japanese population.
561 chr17 34314007 34314007 1 + G A rs854683 34314007 - 34313987 34314027 41 AGATCTTTTGCTAAGTGTGACACAGTGCCCCCAGCCCTGTG AGATCTTTTGCTAAGTGTGATACAGTGCCCCCAGCCCTGTG Direct Gain 0 0.602504372596741 Functional Gain 0.602504372596741 CCL15-CCL14 ENSG00000213494;ENSG00000266956 UTR5;UTR3 Human other chr17:34314007 chr17:34314007 . . 0 21 hPsi_associated_SNPs_251769 0 16252231 Parkinson's disease 0.00079873 Johnson and O'Donnell TagSNP rs854683 . High-resolution whole-genome association study of Parkinson disease.
562 chr17 42827673 42827673 1 + G A rs3744477 42827673 - 42827653 42827693 41 GAGACAACTCTTTAAATGCACGGACGCAGAGAAGGGTGAGA GAGACAACTCTTTAAATGCATGGACGCAGAGAAGGGTGAGA Direct Gain 0 0.931172370910645 Functional Gain 0.931172370910645 DBF4B ENSG00000161692 intronic Human protein_coding chr17:42827673 chr17:42827673 . . 0 21 hPsi_associated_SNPs_252118 0 17671248 Sporadic Amyotrophic Lateral Sclerosis (ALS) 0.03 Johnson and O'Donnell TagSNP rs3744477 . Whole-genome analysis of sporadic amyotrophic lateral sclerosis.
563 chr17 43714850 43714850 1 + G A rs2942168 43714850 - 43714830 43714870 41 GGGGCTCTGGGAAAGAGCTTCGGCCTCACACTGGGTCACCT GGGGCTCTGGGAAAGAGCTTTGGCCTCACACTGGGTCACCT Direct Gain 0 0.99649441242218 Functional Gain 0.99649441242218 LINC02210 ENSG00000204650 ncRNA_exonic Human transcribed_unitary_pseudogene chr17:43714850 chr17:43714850 . . 0 21 hPsi_associated_SNPs_252156 0 21292315 Parkinson's disease 1e-28 GWAS_Catalog TagSNP rs2942168 GCST000959 Imputation of sequence variants for identification of genetic risks for Parkinson's disease: a meta-analysis of genome-wide association studies.
564 chr17 45017193 45017193 1 + G A rs11874 45017193 - 45017173 45017213 41 GGCCTTTATACTAAATTCCACAATATACCTGGTATTAGTAC GGCCTTTATACTAAATTCCATAATATACCTGGTATTAGTAC Direct Gain 0 0.612229585647583 Functional Gain 0.612229585647583 GOSR2 ENSG00000108433 UTR3 Human protein_coding chr17:45017193 chr17:45017193 . . 0 21 hPsi_associated_SNPs_252203 1 31015401 Medication use (agents acting on the renin-angiotensin system) 2e-13 GWAS_Catalog TagSNP rs11874 GCST007930 Genome-wide association study of medication-use and associated disease in the UK Biobank.
565 chr17 48944345 48944345 1 + C A rs12949115 48944345 - 48944325 48944365 41 CGGTTGGCCTAGGCCTTGGGGTGATTAATATTCAATTAATC CGGTTGGCCTAGGCCTTGGGTTGATTAATATTCAATTAATC Direct Gain 0 0.670157074928284 Functional Gain 0.670157074928284 TOB1-AS1 ENSG00000229980 ncRNA_exonic Human processed_transcript chr17:48944345 chr17:48944345 . . 0 21 hPsi_associated_SNPs_252376 0 30595370 Height 1e-10 GWAS_Catalog TagSNP rs12949115 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
566 chr17 58824617 58824617 1 + G A rs34431714 58824617 - 58824597 58824637 41 ACTGTGGAGCAGGCAAGATTCTAGCCGCTCGAATTGGGCCA ACTGTGGAGCAGGCAAGATTTTAGCCGCTCGAATTGGGCCA Direct Gain 0 0.659885108470917 Functional Gain 0.659885108470917 BCAS3 ENSG00000141376 CDS Human protein_coding chr17:58824617 chr17:58824617 nonsynonymous SNV 0.998 3 21 hPsi_associated_SNPs_252528 0 27989323 Interleukin-2 levels 6e-06 GWAS_Catalog TagSNP rs34431714 GCST004455 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
567 chr17 66391276 66391276 1 + G A rs9972951 66391276 - 66391256 66391296 41 AGACGTCCACACCATCAAAGCGCCGTCCTTGAGGTAAGCTG AGACGTCCACACCATCAAAGTGCCGTCCTTGAGGTAAGCTG Direct Gain 0 0.699738144874573 Functional Gain 0.699738144874573 ARSG ENSG00000141337 CDS Human protein_coding chr17:66391276 chr17:66391276 nonsynonymous SNV 0.047 1 21 hPsi_associated_SNPs_252700 0 17554300 Multiple complex diseases 0.000410736 Johnson and O'Donnell TagSNP rs9972951 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
568 chr17 72469966 72469966 1 + G A rs2272111 72469966 - 72469946 72469986 41 CAACGGGATCATGAAAGTCTCGGAGCCATGGTGTATCCACC CAACGGGATCATGAAAGTCTTGGAGCCATGGTGTATCCACC Direct Gain 0 0.91932874917984 Functional Gain 0.91932874917984 CD300A ENSG00000167851 CDS Human protein_coding chr17:72469966 chr17:72469966 nonsynonymous SNV 0.000 0 21 hPsi_associated_SNPs_252800 0 30072576 Blood protein levels 1e-52 GWAS_Catalog TagSNP rs2272111 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
569 chr17 74381555 74381555 1 + G A rs2247856 74381555 - 74381535 74381575 41 CGTGGCTGCAGGAGCACCGGCGTCATTCCCTGCGGCGGCTG CGTGGCTGCAGGAGCACCGGTGTCATTCCCTGCGGCGGCTG Direct Gain 0 0.999824345111847 Functional Gain 0.999824345111847 SPHK1 ENSG00000176170 CDS Human protein_coding chr17:74381555 chr17:74381555 nonsynonymous SNV 0.294 1 21 hPsi_associated_SNPs_252956 0 27863252 Reticulocyte fraction of red cells 2e-27 GWAS_Catalog TagSNP rs2247856 GCST004619 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
570 chr17 77709339 77709339 1 + C A rs11657217 77709339 - 77709319 77709359 41 TTGGGGTGGGCGTCCTTGAGGGCATCGTACACCTTCTCCAG TTGGGGTGGGCGTCCTTGAGTGCATCGTACACCTTCTCCAG Direct Gain 0 0.999851703643799 Functional Gain 0.999851703643799 ENPP7 ENSG00000182156 CDS Human protein_coding chr17:77709339 chr17:77709339 synonymous SNV . 0 21 hPsi_associated_SNPs_253121 0 27802415 Diastolic blood pressure response to hydrochlorothiazide in hypertension 5e-06 GWAS_Catalog TagSNP rs11657217 GCST003805 Genome-Wide and Gene-Based Meta-Analyses Identify Novel Loci Influencing Blood Pressure Response to Hydrochlorothiazide.
571 chr17 79205421 79205421 1 + G A rs61745945 79205421 - 79205401 79205441 41 GGACTGTGACTCGGGGACCACGCGCCTTCCTGAGCCGCGAG GGACTGTGACTCGGGGACCATGCGCCTTCCTGAGCCGCGAG Direct Gain 0 0.94611930847168 Functional Gain 0.94611930847168 TEPSIN ENSG00000167302 CDS Human protein_coding chr17:79205421 chr17:79205421 nonsynonymous SNV 0.001 0 21 hPsi_associated_SNPs_253283 0 29875488 Blood protein levels 6e-19 GWAS_Catalog TagSNP rs61745945 GCST005806 Genomic atlas of the human plasma proteome.
572 chr18 13826678 13826678 1 + C A rs143262370 13826678 - 13826658 13826698 41 AGCAAATAATCTCCTTAAAGGTCTTCCGCATCTCTTGGCTG AGCAAATAATCTCCTTAAAGTTCTTCCGCATCTCTTGGCTG Direct Gain 0 0.841296911239624 Functional Gain 0.841296911239624 MC5R ENSG00000176136 CDS Human protein_coding chr18:13826678 chr18:13826678 nonsynonymous SNV 0.179 3 21 hPsi_associated_SNPs_253623 0 27618447 Systolic blood pressure 9e-06 GWAS_Catalog TagSNP rs143262370 GCST006021 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
573 chr18 21057210 21057210 1 + G A rs33969048 21057210 - 21057190 21057230 41 GCGAGACATTCCTGCAGTCCCGGAACAAGAACTCCAGGCCG GCGAGACATTCCTGCAGTCCTGGAACAAGAACTCCAGGCCG Direct Gain 0 0.564952552318573 Functional Gain 0.564952552318573 RIOK3 ENSG00000101782 CDS Human protein_coding chr18:21057210 chr18:21057210 nonsynonymous SNV 1.000 4 21 hPsi_associated_SNPs_253679 0 27863252 Immature fraction of reticulocytes 2e-10 GWAS_Catalog TagSNP rs33969048 GCST004628 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
574 chr18 33290114 33290114 1 + G A rs17562324 33290114 - 33290094 33290134 41 AAAAATCTTGGAAATCTCTTCATTATGACAGCACGTTCAGC AAAAATCTTGGAAATCTCTTTATTATGACAGCACGTTCAGC Direct Gain 0 0.987571775913239 Functional Gain 0.987571775913239 GALNT1 ENSG00000141429 UTR3 Human protein_coding chr18:33290114 chr18:33290114 . . 0 21 hPsi_associated_SNPs_253786 0 17554300 Multiple complex diseases 9.11171e-05 Johnson and O'Donnell TagSNP rs17562324 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
575 chr18 61570470 61570470 1 + T A rs6102 61570470 - 61570450 61570490 41 TGCATAATAAGAAAAAGAAAAGGATGATCTGCCACAAACTG TGCATAATAAGAAAAAGAAATGGATGATCTGCCACAAACTG Direct Gain 0 0.884267449378967 Functional Gain 0.884267449378967 SERPINB2 ENSG00000197632 CDS Human protein_coding chr18:61570470 chr18:61570470 synonymous SNV . 0 21 hPsi_associated_SNPs_254102 0 18178869 Minor histocompatibility antigenicity 0.001 Johnson and O'Donnell TagSNP rs6102 . Identification of human minor histocompatibility antigens based on genetic association with highly parallel genotyping of pooled DNA.
576 chr19 1049305 1049305 1 + C A rs4147915 1049305 - 1049285 1049325 41 TTCTCCAGGCTGCGAACGGAGACGCCAGGACTCAGGCCGGG TTCTCCAGGCTGCGAACGGATACGCCAGGACTCAGGCCGGG Direct Gain 0 0.999997735023499 Functional Gain 0.999997735023499 ABCA7 ENSG00000064687 CDS Human protein_coding chr19:1049305 chr19:1049305 synonymous SNV . 0 21 hPsi_associated_SNPs_254349 0 27863252 Myeloid white cell count 2e-11 GWAS_Catalog TagSNP rs4147915 GCST004626 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
577 chr19 5823903 5823903 1 + G A rs3763046 5823903 - 5823883 5823923 41 AAGGTCCAGACTTGAATAAACGTAGGAGTTGGCCAGGCAGA AAGGTCCAGACTTGAATAAATGTAGGAGTTGGCCAGGCAGA Direct Gain 0 0.956613898277283 Functional Gain 0.956613898277283 NRTN ENSG00000171119 UTR5 Human protein_coding chr19:5823903 chr19:5823903 . . 0 21 hPsi_associated_SNPs_254765 0 18178869 Minor histocompatibility antigenicity 0.01 Johnson and O'Donnell TagSNP rs3763046 . Identification of human minor histocompatibility antigens based on genetic association with highly parallel genotyping of pooled DNA.
578 chr19 7536221 7536221 1 + G A rs7245775 7536221 - 7536201 7536241 41 CACCCCTCCAGGGAACGGACCGTAAGCTGCAACAGCTCACT CACCCCTCCAGGGAACGGACTGTAAGCTGCAACAGCTCACT Direct Gain 0 0.999972522258759 Functional Gain 0.999972522258759 ARHGEF18 ENSG00000104880 UTR3 Human protein_coding chr19:7536221 chr19:7536221 . . 0 21 hPsi_associated_SNPs_254836 0 17554300 Multiple complex diseases 0.000374166 Johnson and O'Donnell TagSNP rs7245775 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
579 chr19 8429323 8429323 1 + G A rs116843064 8429323 - 8429303 8429343 41 GTGCGCCAGGACATTCATCTCGTCCCAGGACGCAAAGCGCG GTGCGCCAGGACATTCATCTTGTCCCAGGACGCAAAGCGCG Direct Gain 0 0.833919882774353 Functional Gain 0.833919882774353 ANGPTL4 ENSG00000167772 CDS Human protein_coding chr19:8429323 chr19:8429323 nonsynonymous SNV 1.000 3 21 hPsi_associated_SNPs_254916 1 27036123 Triglycerides 4e-13 GWAS_Catalog TagSNP rs116843064 GCST003661 Meta-analysis of 49 549 individuals imputed with the 1000 Genomes Project reveals an exonic damaging variant in ANGPTL4 determining fasting TG levels.
580 chr19 9273300 9273300 1 + C A rs1045354 9273300 - 9273280 9273320 41 GGGCTCTGTTTTCATGATGAGAGAGTACGTGCAGTCCCGTA GGGCTCTGTTTTCATGATGATAGAGTACGTGCAGTCCCGTA Direct Gain 0 0.989424228668213 Functional Gain 0.989424228668213 ZNF317 ENSG00000130803 UTR3 Human protein_coding chr19:9273300 chr19:9273300 . . 0 21 hPsi_associated_SNPs_254932 0 17554300 Multiple complex diseases 0.000996672 Johnson and O'Donnell TagSNP rs1045354 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
581 chr19 9959014 9959014 1 + G A rs2287838 9959014 - 9958994 9959034 41 ATGATGCCAGGAAGAAAGTGCTGCAGCCCCCCTCCCTGTGT ATGATGCCAGGAAGAAAGTGTTGCAGCCCCCCTCCCTGTGT Direct Gain 0 0.999990582466125 Functional Gain 0.999990582466125 PIN1 ENSG00000127445 UTR3 Human protein_coding chr19:9959014 chr19:9959014 . . 0 21 hPsi_associated_SNPs_254964 0 30038396 Educational attainment (MTAG) 7e-13 GWAS_Catalog TagSNP rs2287838 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
582 chr19 11221357 11221357 1 + G A rs72658860 11221357 - 11221337 11221377 41 ATTGCAGACGTGGGAACAGCCGCCGTTGTTGTCCAAGCATT ATTGCAGACGTGGGAACAGCTGCCGTTGTTGTCCAAGCATT Direct Gain 0 0.768697738647461 Functional Gain 0.768697738647461 LDLR ENSG00000130164 CDS Human protein_coding chr19:11221357 chr19:11221357 nonsynonymous SNV 0.637 4 21 hPsi_associated_SNPs_255078 4 30275531 LDL cholesterol 3e-15 GWAS_Catalog TagSNP rs72658860 GCST006612 Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program.
583 chr19 18497141 18497141 1 + T A rs1059369 18497141 - 18497121 18497161 41 TCGGAATCTGGAGTCTTCGGAGTGCAACTCTGAGGGTCCCG TCGGAATCTGGAGTCTTCGGTGTGCAACTCTGAGGGTCCCG Direct Gain 0 0.654812216758728 Functional Gain 0.654812216758728 GDF15 ENSG00000130513 CDS Human protein_coding chr19:18497141 chr19:18497141 nonsynonymous SNV 0.002 1 21 hPsi_associated_SNPs_255554 0 29628937 Growth differentiation factor-15 levels (conditioned on rs888663) 2e-10 GWAS_Catalog TagSNP rs1059369 GCST005712 A Meta-Analysis of Genome-Wide Association Studies of Growth Differentiation Factor-15 Concentration in Blood.
584 chr19 19329924 19329924 1 + C A rs2228603 19329924 - 19329904 19329944 41 GTCCTTGGCCACCAGGATGGGCAAGTCCTGTCGCTGGCCCG GTCCTTGGCCACCAGGATGGTCAAGTCCTGTCGCTGGCCCG Direct Gain 0 0.54730612039566 Functional Gain 0.54730612039566 NCAN ENSG00000130287 CDS Human protein_coding chr19:19329924 chr19:19329924 nonsynonymous SNV 0.998 2 21 hPsi_associated_SNPs_255609 0 27286809 C-reactive protein levels or total cholesterol levels (pleiotropy) 1e-35 GWAS_Catalog TagSNP rs2228603 GCST003678 Bivariate genome-wide association study identifies novel pleiotropic loci for lipids and inflammation.
585 chr19 19455750 19455750 1 + G A rs8102280 19455750 - 19455730 19455770 41 GGATTCTCCCGGGGTGTTGTCACAGGGTTACTCACCAGCAA GGATTCTCCCGGGGTGTTGTTACAGGGTTACTCACCAGCAA Direct Gain 0 0.996555149555206 Functional Gain 0.996555149555206 MAU2 ENSG00000129933 intronic Human protein_coding chr19:19455750 chr19:19455750 . . 0 21 hPsi_associated_SNPs_255615 0 26780889 Triglycerides 3e-18 GWAS_Catalog TagSNP rs8102280 GCST003301 Meta-analysis of lipid-traits in Hispanics identifies novel loci, population-specific effects, and tissue-specific enrichment of eQTLs.
586 chr19 34872382 34872382 1 + G A rs1864139 34872382 - 34872362 34872402 41 TGAGGGTCAATTCCAAACTCCTTCACTTTGGTCTACAAAAA TGAGGGTCAATTCCAAACTCTTTCACTTTGGTCTACAAAAA Direct Gain 0 0.961680352687836 Functional Gain 0.961680352687836 GPI ENSG00000105220 CDS Human protein_coding chr19:34872382 chr19:34872382 synonymous SNV . 0 21 hPsi_associated_SNPs_255895 0 17554300 Multiple complex diseases 0.000237768 Johnson and O'Donnell TagSNP rs1864139 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
587 chr19 36273534 36273534 1 + G A rs2291067 36273534 - 36273514 36273554 41 ATGACATCGTGCACCCGCACCAGACGCTCCTCCTCCCCAGG ATGACATCGTGCACCCGCACTAGACGCTCCTCCTCCCCAGG Direct Gain 0 0.999949812889099 Functional Gain 0.999949812889099 ARHGAP33 ENSG00000004777 CDS Human protein_coding chr19:36273534 chr19:36273534 synonymous SNV . 0 21 hPsi_associated_SNPs_256010 0 31005965 Umami taste perception in obesity with metabolic syndrome 8e-06 GWAS_Catalog TagSNP rs2291067 GCST008022 Association between taste perception and adiposity in overweight or obese older subjects with metabolic syndrome and identification of novel taste-related genes.
588 chr19 39888511 39888511 1 + G A rs3746082 39888511 - 39888491 39888531 41 GCAGGAAGAAGGGGCAGGGACGCAGGGGCCCGGCCTGCGAG GCAGGAAGAAGGGGCAGGGATGCAGGGGCCCGGCCTGCGAG Direct Gain 0 0.95275354385376 Functional Gain 0.95275354385376 MED29 ENSG00000063322 UTR3 Human protein_coding chr19:39888511 chr19:39888511 . . 0 21 hPsi_associated_SNPs_256217 0 27989323 Eotaxin levels 5e-07 GWAS_Catalog TagSNP rs3746082 GCST004460 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
589 chr19 40170053 40170053 1 + G A rs8103033 40170053 - 40170033 40170073 41 TTTAGTGATGACATTGTTGTCTCCCTCTGTGTAGTTCTTCA TTTAGTGATGACATTGTTGTTTCCCTCTGTGTAGTTCTTCA Direct Gain 0 0.906734347343445 Functional Gain 0.906734347343445 LGALS17A ENSG00000226025 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr19:40170053 chr19:40170053 . . 0 21 hPsi_associated_SNPs_256254 0 23251661 Obesity-related traits 8e-06 GWAS_Catalog TagSNP rs8103033 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
590 chr19 41117300 41117300 1 + G A rs34093919 41117300 - 41117280 41117320 41 GCTGGGCTCAGCACCCTCACCTTGGCAGGGGGCCCCGGGCC GCTGGGCTCAGCACCCTCACTTTGGCAGGGGGCCCCGGGCC Direct Gain 0 0.99808943271637 Functional Gain 0.99808943271637 LTBP4 ENSG00000090006 CDS Human protein_coding chr19:41117300 chr19:41117300 nonsynonymous SNV 1.000 1 21 hPsi_associated_SNPs_256291 1 30595370 Lung function (FEV1/FVC) 4e-48 GWAS_Catalog TagSNP rs34093919 GCST007080 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
591 chr19 41257046 41257046 1 + G A rs1455434 41257046 - 41257026 41257066 41 CGACCCGGTGGGCGGAGCACCCTAAATGGCGATTCCCATTG CGACCCGGTGGGCGGAGCACTCTAAATGGCGATTCCCATTG Direct Gain 0 0.968881130218506 Functional Gain 0.968881130218506 SNRPA ENSG00000077312 UTR5 Human protein_coding chr19:41257046 chr19:41257046 . . 0 21 hPsi_associated_SNPs_256306 0 28240269 Blood protein levels 2e-28 GWAS_Catalog TagSNP rs1455434 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
592 chr19 41883198 41883198 1 + G A rs1529717 41883198 - 41883178 41883218 41 CAATTGACTCCGTGCACAACCCTACTCCCCACTGCATCACA CAATTGACTCCGTGCACAACTCTACTCCCCACTGCATCACA Direct Gain 0 0.936772704124451 Functional Gain 0.936772704124451 TMEM91 ENSG00000142046 UTR5 Human protein_coding chr19:41883198 chr19:41883198 . . 0 21 hPsi_associated_SNPs_256374 0 17827064 Amyotrophic Lateral Sclerosis (ALS) 9.283e-05 Johnson and O'Donnell TagSNP rs1529717 . ITPR2 as a susceptibility gene in sporadic amyotrophic lateral sclerosis: a genome-wide association study.
593 chr19 43865320 43865320 1 + C A rs587670082 43865320 - 43865300 43865340 41 CCAACAGCGCTGCAGCTTTAGGTCGCCACCAGGGTTGATGT CCAACAGCGCTGCAGCTTTATGTCGCCACCAGGGTTGATGT Direct Gain 0 0.998122751712799 Functional Gain 0.998122751712799 CD177 ENSG00000204936 CDS Human protein_coding chr19:43865320 chr19:43865320 unknown . 0 21 hPsi_associated_SNPs_256438 0 29875488 Blood protein levels 2e-65 GWAS_Catalog TagSNP rs587670082 GCST005806 Genomic atlas of the human plasma proteome.
594 chr19 45139812 45139812 1 + C A rs203717 45139812 - 45139792 45139832 41 GGCAAAGGGAGTCTGGTTACGTTGGGTTGTTCCCTTGAACA GGCAAAGGGAGTCTGGTTACTTTGGGTTGTTCCCTTGAACA Direct Gain 0 0.998993158340454 Functional Gain 0.998993158340454 IGSF23 ENSG00000266903 ncRNA_intronic Human antisense chr19:45139812 chr19:45139812 . . 0 21 hPsi_associated_SNPs_256514 0 17554300 Multiple complex diseases 1.22e-05 Johnson and O'Donnell TagSNP rs203717 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
595 chr19 46206262 46206262 1 + G A rs17850756 46206262 - 46206242 46206282 41 AACACAGCGAGAATGCGGCACAAGTTGTGTACCGTGGGTGG AACACAGCGAGAATGCGGCATAAGTTGTGTACCGTGGGTGG Direct Gain 0 0.642364323139191 Functional Gain 0.642364323139191 QPCTL ENSG00000011478 CDS Human protein_coding chr19:46206262 chr19:46206262 synonymous SNV . 0 21 hPsi_associated_SNPs_256614 0 29875488 Blood protein levels 2e-28 GWAS_Catalog TagSNP rs17850756 GCST005806 Genomic atlas of the human plasma proteome.
596 chr19 46262286 46262286 1 + C A rs725660 46262286 - 46262266 46262306 41 AGGCCTGGGCCTCACCTTGGGTCAGGTACTCCATGTCATCC AGGCCTGGGCCTCACCTTGGTTCAGGTACTCCATGTCATCC Direct Gain 0 0.966748535633087 Functional Gain 0.966748535633087 BHMG1 ENSG00000237452 CDS Human protein_coding chr19:46262286 chr19:46262286 nonsynonymous SNV 0.150 2 21 hPsi_associated_SNPs_256619 0 27863252 Sum eosinophil basophil counts 3e-12 GWAS_Catalog TagSNP rs725660 GCST004624 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
597 chr19 49206462 49206462 1 + C A rs681343 49206462 - 49206442 49206482 41 CCGTTCATCTTGGCCAGGGCGTACAGTGTGGCGTACTCGCC CCGTTCATCTTGGCCAGGGCTTACAGTGTGGCGTACTCGCC Direct Gain 0 0.538133323192596 Functional Gain 0.538133323192596 FUT2 ENSG00000176920 CDS Human protein_coding chr19:49206462 chr19:49206462 stopgain 0.010 0 21 hPsi_associated_SNPs_256792 0 27182965 Childhood ear infection 4e-30 GWAS_Catalog TagSNP rs681343 GCST003991 Detection and interpretation of shared genetic influences on 42 human traits.
598 chr19 49605705 49605705 1 + G A rs73046792 49605705 - 49605685 49605725 41 ACATCACGAAGCCGGGTCATCAGAGGCTGGGTGGAACCCAA ACATCACGAAGCCGGGTCATTAGAGGCTGGGTGGAACCCAA Direct Gain 0 0.694116830825806 Functional Gain 0.694116830825806 SNRNP70 ENSG00000104852 UTR3 Human protein_coding chr19:49605705 chr19:49605705 . . 0 21 hPsi_associated_SNPs_256833 0 30595370 Systolic blood pressure 1e-17 GWAS_Catalog TagSNP rs73046792 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
599 chr19 50045916 50045916 1 + T A rs34459162 50045916 - 50045896 50045936 41 CAGTGGCCCACCTCACTCCCATCCAGGTGCCCATCCTTGTT CAGTGGCCCACCTCACTCCCTTCCAGGTGCCCATCCTTGTT Direct Gain 0 0.612286329269409 Functional Gain 0.612286329269409 RCN3 ENSG00000142552 CDS Human protein_coding chr19:50045916 chr19:50045916 nonsynonymous SNV 0.180 2 21 hPsi_associated_SNPs_256891 0 29844224 Fructosamine levels 5e-09 GWAS_Catalog TagSNP rs34459162 GCST006056 Genome-Wide Association Study of Serum Fructosamine and Glycated Albumin in Adults Without Diagnosed Diabetes: Results from the Atherosclerosis Risk in Communities Study.
600 chr19 51361382 51361382 1 + G A rs61752561 51361382 - 51361362 51361402 41 ATTCTTCAGGAGGCTCATATCGTAGAGCGGGTGTGGGAAGC ATTCTTCAGGAGGCTCATATTGTAGAGCGGGTGTGGGAAGC Direct Gain 0 0.675812482833862 Functional Gain 0.675812482833862 KLK3 ENSG00000142515 CDS Human protein_coding chr19:51361382 chr19:51361382 nonsynonymous SNV 0.000 1 21 hPsi_associated_SNPs_257021 0 28139693 Prostate-specific antigen levels (conditioned on lead SNPs) 2e-25 GWAS_Catalog TagSNP rs61752561 GCST004094 Genome-wide association study of prostate-specific antigen levels identifies novel loci independent of prostate cancer.
601 chr19 55481398 55481398 1 + G A rs269912 55481398 - 55481378 55481418 41 TGCAGGTTGAAGCCCATCTGCGCCGAAGACACCATCTTGTC TGCAGGTTGAAGCCCATCTGTGCCGAAGACACCATCTTGTC Direct Gain 0 0.954498529434204 Functional Gain 0.954498529434204 NLRP2 ENSG00000022556 CDS Human protein_coding chr19:55481398 chr19:55481398 synonymous SNV . 0 21 hPsi_associated_SNPs_257411 0 17554300 Multiple complex diseases 0.000837435 Johnson and O'Donnell TagSNP rs269912 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
602 chr19 57006069 57006069 1 + G A rs3971706 57006069 - 57006049 57006089 41 GGGATGGGAAGATGGGAAGTCGTTTAATGGGTAGAGTTTCA GGGATGGGAAGATGGGAAGTTGTTTAATGGGTAGAGTTTCA Direct Gain 0 0.756900906562805 Functional Gain 0.756900906562805 ZNF667-AS1 ENSG00000166770 ncRNA_exonic Human lincRNA chr19:57006069 chr19:57006069 . . 0 21 hPsi_associated_SNPs_257543 0 17554300 Multiple complex diseases 0.000114773 Johnson and O'Donnell TagSNP rs3971706 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
603 chr19 57802911 57802911 1 + G A rs36032958 57802911 - 57802891 57802931 41 CACTCAAGGCACTTAAAGGGCCTCTCCCCAGTATGGATAAT CACTCAAGGCACTTAAAGGGTCTCTCCCCAGTATGGATAAT Direct Gain 0 0.978271126747131 Functional Gain 0.978271126747131 ZNF460 ENSG00000197714 CDS Human protein_coding chr19:57802911 chr19:57802911 synonymous SNV . 0 21 hPsi_associated_SNPs_257615 0 26053186 3-hydroxypropylmercapturic acid levels in smokers 5e-06 GWAS_Catalog TagSNP rs36032958 GCST002956 Mercapturic Acids Derived from the Toxicants Acrolein and Crotonaldehyde in the Urine of Cigarette Smokers from Five Ethnic Groups with Differing Risks for Lung Cancer.
604 chr20 3193842 3193842 1 + C A rs1127354 3193842 - 3193822 3193862 41 CTGTGCCACCAAAGTGCATGGAAACTTATCTCCTAGAATCT CTGTGCCACCAAAGTGCATGTAAACTTATCTCCTAGAATCT Direct Gain 0 0.999998092651367 Functional Gain 0.999998092651367 ITPA ENSG00000125877 CDS Human protein_coding chr20:3193842 chr20:3193842 nonsynonymous SNV 1.000 1 21 hPsi_associated_SNPs_257922 3 20637204 Ribavirin-induced anemia 4e-44 GWAS_Catalog TagSNP rs1127354 GCST000729 ITPA polymorphism affects ribavirin-induced anemia and outcomes of therapy--a genome-wide study of Japanese HCV virus patients.
605 chr20 23017082 23017082 1 + T A rs2567608 23017082 - 23017062 23017102 41 GGCAGAGAACCCGCTGGAAGAATCGGCGGAAGTTGTCGGAG GGCAGAGAACCCGCTGGAAGTATCGGCGGAAGTTGTCGGAG Direct Gain 0 0.997093975543976 Functional Gain 0.997093975543976 SSTR4 ENSG00000132671 CDS Human protein_coding chr20:23017082 chr20:23017082 nonsynonymous SNV 0.074 1 21 hPsi_associated_SNPs_258178 0 18282107 Schizophrenia 0.006979535 Johnson and O'Donnell TagSNP rs2567608 . Genome-wide association identifies a common variant in the reelin gene that increases the risk of schizophrenia only in women.
606 chr20 25202892 25202892 1 + G A rs6037062 25202892 - 25202872 25202912 41 GAGTGCTTCCAGGGTTCCCACGGTCCACAGACCCATGCTCC GAGTGCTTCCAGGGTTCCCATGGTCCACAGACCCATGCTCC Direct Gain 0 0.777262568473816 Functional Gain 0.777262568473816 ENTPD6 ENSG00000197586 intronic Human protein_coding chr20:25202892 chr20:25202892 . . 0 21 hPsi_associated_SNPs_258214 0 30595370 Lung function (FVC) 5e-12 GWAS_Catalog TagSNP rs6037062 GCST007081 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
607 chr20 36977970 36977970 1 + G A rs1739654 36977970 - 36977950 36977990 41 AGCAGCTCACTCTGCAGAGCCAATAGCCCCTCCTGGGCCGC AGCAGCTCACTCTGCAGAGCTAATAGCCCCTCCTGGGCCGC Direct Gain 0 0.775410652160645 Functional Gain 0.775410652160645 LBP ENSG00000129988 CDS Human protein_coding chr20:36977970 chr20:36977970 synonymous SNV . 0 21 hPsi_associated_SNPs_258522 0 23382691 IgG glycosylation 5e-06 GWAS_Catalog TagSNP rs1739654 GCST001848 Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers.
608 chr20 43629135 43629135 1 + G A rs17420378 43629135 - 43629115 43629155 41 TTCTTCATCGTCCTGGTCCACTTCCCGCTGCTGGGATTCCT TTCTTCATCGTCCTGGTCCATTTCCCGCTGCTGGGATTCCT Direct Gain 0 0.749243557453156 Functional Gain 0.749243557453156 STK4 ENSG00000101109 CDS Human protein_coding chr20:43629135 chr20:43629135 nonsynonymous SNV 1.000 0 21 hPsi_associated_SNPs_258671 0 17554300 Multiple complex diseases 0.000272466 Johnson and O'Donnell TagSNP rs17420378 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
609 chr20 44507536 44507536 1 + G A rs4812973 44507536 - 44507516 44507556 41 GGAAGAGGGTGACCTTGCAGCACGGAGATAACTTTGGCCTT GGAAGAGGGTGACCTTGCAGTACGGAGATAACTTTGGCCTT Direct Gain 0 0.999691247940063 Functional Gain 0.999691247940063 ZSWIM3 ENSG00000132801 UTR3 Human protein_coding chr20:44507536 chr20:44507536 . . 0 21 hPsi_associated_SNPs_258710 0 26053186 3-hydroxypropylmercapturic acid levels in smokers 8e-06 GWAS_Catalog TagSNP rs4812973 GCST002956 Mercapturic Acids Derived from the Toxicants Acrolein and Crotonaldehyde in the Urine of Cigarette Smokers from Five Ethnic Groups with Differing Risks for Lung Cancer.
610 chr20 52107666 52107666 1 + T A rs16998132 52107666 - 52107646 52107686 41 GCATTCATCTACATCTTACTATCCTTGTTGCAGAGAAGAGA GCATTCATCTACATCTTACTTTCCTTGTTGCAGAGAAGAGA Direct Gain 0 0.926801919937134 Functional Gain 0.926801919937134 TSHZ2 ENSG00000259723 ncRNA_intronic Human antisense chr20:52107666 chr20:52107666 . . 0 21 hPsi_associated_SNPs_258832 0 17554300 Multiple complex diseases 0.000771567 Johnson and O'Donnell TagSNP rs16998132 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
611 chr20 54823805 54823805 1 + C A rs3746619 54823805 - 54823785 54823825 41 CAAAATCTCCCTCCAGATACGTCTTTTGGATGCTCATTCAA CAAAATCTCCCTCCAGATACTTCTTTTGGATGCTCATTCAA Direct Gain 0 0.642684876918793 Functional Gain 0.642684876918793 MC3R ENSG00000124089 UTR5 Human protein_coding chr20:54823805 chr20:54823805 . . 0 21 hPsi_associated_SNPs_258840 0 30595370 Menarche (age at onset) 3e-11 GWAS_Catalog TagSNP rs3746619 GCST007078 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
612 chr20 56138648 56138648 1 + G A rs11552145 56138648 - 56138628 56138668 41 GGCCGCCAGGTACTTCTTCTCACCCTCAGGGTTGGTTATAC GGCCGCCAGGTACTTCTTCTTACCCTCAGGGTTGGTTATAC Direct Gain 0 0.998697459697723 Functional Gain 0.998697459697723 PCK1 ENSG00000124253 CDS Human protein_coding chr20:56138648 chr20:56138648 nonsynonymous SNV 0.449 0 21 hPsi_associated_SNPs_258868 1 28644415 Prudent dietary pattern 2e-06 GWAS_Catalog TagSNP rs11552145 GCST004639 Genome-Wide Association Study of Dietary Pattern Scores.
613 chr20 58895846 58895846 1 + G A rs11698685 58895846 - 58895826 58895866 41 GCTTGAGTGGCAGATTTGTACGAAGCCACTTTCACATCGAG GCTTGAGTGGCAGATTTGTATGAAGCCACTTTCACATCGAG Direct Gain 0 0.989349365234375 Functional Gain 0.989349365234375 MIR646HG ENSG00000228340 ncRNA_exonic Human lincRNA chr20:58895846 chr20:58895846 . . 0 21 hPsi_associated_SNPs_258997 0 23028342 Type 1 diabetes nephropathy 1e-06 GWAS_Catalog TagSNP rs11698685 GCST001688 New susceptibility loci associated with kidney disease in type 1 diabetes.
614 chr20 60514224 60514224 1 + G A rs4925325 60514224 - 60514204 60514244 41 GGCCATAGTCACACTTCGAACAATCCACGCATACTCCGAAG GGCCATAGTCACACTTCGAATAATCCACGCATACTCCGAAG Direct Gain 0 0.999998569488525 Functional Gain 0.999998569488525 CDH4 ENSG00000179242 UTR3 Human protein_coding chr20:60514224 chr20:60514224 . . 0 21 hPsi_associated_SNPs_259025 0 23251661 Obesity-related traits 7e-06 GWAS_Catalog TagSNP rs4925325 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
615 chr20 62327582 62327582 1 + G A rs2297441 62327582 - 62327562 62327602 41 GTCCTGGGCACTGCCAGCAGCTTTATTAGAGAGCCCTGTCC GTCCTGGGCACTGCCAGCAGTTTTATTAGAGAGCCCTGTCC Direct Gain 0 0.7073814868927 Functional Gain 0.7073814868927 RTEL1-TNFRSF6B ENSG00000258366 UTR3 Human protein_coding chr20:62327582 chr20:62327582 . . 0 21 hPsi_associated_SNPs_259199 0 21297633 Ulcerative colitis 2e-10 GWAS_Catalog TagSNP rs2297441 GCST000964 Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47.
616 chr21 29912452 29912452 1 + C A rs2150392 29912452 - 29912432 29912472 41 CCACAATTTTAGTTCTCTGTGTTAACCGATTTGTAGTCTAT CCACAATTTTAGTTCTCTGTTTTAACCGATTTGTAGTCTAT Direct Gain 0 0.864917635917664 Functional Gain 0.864917635917664 LINC00161 ENSG00000226935 ncRNA_exonic Human lincRNA chr21:29912452 chr21:29912452 . . 0 21 hPsi_associated_SNPs_259334 0 17554300 Multiple complex diseases 0.000214965 Johnson and O'Donnell TagSNP rs2150392 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
617 chr21 46931109 46931109 1 + G A rs12483377 46931109 - 46931089 46931129 41 CCTCAGGACGTCCTTGCCGTCAAAGGAGAAGATGCGTGCCC CCTCAGGACGTCCTTGCCGTTAAAGGAGAAGATGCGTGCCC Direct Gain 0 1 Functional Gain 1 COL18A1 ENSG00000182871 CDS Human protein_coding chr21:46931109 chr21:46931109 nonsynonymous SNV 0.595 3 21 hPsi_associated_SNPs_259803 2 29875488 Blood protein levels 0 GWAS_Catalog TagSNP rs12483377 GCST005806 Genomic atlas of the human plasma proteome.
618 chr21 46932614 46932614 1 + C A rs17255281 46932614 - 46932594 46932634 41 CCTGGAGAAATCGAGCCGTGGTCTGATCAGGCCAAGAGGTT CCTGGAGAAATCGAGCCGTGTTCTGATCAGGCCAAGAGGTT Direct Gain 0 0.999761700630188 Functional Gain 0.999761700630188 COL18A1 ENSG00000182871 UTR3 Human protein_coding chr21:46932614 chr21:46932614 . . 0 21 hPsi_associated_SNPs_259805 1 29064472 Pursuit maintenance gain 2e-06 GWAS_Catalog TagSNP rs17255281 GCST005024 Genome-wide association studies of smooth pursuit and antisaccade eye movements in psychotic disorders: findings from the B-SNIP study.
619 chr22 20134350 20134350 1 + C A rs1974653 20134350 - 20134330 20134370 41 AGAGTTCCAGCAGGTTCAGCGGCCCCCACAGGGCCCTGAGC AGAGTTCCAGCAGGTTCAGCTGCCCCCACAGGGCCCTGAGC Direct Gain 0 0.995905756950378 Functional Gain 0.995905756950378 ZDHHC8 ENSG00000099904 UTR3 Human protein_coding chr22:20134350 chr22:20134350 . . 0 21 hPsi_associated_SNPs_260071 0 26198764 Schizophrenia 8e-06 GWAS_Catalog TagSNP rs1974653 GCST003048 Genome-wide association study of schizophrenia in Ashkenazi Jews.
620 chr22 22712467 22712467 1 + T A rs5757973 22712467 - 22712447 22712487 41 CCTGAGGGCCGCTGATTATTACTATAGATGAGGAGTTTGGG CCTGAGGGCCGCTGATTATTTCTATAGATGAGGAGTTTGGG Direct Gain 0 0.968217849731445 Functional Gain 0.968217849731445 BMS1P20;ZNF280B ENSG00000211648 CDS Human IG_V_gene chr22:22712467 chr22:22712467 nonsynonymous SNV . 0 21 hPsi_associated_SNPs_260243 0 29875488 Blood protein levels 2e-21 GWAS_Catalog TagSNP rs5757973 GCST005806 Genomic atlas of the human plasma proteome.
621 chr22 31286928 31286928 1 + G A rs41282553 31286928 - 31286908 31286948 41 GGAGCGCAGGCCCATGTCGTCGAGGCGGTCCAGCTCGAAGG GGAGCGCAGGCCCATGTCGTTGAGGCGGTCCAGCTCGAAGG Direct Gain 0 0.996030271053314 Functional Gain 0.996030271053314 OSBP2 ENSG00000184792 CDS Human protein_coding chr22:31286928 chr22:31286928 nonsynonymous SNV 0.710 0 21 hPsi_associated_SNPs_260656 0 30038396 Educational attainment (MTAG) 8e-12 GWAS_Catalog TagSNP rs41282553 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
622 chr22 36661330 36661330 1 + G A rs2239785 36661330 - 36661310 36661350 41 TCTTATGTTATCCTCAAGCTCACTTTTCAACCGAGGAAACT TCTTATGTTATCCTCAAGCTTACTTTTCAACCGAGGAAACT Direct Gain 0 0.565086483955383 Functional Gain 0.565086483955383 APOL1 ENSG00000100342 CDS Human protein_coding chr22:36661330 chr22:36661330 nonsynonymous SNV 0.001 1 21 hPsi_associated_SNPs_260784 0 20668430 Glomerulosclerosis 5e-13 GWAS_Catalog TagSNP rs2239785 GCST000741 A risk allele for focal segmental glomerulosclerosis in African Americans is located within a region containing APOL1 and MYH9.
623 chr22 37424991 37424991 1 + G A rs5756492 37424991 - 37424971 37425011 41 CTGAACTTTGAACCTAAGAACTGGGCCCCAAGGTTTCCTGA CTGAACTTTGAACCTAAGAATTGGGCCCCAAGGTTTCCTGA Direct Gain 0 0.990601897239685 Functional Gain 0.990601897239685 MPST ENSG00000128309 intronic Human protein_coding chr22:37424991 chr22:37424991 . . 0 21 hPsi_associated_SNPs_260808 0 30664655 Eye color (saturation) 5e-08 GWAS_Catalog TagSNP rs5756492 GCST007457 A GWAS in Latin Americans highlights the convergent evolution of lighter skin pigmentation in Eurasia.
624 chr22 39830586 39830586 1 + G A rs17001110 39830586 - 39830566 39830606 41 GTGGAATGCCAAGCGCCTGTCTCTGCTCGGGGCTGACATCA GTGGAATGCCAAGCGCCTGTTTCTGCTCGGGGCTGACATCA Direct Gain 0 0.999986052513123 Functional Gain 0.999986052513123 LOC100506472 ENSG00000100324 intronic Human protein_coding chr22:39830586 chr22:39830586 . . 0 21 hPsi_associated_SNPs_260934 0 28552196 Waist circumference 6e-06 GWAS_Catalog TagSNP rs17001110 GCST008151 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
625 chr22 41736090 41736090 1 + G A rs9607793 41736090 - 41736070 41736110 41 TCGTGTCGACCCAAAGCTGTCGAGTGCATCCAGCCGGGTCT TCGTGTCGACCCAAAGCTGTTGAGTGCATCCAGCCGGGTCT Direct Gain 0 0.992003440856934 Functional Gain 0.992003440856934 ZC3H7B ENSG00000100403 CDS Human protein_coding chr22:41736090 chr22:41736090 nonsynonymous SNV 0.701 1 21 hPsi_associated_SNPs_261017 0 30595370 Red cell distribution width 4e-08 GWAS_Catalog TagSNP rs9607793 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
626 chr22 42392811 42392811 1 + G A rs1062753 42392811 - 42392791 42392831 41 GGGAGGCTCAGATCATGGTTCAGGGGTGCCAGGCACCATTC GGGAGGCTCAGATCATGGTTTAGGGGTGCCAGGCACCATTC Direct Gain 0 0.777408123016357 Functional Gain 0.777408123016357 SEPT3 ENSG00000100167 UTR3 Human protein_coding chr22:42392811 chr22:42392811 . . 0 21 hPsi_associated_SNPs_261053 0 24528284 Response to serotonin reuptake inhibitors in major depressive disorder (plasma drug and metabolite levels) 2e-16 GWAS_Catalog TagSNP rs1062753 GCST002549 Citalopram and escitalopram plasma drug and metabolite concentrations: genome-wide associations.
627 chr22 51042336 51042336 1 + G A rs116947359 51042336 - 51042316 51042356 41 GGTTCCCTTCGCAGTCGCAACCCGGGCGCACTGGCGACTGC GGTTCCCTTCGCAGTCGCAATCCGGGCGCACTGGCGACTGC Direct Gain 0 0.993294358253479 Functional Gain 0.993294358253479 MAPK8IP2 ENSG00000008735 CDS Human protein_coding chr22:51042336 chr22:51042336 nonsynonymous SNV 0.498 0 21 hPsi_associated_SNPs_261388 0 30072576 Blood protein levels 1e-07 GWAS_Catalog TagSNP rs116947359 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
628 chrX 27839572 27839572 1 + T A rs1368769 27839572 - 27839552 27839592 41 CCCCATCAAGTGAACTCTGGAAAACATCCTTCAAACAAGCA CCCCATCAAGTGAACTCTGGTAAACATCCTTCAAACAAGCA Direct Gain 0 0.990629136562347 Functional Gain 0.990629136562347 MAGEB10 ENSG00000177689 CDS Human protein_coding chrX:27839572 chrX:27839572 nonsynonymous SNV 0.001 0 21 hPsi_associated_SNPs_261670 0 17660530 Multiple sclerosis 5.63e-05 Johnson and O'Donnell TagSNP rs1368769 . Risk alleles for multiple sclerosis identified by a genomewide study.
629 chrX 48436426 48436426 1 + G A rs3200611 48436426 - 48436406 48436446 41 CCCAGGCTGGAGTACAGTGGCGCGATCTTAGCTCACTGCAA CCCAGGCTGGAGTACAGTGGTGCGATCTTAGCTCACTGCAA Direct Gain 0 0.996345400810242 Functional Gain 0.996345400810242 RBM3 ENSG00000102317 UTR3 Human protein_coding chrX:48436426 chrX:48436426 . . 0 21 hPsi_associated_SNPs_261811 0 28928442 Hepatitis A 9e-06 GWAS_Catalog TagSNP rs3200611 GCST005017 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
630 chrX 148622745 148622745 1 + T A rs3747442 148622745 - 148622725 148622765 41 CCGGCTTTTCGCCACAGGAAAGAACAGTCCTCTGCCTCCCC CCGGCTTTTCGCCACAGGAATGAACAGTCCTCTGCCTCCCC Direct Gain 0 0.955855250358582 Functional Gain 0.955855250358582 CXorf40A ENSG00000197620 UTR5 Human protein_coding chrX:148622745 chrX:148622745 . . 0 21 hPsi_associated_SNPs_262404 0 17052657 Parkinson's disease 0.000510495 Johnson and O'Donnell TagSNP rs3747442 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.