1 chr6 10723449 10723449 1 + A C rs1045911 10723449 + 10723429 10723469 41 TGCGGCTTGCGCGCCCTTGTAGACAGCCGGGGCCTTCGTGA TGCGGCTTGCGCGCCCTTGTCGACAGCCGGGGCCTTCGTGA Direct Loss 1 0 Functional Loss -1 TMEM14C ENSG00000111843 UTR5 Human protein_coding chr6:10723449 chr6:10723449 . . 0 21 hm1A_associated_SNPs_28 0 30595370 Mean corpuscular hemoglobin 9e-10 GWAS_Catalog TagSNP rs1045911 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
2 chr6 29913298 29913298 1 + A T rs1061235 29913295 + 29913275 29913315 41 GCCCTTCCCTTTGTGACTTGAAGAACCCTGACTTTGTTTCT GCCCTTCCCTTTGTGACTTGAAGTACCCTGACTTTGTTTCT < 41bp 1 0.0536052286624908 Functional Loss -0.946394771337509 HLA-A ENSG00000206503 UTR3 Human protein_coding chr6:29913295 chr6:29913298 . . 0 24 hm1A_associated_SNPs_340 1 21428769 Adverse response to carbamazepine 1e-07 GWAS_Catalog TagSNP rs1061235 GCST001014 HLA-A*3101 and carbamazepine-induced hypersensitivity reactions in Europeans.
3 chr19 50045916 50045916 1 + T A rs34459162 50045909 + 50045889 50045929 41 GGATCTGAACAAGGATGGGCACCTGGATGGGAGTGAGGTGG GGATCTGAACAAGGATGGGCACCTGGAAGGGAGTGAGGTGG < 41bp 1 0.251935541629791 Functional Loss -0.748064458370209 RCN3 ENSG00000142552 CDS Human protein_coding chr19:50045909 chr19:50045916 nonsynonymous SNV 0.180 2 28 hm1A_associated_SNPs_670 0 29844224 Fructosamine levels 5e-09 GWAS_Catalog TagSNP rs34459162 GCST006056 Genome-Wide Association Study of Serum Fructosamine and Glycated Albumin in Adults Without Diagnosed Diabetes: Results from the Atherosclerosis Risk in Communities Study.
4 chr1 2494330 2494330 1 + G A rs2234167 2494330 + 2494310 2494350 41 TAGTCAAGGTGATCGTCTCCGTCCAGGTATTGATCCTCCTC TAGTCAAGGTGATCGTCTCCATCCAGGTATTGATCCTCCTC Direct Gain 0 0.991368234157562 Functional Gain 0.991368234157562 TNFRSF14 ENSG00000157873 CDS Human protein_coding chr1:2494330 chr1:2494330 nonsynonymous SNV 0.000 1 21 hm1A_associated_SNPs_3297 1 31015401 Medication use (thyroid preparations) 9e-10 GWAS_Catalog TagSNP rs2234167 GCST007932 Genome-wide association study of medication-use and associated disease in the UK Biobank.
5 chr1 3649562 3649562 1 + G A rs9662633 3649562 + 3649542 3649582 41 GGCGGCCCTGACGAGTGGGCGGACTTCGGCTTCGACCTGCC GGCGGCCCTGACGAGTGGGCAGACTTCGGCTTCGACCTGCC Direct Gain 0 0.603412628173828 Functional Gain 0.603412628173828 TP73 ENSG00000078900 CDS Human protein_coding chr1:3649562 chr1:3649562 synonymous SNV . 0 21 hm1A_associated_SNPs_3339 0 22589738 Visceral adipose tissue adjusted for BMI 6e-06 GWAS_Catalog TagSNP rs9662633 GCST001523 Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women.
6 chr1 3651409 3651409 1 + G A rs10910018 3651409 + 3651389 3651429 41 CAGCAGGAACGGGGCTGTCGGCTCTCAGGGGATCTGGCTGC CAGCAGGAACGGGGCTGTCGACTCTCAGGGGATCTGGCTGC Direct Gain 0 0.851248741149902 Functional Gain 0.851248741149902 TP73 ENSG00000078900 UTR3 Human protein_coding chr1:3651409 chr1:3651409 . . 0 21 hm1A_associated_SNPs_3341 0 22589738 Visceral fat 2e-06 GWAS_Catalog TagSNP rs10910018 GCST001525 Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women.
7 chr1 8021740 8021740 1 + G A rs17523802 8021740 + 8021720 8021760 41 TGCGCAGTGTGGGGCTGAGGGAGGCCGGACGGCGCGCGTGC TGCGCAGTGTGGGGCTGAGGAAGGCCGGACGGCGCGCGTGC Direct Gain 0 0.888636589050293 Functional Gain 0.888636589050293 PARK7 ENSG00000116288 UTR5 Human protein_coding chr1:8021740 chr1:8021740 . . 0 21 hm1A_associated_SNPs_3410 1 28928442 Tonsillectomy 9e-07 GWAS_Catalog TagSNP rs17523802 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
8 chr1 18808292 18808292 1 + C A rs2992753 18808292 + 18808272 18808312 41 CCCGCGTCCGAATGGAGGAGCATTTCATACAGAAGGCGGAG CCCGCGTCCGAATGGAGGAGAATTTCATACAGAAGGCGGAG Direct Gain 0 0.569052934646606 Functional Gain 0.569052934646606 KLHDC7A ENSG00000179023 CDS Human protein_coding chr1:18808292 chr1:18808292 nonsynonymous SNV 0.947 0 21 hm1A_associated_SNPs_3688 0 30275531 LDL cholesterol 5e-09 GWAS_Catalog TagSNP rs2992753 GCST006612 Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program.
9 chr1 43828736 43828736 1 + G A rs45461499 43828736 + 43828716 43828756 41 TTTTGAGTTGGACCCTGCGCGGCGGCGGGAGCGGGAGAAGG TTTTGAGTTGGACCCTGCGCAGCGGCGGGAGCGGGAGAAGG Direct Gain 0 0.704443275928497 Functional Gain 0.704443275928497 CDC20 ENSG00000117399 CDS Human protein_coding chr1:43828736 chr1:43828736 nonsynonymous SNV 0.189 0 21 hm1A_associated_SNPs_4118 0 27114598 Asparaginase-induced acute pancreatitis in acute lymphoblastic leukemia (onset time) 4e-09 GWAS_Catalog TagSNP rs45461499 GCST003501 Clinical and Genetic Risk Factors for Acute Pancreatitis in Patients With Acute Lymphoblastic Leukemia.
10 chr1 43919486 43919486 1 + C A rs182798940 43919486 + 43919466 43919506 41 CCTGGGGAGGCCGGGCCGGGCGGAGTCCGCGGGATCCAAAG CCTGGGGAGGCCGGGCCGGGAGGAGTCCGCGGGATCCAAAG Direct Gain 0 0.977978706359863 Functional Gain 0.977978706359863 HYI;SZT2 ENSG00000178922 UTR5 Human protein_coding chr1:43919486 chr1:43919486 . . 0 21 hm1A_associated_SNPs_4125 0 26830138 Alzheimer disease and age of onset 7e-07 GWAS_Catalog TagSNP rs182798940 GCST003427 Family-based association analyses of imputed genotypes reveal genome-wide significant association of Alzheimer's disease with OSBPL6, PTPRG, and PDCL3.
11 chr1 44137257 44137257 1 + C A rs586339 44137257 + 44137237 44137277 41 GGATGAGGAGGAAGAACAAGCAGCAGCTGCCTTGGATCTTT GGATGAGGAGGAAGAACAAGAAGCAGCTGCCTTGGATCTTT Direct Gain 0 0.650399923324585 Functional Gain 0.650399923324585 KDM4A ENSG00000066135 CDS Human protein_coding chr1:44137257 chr1:44137257 nonsynonymous SNV 0.980 0 21 hm1A_associated_SNPs_4136 0 30038396 Educational attainment (MTAG) 2e-31 GWAS_Catalog TagSNP rs586339 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
12 chr1 46073489 46073489 1 + G A rs2230657 46073489 + 46073469 46073509 41 GAAGCAGAGTCTTTAGACCCGACAGTCAAGCCAGTGGATGT GAAGCAGAGTCTTTAGACCCAACAGTCAAGCCAGTGGATGT Direct Gain 0 0.918261766433716 Functional Gain 0.918261766433716 NASP ENSG00000132780 CDS Human protein_coding chr1:46073489 chr1:46073489 synonymous SNV . 0 21 hm1A_associated_SNPs_4176 0 27863252 Hemoglobin concentration 3e-13 GWAS_Catalog TagSNP rs2230657 GCST004615 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
13 chr1 55505647 55505647 1 + G A rs11591147 55505647 + 55505627 55505667 41 GGAGCTGGTGCTAGCCTTGCGTTCCGAGGAGGACGGCCTGG GGAGCTGGTGCTAGCCTTGCATTCCGAGGAGGACGGCCTGG Direct Gain 0 0.970383822917938 Functional Gain 0.970383822917938 PCSK9 ENSG00000169174 CDS Human protein_coding chr1:55505647 chr1:55505647 nonsynonymous SNV 0.001 0 21 hm1A_associated_SNPs_4285 0 22331829 Response to statins (LDL cholesterol change) 5e-09 GWAS_Catalog TagSNP rs11591147 GCST001408 Genetic determinants of statin-induced low-density lipoprotein cholesterol reduction: the Justification for the Use of Statins in Prevention: an Intervention Trial Evaluating Rosuvastatin (JUPITER) trial.
14 chr1 55529187 55529187 1 + G A rs505151 55529187 + 55529167 55529207 41 TACAGGCAGCACCAGCGAAGGGGCCGTGACAGCCGTTGCCA TACAGGCAGCACCAGCGAAGAGGCCGTGACAGCCGTTGCCA Direct Gain 0 0.962957739830017 Functional Gain 0.962957739830017 PCSK9 ENSG00000169174 CDS Human protein_coding chr1:55529187 chr1:55529187 nonsynonymous SNV 0.001 0 21 hm1A_associated_SNPs_4291 3 28334899 Total cholesterol levels 3e-08 GWAS_Catalog TagSNP rs505151 GCST004235 Association analyses of East Asian individuals and trans-ancestry analyses with European individuals reveal new loci associated with cholesterol and triglyceride levels.
15 chr1 62579891 62579891 1 + G A rs12140153 62579891 + 62579871 62579911 41 GCAGAAGAAAGCTGGCCGGGGCCTGGGCCTGAGCATCGTTG GCAGAAGAAAGCTGGCCGGGACCTGGGCCTGAGCATCGTTG Direct Gain 0 0.868939816951752 Functional Gain 0.868939816951752 PATJ ENSG00000132849 CDS Human protein_coding chr1:62579891 chr1:62579891 nonsynonymous SNV 0.990 4 21 hm1A_associated_SNPs_4304 0 27494321 Chronotype 3e-08 GWAS_Catalog TagSNP rs12140153 GCST003837 Genome-Wide Association Analyses in 128,266 Individuals Identifies New Morningness and Sleep Duration Loci.
16 chr1 66102257 66102257 1 + G A rs1805096 66102257 + 66102237 66102277 41 TTCTCTAGCAAAAATTCTCCGTTGAAGGATTCTTTCTCTAA TTCTCTAGCAAAAATTCTCCATTGAAGGATTCTTTCTCTAA Direct Gain 0 0.932062268257141 Functional Gain 0.932062268257141 LEPR ENSG00000116678 CDS Human protein_coding chr1:66102257 chr1:66102257 synonymous SNV . 0 21 hm1A_associated_SNPs_4331 2 22939635 C-reactive protein 2e-09 GWAS_Catalog TagSNP rs1805096 GCST001650 Genome-wide association and population genetic analysis of C-reactive protein in African American and Hispanic American women.
17 chr1 94019561 94019561 1 + G A rs114771147 94019561 + 94019541 94019581 41 TTATTTGAATCATACTACCCGTTATACTAAAGCTGAATGAC TTATTTGAATCATACTACCCATTATACTAAAGCTGAATGAC Direct Gain 0 0.972035527229309 Functional Gain 0.972035527229309 FNBP1L ENSG00000137942 UTR3 Human protein_coding chr1:94019561 chr1:94019561 . . 0 21 hm1A_associated_SNPs_4439 0 28584286 Cognitive empathy 4e-06 GWAS_Catalog TagSNP rs114771147 GCST005755 Genome-wide meta-analysis of cognitive empathy: heritability, and correlates with sex, neuropsychiatric conditions and cognition.
18 chr1 101704577 101704577 1 + C A rs41287280 101704577 + 101704557 101704597 41 TCCCGCTGGTCAAGGCCCACCGCAGCTCGGTCTCTGACTAC TCCCGCTGGTCAAGGCCCACAGCAGCTCGGTCTCTGACTAC Direct Gain 0 0.845171213150024 Functional Gain 0.845171213150024 S1PR1 ENSG00000170989 CDS Human protein_coding chr1:101704577 chr1:101704577 nonsynonymous SNV 0.012 0 21 hm1A_associated_SNPs_4475 0 27863252 Lymphocyte counts 2e-19 GWAS_Catalog TagSNP rs41287280 GCST004627 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
19 chr1 150484987 150484987 1 + G A rs13294 150484987 + 150484967 150485007 41 ACATCTTGACCATTGACATCGGTCGAGTCACCCCCAACCTC ACATCTTGACCATTGACATCAGTCGAGTCACCCCCAACCTC Direct Gain 0 0.529756188392639 Functional Gain 0.529756188392639 ECM1 ENSG00000143369 CDS Human protein_coding chr1:150484987 chr1:150484987 nonsynonymous SNV 0.754 0 21 hm1A_associated_SNPs_4714 0 28240269 Blood protein levels 8e-102 GWAS_Catalog TagSNP rs13294 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
20 chr1 152487917 152487917 1 + G A rs73004856 152487917 + 152487897 152487937 41 TTTCCAAGGGGTCGTCCCAGGGCCCCGCTCCGTGTCCCGCC TTTCCAAGGGGTCGTCCCAGAGCCCCGCTCCGTGTCCCGCC Direct Gain 0 0.521331667900085 Functional Gain 0.521331667900085 CRCT1 ENSG00000169509 CDS Human protein_coding chr1:152487917 chr1:152487917 nonsynonymous SNV 0.750 0 21 hm1A_associated_SNPs_4756 0 23251661 Obesity-related traits 3e-06 GWAS_Catalog TagSNP rs73004856 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
21 chr1 161642985 161642985 1 + G A rs182968886 161642985 + 161642965 161643005 41 GGAAACATAGGCTACACGCTGTACTCATCCAAGCCTGTGAC GGAAACATAGGCTACACGCTATACTCATCCAAGCCTGTGAC Direct Gain 0 0.723024487495422 Functional Gain 0.723024487495422 FCGR2B ENSG00000072694 CDS Human protein_coding chr1:161642985 chr1:161642985 synonymous SNV . 0 21 hm1A_associated_SNPs_4987 0 27863252 Monocyte percentage of white cells 7e-11 GWAS_Catalog TagSNP rs182968886 GCST004609 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
22 chr1 169101060 169101060 1 + G A rs12079745 169101060 + 169101040 169101080 41 TTACTGTAAATTATGATTCCGTAACTGACTTGTAGTAAGCA TTACTGTAAATTATGATTCCATAACTGACTTGTAGTAAGCA Direct Gain 0 0.998918890953064 Functional Gain 0.998918890953064 ATP1B1 ENSG00000143153 UTR3 Human protein_coding chr1:169101060 chr1:169101060 . . 0 21 hm1A_associated_SNPs_5055 0 24952745 QT interval 1e-10 GWAS_Catalog TagSNP rs12079745 GCST002500 Genetic association study of QT interval highlights role for calcium signaling pathways in myocardial repolarization.
23 chr1 173725101 173725101 1 + G A rs16846395 173725101 + 173725081 173725121 41 AAAAACTACCTCCTATTGCCGCAAGAACGACCACTAATGCA AAAAACTACCTCCTATTGCCACAAGAACGACCACTAATGCA Direct Gain 0 0.505141198635101 Functional Gain 0.505141198635101 KLHL20 ENSG00000076321 CDS Human protein_coding chr1:173725101 chr1:173725101 synonymous SNV . 0 21 hm1A_associated_SNPs_5071 0 17554300 Multiple complex diseases 1.283e-05 Johnson and O'Donnell TagSNP rs16846395 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
24 chr1 183155482 183155482 1 + C A rs684527 183155482 + 183155462 183155502 41 CAGAGACTGAGCGGCCCGGCCCCGCCATGCCTGCGCTCTGG CAGAGACTGAGCGGCCCGGCACCGCCATGCCTGCGCTCTGG Direct Gain 0 0.601532340049744 Functional Gain 0.601532340049744 LAMC2 ENSG00000058085 UTR5 Human protein_coding chr1:183155482 chr1:183155482 . . 0 21 hm1A_associated_SNPs_5162 1 30048462 Heel bone mineral density 2e-11 GWAS_Catalog TagSNP rs684527 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
25 chr1 184020945 184020945 1 + G A rs2274432 184020945 + 184020925 184020965 41 CTGCAGCGGCCTGGGTCCGGGCGGTGTTCGCGGCTTTGGCG CTGCAGCGGCCTGGGTCCGGACGGTGTTCGCGGCTTTGGCG Direct Gain 0 0.99507737159729 Functional Gain 0.99507737159729 TSEN15 ENSG00000198860 CDS Human protein_coding chr1:184020945 chr1:184020945 nonsynonymous SNV 0.094 0 21 hm1A_associated_SNPs_5172 0 18391951 Height 8e-09 GWAS_Catalog TagSNP rs2274432 GCST000175 Many sequence variants affecting diversity of adult human height.
26 chr1 214161820 214161820 1 + G A rs340839 214161820 + 214161800 214161840 41 GCTCGGTCCCACTGCTCCCTGCACCGCGTAAGTATCTTCTT GCTCGGTCCCACTGCTCCCTACACCGCGTAAGTATCTTCTT Direct Gain 0 0.538891315460205 Functional Gain 0.538891315460205 PROX1 ENSG00000117707 UTR5 Human protein_coding chr1:214161820 chr1:214161820 . . 0 21 hm1A_associated_SNPs_5419 0 25961943 Triglycerides 4e-10 GWAS_Catalog TagSNP rs340839 GCST002897 The impact of low-frequency and rare variants on lipid levels.
27 chr1 218617543 218617543 1 + G A rs6704255 218617543 + 218617523 218617563 41 ATAGAAGAAATCCCTGTGCCGTCTTTTTATTCCCTTATTTA ATAGAAGAAATCCCTGTGCCATCTTTTTATTCCCTTATTTA Direct Gain 0 0.849014103412628 Functional Gain 0.849014103412628 MIR548F3 ENSG00000092969 UTR3 Human protein_coding chr1:218617543 chr1:218617543 . . 0 21 hm1A_associated_SNPs_5433 1 26634245 Post bronchodilator FEV1/FVC ratio 5e-07 GWAS_Catalog TagSNP rs6704255 GCST003264 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
28 chr1 221057662 221057662 1 + G A rs3738182 221057662 + 221057642 221057682 41 GCCCCGGCTGCGGATGGCGAGCAGGACGAGAGGAGCCCCAG GCCCCGGCTGCGGATGGCGAACAGGACGAGAGGAGCCCCAG Direct Gain 0 0.665810167789459 Functional Gain 0.665810167789459 HLX ENSG00000136630 CDS Human protein_coding chr1:221057662 chr1:221057662 synonymous SNV . 0 21 hm1A_associated_SNPs_5450 0 30595370 White blood cell count 4e-08 GWAS_Catalog TagSNP rs3738182 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
29 chr1 236229347 236229347 1 + C A rs12093542 236229347 + 236229327 236229367 41 GAATAATCGGTTGATCGTTACTTTGGCACTAGGGTGAAAGT GAATAATCGGTTGATCGTTAATTTGGCACTAGGGTGAAAGT Direct Gain 0 0.759691834449768 Functional Gain 0.759691834449768 NID1 ENSG00000116962 upstream Human protein_coding chr1:236229347 chr1:236229347 . . 0 21 hm1A_associated_SNPs_5682 0 17554300 Multiple complex diseases 2.73729e-06 Johnson and O'Donnell TagSNP rs12093542 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
30 chr2 3392075 3392075 1 + T A rs10865541 3392075 + 3392055 3392095 41 TCGGACTTCTTCGACTCCTTTACTACCTCCGCCTTCATTTC TCGGACTTCTTCGACTCCTTAACTACCTCCGCCTTCATTTC Direct Gain 0 0.977106153964996 Functional Gain 0.977106153964996 TRAPPC12 ENSG00000171853 CDS Human protein_coding chr2:3392075 chr2:3392075 nonsynonymous SNV 0.794 4 21 hm1A_associated_SNPs_5832 0 23251661 Obesity-related traits 6e-06 GWAS_Catalog TagSNP rs10865541 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
31 chr2 27315252 27315252 1 + G A rs2304681 27315252 + 27315232 27315272 41 ACGCGTCCAACTCCTGCACCGTTCTCTCCCTGCTCGGAGCC ACGCGTCCAACTCCTGCACCATTCTCTCCCTGCTCGGAGCC Direct Gain 0 0.996198773384094 Functional Gain 0.996198773384094 KHK ENSG00000138030 CDS Human protein_coding chr2:27315252 chr2:27315252 nonsynonymous SNV 0.668 0 21 hm1A_associated_SNPs_5995 1 30181555 Self-reported risk-taking behaviour 1e-07 GWAS_Catalog TagSNP rs2304681 GCST006461 Genetics of self-reported risk-taking behaviour, trans-ethnic consistency and relevance to brain gene expression.
32 chr2 27801418 27801418 1 + C A rs1919126 27801418 + 27801398 27801438 41 ATGTACTCAAGTGAAGTCTGCAGAATTAACCTCACCGCAAA ATGTACTCAAGTGAAGTCTGAAGAATTAACCTCACCGCAAA Direct Gain 0 0.658704459667206 Functional Gain 0.658704459667206 C2orf16 ENSG00000221843 CDS Human protein_coding chr2:27801418 chr2:27801418 nonsynonymous SNV 0.551 0 21 hm1A_associated_SNPs_6022 0 27618448 Mean arterial pressure 9e-06 GWAS_Catalog TagSNP rs1919126 GCST006231 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
33 chr2 44066247 44066247 1 + G A rs11887534 44066247 + 44066227 44066267 41 CGAAAGGGGCCACTCCCCAGGATACCTCGGTGAGTGAGCAA CGAAAGGGGCCACTCCCCAGAATACCTCGGTGAGTGAGCAA Direct Gain 0 0.753201246261597 Functional Gain 0.753201246261597 ABCG8 ENSG00000143921 CDS Human protein_coding chr2:44066247 chr2:44066247 nonsynonymous SNV 0.045 1 21 hm1A_associated_SNPs_6095 0 27286809 C-reactive protein levels or LDL-cholesterol levels (pleiotropy) 9e-33 GWAS_Catalog TagSNP rs11887534 GCST003679 Bivariate genome-wide association study identifies novel pleiotropic loci for lipids and inflammation.
34 chr2 44099433 44099433 1 + C A rs4148217 44099433 + 44099413 44099453 41 TGGGGCGGTGCAGCAGTTTACGACGCTGATCCGGTAATTAT TGGGGCGGTGCAGCAGTTTAAGACGCTGATCCGGTAATTAT Direct Gain 0 0.831076622009277 Functional Gain 0.831076622009277 ABCG8 ENSG00000143921 CDS Human protein_coding chr2:44099433 chr2:44099433 nonsynonymous SNV 0.375 0 21 hm1A_associated_SNPs_6098 2 17632509 Gallstone disease 0.02 Johnson and O'Donnell TagSNP rs4148217 . A genome-wide association scan identifies the hepatic cholesterol transporter ABCG8 as a susceptibility factor for human gallstone disease.
35 chr2 103149100 103149100 1 + G A rs1014286 103149100 + 103149080 103149120 41 GGACAGCTGACCATGGACACGGCAGGGACCATCACAGGTCC GGACAGCTGACCATGGACACAGCAGGGACCATCACAGGTCC Direct Gain 0 0.523451089859009 Functional Gain 0.523451089859009 SLC9A4 ENSG00000180251 CDS Human protein_coding chr2:103149100 chr2:103149100 nonsynonymous SNV 0.003 0 21 hm1A_associated_SNPs_6488 0 23999434 Serum protein levels (sST2) 3e-33 GWAS_Catalog TagSNP rs1014286 GCST002166 Common genetic variation at the IL1RL1 locus regulates IL-33/ST2 signaling.
36 chr2 162280748 162280748 1 + G A rs890076 162280748 + 162280728 162280768 41 CGCACAGCTAGGCCGCCCCTGCCCGCCCGGCCCCGCCGCGG CGCACAGCTAGGCCGCCCCTACCCGCCCGGCCCCGCCGCGG Direct Gain 0 0.572424530982971 Functional Gain 0.572424530982971 TBR1 ENSG00000251621 ncRNA_exonic Human 3prime_overlapping_ncRNA chr2:162280748 chr2:162280748 . . 0 21 hm1A_associated_SNPs_6752 0 30038396 Highest math class taken (MTAG) 2e-08 GWAS_Catalog TagSNP rs890076 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
37 chr2 219755011 219755011 1 + T A rs121908120 219755011 + 219754991 219755031 41 GGGAGCGCTTTTCTAAGGACTTTCTGGACTCCCGGGAGCCT GGGAGCGCTTTTCTAAGGACATTCTGGACTCCCGGGAGCCT Direct Gain 0 0.853904366493225 Functional Gain 0.853904366493225 WNT10A ENSG00000135925 CDS Human protein_coding chr2:219755011 chr2:219755011 nonsynonymous SNV 0.999 5 21 hm1A_associated_SNPs_7071 6 29364747 Tooth agenesis 2e-40 GWAS_Catalog TagSNP rs121908120 GCST005389 Rare and Common Variants Conferring Risk of Tooth Agenesis.
38 chr2 223917983 223917983 1 + T A rs12621643 223917983 + 223917963 223918003 41 CAGGAGGAGGGGGCAGACGATGAGCTGGAGGAGACCTCGGA CAGGAGGAGGGGGCAGACGAAGAGCTGGAGGAGACCTCGGA Direct Gain 0 0.73813670873642 Functional Gain 0.73813670873642 KCNE4 ENSG00000152049 CDS Human protein_coding chr2:223917983 chr2:223917983 nonsynonymous SNV 0.961 0 21 hm1A_associated_SNPs_7154 0 19684603 Acute lymphoblastic leukemia (childhood) 3e-06 GWAS_Catalog TagSNP rs12621643 GCST000464 Germline genomic variants associated with childhood acute lymphoblastic leukemia.
39 chr2 234113301 234113301 1 + C A rs9247 234113301 + 234113281 234113321 41 GCGACAACACCGAGCTCCCGCATCACGGCAAGCACCGGCCG GCGACAACACCGAGCTCCCGAATCACGGCAAGCACCGGCCG Direct Gain 0 0.760066032409668 Functional Gain 0.760066032409668 INPP5D ENSG00000168918 CDS Human protein_coding chr2:234113301 chr2:234113301 nonsynonymous SNV 0.126 4 21 hm1A_associated_SNPs_7256 0 30595370 Eczema 1e-14 GWAS_Catalog TagSNP rs9247 GCST007075 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
40 chr2 234627608 234627608 1 + T A rs2011425 234627608 + 234627588 234627628 41 GGCTCAGCATGCGGGAGGCCTTGCGGGAGCTCCATGCCAGA GGCTCAGCATGCGGGAGGCCATGCGGGAGCTCCATGCCAGA Direct Gain 0 0.990444421768188 Functional Gain 0.990444421768188 UGT1A4 ENSG00000244474 CDS Human protein_coding chr2:234627608 chr2:234627608 nonsynonymous SNV 0.012 1 21 hm1A_associated_SNPs_7269 0 30922102 Plasma norclozapine levels in treatment-resistant schizophrenia 8e-09 GWAS_Catalog TagSNP rs2011425 GCST007686 Pharmacogenomic Variants and Drug Interactions Identified Through the Genetic Analysis of Clozapine Metabolism.
41 chr2 238990388 238990388 1 + G A rs3210400 238990388 + 238990368 238990408 41 TGTCCAAGGTGAGCGGGCAGGCAGAGGTGGACGACATCCTC TGTCCAAGGTGAGCGGGCAGACAGAGGTGGACGACATCCTC Direct Gain 0 0.747575163841248 Functional Gain 0.747575163841248 SCLY ENSG00000132330 CDS Human protein_coding chr2:238990388 chr2:238990388 nonsynonymous SNV 0.038 0 21 hm1A_associated_SNPs_7331 0 30038396 Highest math class taken 1e-12 GWAS_Catalog TagSNP rs3210400 GCST006574 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
42 chr2 242012729 242012729 1 + G A rs6721345 242012729 + 242012709 242012749 41 CATGGAGGAAGCCCCCAAGCGGGTCAGCCTGGCCCTCCAGC CATGGAGGAAGCCCCCAAGCAGGTCAGCCTGGCCCTCCAGC Direct Gain 0 0.550187826156616 Functional Gain 0.550187826156616 SNED1 ENSG00000162804 CDS Human protein_coding chr2:242012729 chr2:242012729 nonsynonymous SNV 0.091 1 21 hm1A_associated_SNPs_7423 0 22675492 Sex hormone-binding globulin levels 3e-06 GWAS_Catalog TagSNP rs6721345 GCST001554 Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women.
43 chr3 8608920 8608920 1 + G A rs171408 8608920 + 8608900 8608940 41 TGGAGGATTTTTTTTATTCCGTCTGAGAAGCTAAGATGCAA TGGAGGATTTTTTTTATTCCATCTGAGAAGCTAAGATGCAA Direct Gain 0 0.96715772151947 Functional Gain 0.96715772151947 LMCD1 ENSG00000227110 ncRNA_intronic Human antisense chr3:8608920 chr3:8608920 . . 0 21 hm1A_associated_SNPs_7479 0 26301497 Mitral valve prolapse 1e-11 GWAS_Catalog TagSNP rs171408 GCST003094 Genetic association analyses highlight biological pathways underlying mitral valve prolapse.
44 chr3 51747288 51747288 1 + G A rs116567227 51747288 + 51747268 51747308 41 GCGGCCAGTTAACGGGCGCCGCCTCTACAAGGACTTTGTGC GCGGCCAGTTAACGGGCGCCACCTCTACAAGGACTTTGTGC Direct Gain 0 0.982847809791565 Functional Gain 0.982847809791565 GRM2 ENSG00000164082 CDS Human protein_coding chr3:51747288 chr3:51747288 nonsynonymous SNV 0.990 3 21 hm1A_associated_SNPs_7874 0 27989323 Macrophage inflammatory protein 1b levels 5e-10 GWAS_Catalog TagSNP rs116567227 GCST004433 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
45 chr3 57994398 57994398 1 + G A rs142568031 57994398 + 57994378 57994418 41 CCTCAAGTGCGTGAACAAACGCATCGGCAACCTGCAGACCG CCTCAAGTGCGTGAACAAACACATCGGCAACCTGCAGACCG Direct Gain 0 0.528846800327301 Functional Gain 0.528846800327301 FLNB ENSG00000136068 CDS Human protein_coding chr3:57994398 chr3:57994398 nonsynonymous SNV 0.999 5 21 hm1A_associated_SNPs_7925 0 31217584 Height 5e-11 GWAS_Catalog TagSNP rs142568031 GCST008053 Genetic analyses of diverse populations improves discovery for complex traits.
46 chr3 58292131 58292131 1 + C A rs17059150 58292131 + 58292111 58292151 41 TGGTCAGGCGTCAGGCTAGTCCGACGAAGAGTGGGTAGGTG TGGTCAGGCGTCAGGCTAGTACGACGAAGAGTGGGTAGGTG Direct Gain 0 0.915395617485046 Functional Gain 0.915395617485046 HTD2;RPP14 ENSG00000163684 UTR5 Human protein_coding chr3:58292131 chr3:58292131 . . 0 21 hm1A_associated_SNPs_7933 0 17554300 Multiple complex diseases 0.000735845 Johnson and O'Donnell TagSNP rs17059150 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
47 chr3 111732608 111732608 1 + G A rs8070 111732608 + 111732588 111732628 41 TATGCAAAGACTCCGCTTCCGTTTTCCTGAGCTCCTCGGGC TATGCAAAGACTCCGCTTCCATTTTCCTGAGCTCCTCGGGC Direct Gain 0 0.993184626102448 Functional Gain 0.993184626102448 TAGLN3 ENSG00000144834 UTR3 Human protein_coding chr3:111732608 chr3:111732608 . . 0 21 hm1A_associated_SNPs_8035 0 17463246 Multiple continuous traits in DGI samples 0.0004057 Johnson and O'Donnell TagSNP rs8070 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
48 chr3 122003045 122003045 1 + G A rs2036400 122003045 + 122003025 122003065 41 TGGCTCTACACCGCGCCCCCGTCAAGCTACCGCAACCAGGA TGGCTCTACACCGCGCCCCCATCAAGCTACCGCAACCAGGA Direct Gain 0 0.958679556846619 Functional Gain 0.958679556846619 CASR ENSG00000036828 CDS Human protein_coding chr3:122003045 chr3:122003045 synonymous SNV . 0 21 hm1A_associated_SNPs_8078 0 17554300 Multiple complex diseases 6.42429e-05 Johnson and O'Donnell TagSNP rs2036400 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
49 chr3 124351316 124351316 1 + G A rs1708303 124351316 + 124351296 124351336 41 GGAGGCAAGTCCGAGTCCGTGGCCAACCTGCAGGCCCAGCC GGAGGCAAGTCCGAGTCCGTAGCCAACCTGCAGGCCCAGCC Direct Gain 0 0.699447154998779 Functional Gain 0.699447154998779 KALRN ENSG00000160145 CDS Human protein_coding chr3:124351316 chr3:124351316 synonymous SNV . 0 21 hm1A_associated_SNPs_8096 0 17554300 Multiple complex diseases 9.3848e-05 Johnson and O'Donnell TagSNP rs1708303 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
50 chr3 126261202 126261202 1 + G A rs1056524 126261202 + 126261182 126261222 41 GTCGTGGGCAAGTTCGAGACGCTGGCGGAGGACGCGGCCTT GTCGTGGGCAAGTTCGAGACACTGGCGGAGGACGCGGCCTT Direct Gain 0 0.974822580814362 Functional Gain 0.974822580814362 CHST13 ENSG00000180767 CDS Human protein_coding chr3:126261202 chr3:126261202 synonymous SNV 0.284 0 21 hm1A_associated_SNPs_8112 0 29875488 Blood protein levels 8e-26 GWAS_Catalog TagSNP rs1056524 GCST005806 Genomic atlas of the human plasma proteome.
51 chr3 135974216 135974216 1 + G A rs9844666 135974216 + 135974196 135974236 41 GAGAAGAACCAGGAAGTAGCGTGTCCTTGAGGTGGGAGCTG GAGAAGAACCAGGAAGTAGCATGTCCTTGAGGTGGGAGCTG Direct Gain 0 0.623393952846527 Functional Gain 0.623393952846527 PCCB ENSG00000114054 UTR5 Human protein_coding chr3:135974216 chr3:135974216 . . 0 21 hm1A_associated_SNPs_8236 0 20881960 Height 4e-09 GWAS_Catalog TagSNP rs9844666 GCST000817 Hundreds of variants clustered in genomic loci and biological pathways affect human height.
52 chr3 150128392 150128392 1 + G A rs879634 150128392 + 150128372 150128412 41 CCGTGGGCACCGGCCAGAATGCTTCCTCGGTGGGCGCGCAG CCGTGGGCACCGGCCAGAATACTTCCTCGGTGGGCGCGCAG Direct Gain 0 0.543737590312958 Functional Gain 0.543737590312958 TSC22D2 ENSG00000196428 CDS Human protein_coding chr3:150128392 chr3:150128392 nonsynonymous SNV 0.001 0 21 hm1A_associated_SNPs_8304 0 27618447 Systolic blood pressure 8e-06 GWAS_Catalog TagSNP rs879634 GCST006021 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
53 chr3 186395436 186395436 1 + C A rs1042445 186395436 + 186395416 186395456 41 GAGGCCCAGGTAAAGGACCCCGTCCCTTCCATTGCAGACAA GAGGCCCAGGTAAAGGACCCAGTCCCTTCCATTGCAGACAA Direct Gain 0 0.747531890869141 Functional Gain 0.747531890869141 HRG ENSG00000113905 CDS Human protein_coding chr3:186395436 chr3:186395436 nonsynonymous SNV 0.001 0 21 hm1A_associated_SNPs_8456 0 28240269 Blood protein levels 8e-78 GWAS_Catalog TagSNP rs1042445 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
54 chr4 996165 996165 1 + G A rs6831280 996165 + 996145 996185 41 GCTACCACCCGCACCCCTTCGCGCAGCGCACGCTCACCGCG GCTACCACCCGCACCCCTTCACGCAGCGCACGCTCACCGCG Direct Gain 0 0.661182284355164 Functional Gain 0.661182284355164 IDUA ENSG00000127415 CDS Human protein_coding chr4:996165 chr4:996165 nonsynonymous SNV 0.019 1 21 hm1A_associated_SNPs_8596 2 29304378 Total body bone mineral density 8e-19 GWAS_Catalog TagSNP rs6831280 GCST005348 Life-Course Genome-wide Association Study Meta-analysis of Total Body BMD and Assessment of Age-Specific Effects.
55 chr4 20620683 20620683 1 + G A rs1379659 20620683 + 20620663 20620703 41 AGGTTGTATACTTCTTGACCGTGTGGGACTAATGAATGCTT AGGTTGTATACTTCTTGACCATGTGGGACTAATGAATGCTT Direct Gain 0 0.529375731945038 Functional Gain 0.529375731945038 SLIT2 ENSG00000145147 UTR3 Human protein_coding chr4:20620683 chr4:20620683 . . 0 21 hm1A_associated_SNPs_8988 0 17903301 Echocardiographic traits 1e-07 GWAS_Catalog TagSNP rs1379659 GCST000110 Genome-wide association of echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Heart Study.
56 chr4 39529700 39529700 1 + G A rs3755899 39529700 + 39529680 39529720 41 CCCACAACCTCGAGGCCCCGGGGTCAACCGCGCCCTCCGGG CCCACAACCTCGAGGCCCCGAGGTCAACCGCGCCCTCCGGG Direct Gain 0 0.968657612800598 Functional Gain 0.968657612800598 UGDH-AS1 ENSG00000249348 ncRNA_exonic Human antisense chr4:39529700 chr4:39529700 . . 0 21 hm1A_associated_SNPs_9047 0 27082954 Peripheral arterial disease (traffic-related air pollution interaction) 2e-08 GWAS_Catalog TagSNP rs3755899 GCST004482 Genetic Variants in the Bone Morphogenic Protein Gene Family Modify the Association between Residential Exposure to Traffic and Peripheral Arterial Disease.
57 chr4 71859680 71859680 1 + G A rs9997790 71859680 + 71859660 71859700 41 AATGTGGGACGCAAGGCTGGGGTGTCGCGGCAGTGGCTGAA AATGTGGGACGCAAGGCTGGAGTGTCGCGGCAGTGGCTGAA Direct Gain 0 0.988166093826294 Functional Gain 0.988166093826294 DCK ENSG00000156136 CDS Human protein_coding chr4:71859680 chr4:71859680 nonsynonymous SNV . 0 21 hm1A_associated_SNPs_9155 0 30595370 Red cell distribution width 4e-08 GWAS_Catalog TagSNP rs9997790 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
58 chr4 72316967 72316967 1 + G A rs148635969 72316967 + 72316947 72316987 41 GGATACGCCCCATGATGGAGGTCACGGAGGAGGAGGACATG GGATACGCCCCATGATGGAGATCACGGAGGAGGAGGACATG Direct Gain 0 0.990088701248169 Functional Gain 0.990088701248169 SLC4A4 ENSG00000080493 CDS Human protein_coding chr4:72316967 chr4:72316967 nonsynonymous SNV 0.977 3 21 hm1A_associated_SNPs_9157 1 24951543 Age-related nuclear cataracts 8e-06 GWAS_Catalog TagSNP rs148635969 GCST002498 Meta-analysis of genome-wide association studies in multiethnic Asians identifies two loci for age-related nuclear cataract.
59 chr4 74361142 74361142 1 + G A rs41265665 74361142 + 74361122 74361162 41 AAACCCTCCAGGTTGTTACCGTTACGCGGTAGGTTCCATTG AAACCCTCCAGGTTGTTACCATTACGCGGTAGGTTCCATTG Direct Gain 0 0.514247059822083 Functional Gain 0.514247059822083 AFM ENSG00000079557 CDS Human protein_coding chr4:74361142 chr4:74361142 nonsynonymous SNV 0.178 0 21 hm1A_associated_SNPs_9159 0 28240269 Blood protein levels 3e-12 GWAS_Catalog TagSNP rs41265665 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
60 chr4 77955205 77955205 1 + T A rs17002342 77955205 + 77955185 77955225 41 TCCCTAAACTGCTTTAGACCTTTTCTTCAAGTCAATTGTAC TCCCTAAACTGCTTTAGACCATTTCTTCAAGTCAATTGTAC Direct Gain 0 0.981761813163757 Functional Gain 0.981761813163757 SEPT11 ENSG00000138758 intronic Human protein_coding chr4:77955205 chr4:77955205 . . 0 21 hm1A_associated_SNPs_9192 0 23192594 Waist-to-hip circumference ratio (alcohol intake interaction) 9e-06 GWAS_Catalog TagSNP rs17002342 GCST004579 Gene-environment interactions and obesity traits among postmenopausal African-American and Hispanic women in the Women's Health Initiative SHARe Study.
61 chr4 79697870 79697870 1 + C A rs149914551 79697870 + 79697850 79697890 41 CACCCTGGAAGAGTCGCTGGCCGAAGGTACGGGCGCCCGGG CACCCTGGAAGAGTCGCTGGACGAAGGTACGGGCGCCCGGG Direct Gain 0 0.599259734153748 Functional Gain 0.599259734153748 BMP2K ENSG00000138756 CDS Human protein_coding chr4:79697870 chr4:79697870 nonsynonymous SNV 0.993 3 21 hm1A_associated_SNPs_9204 0 30038396 Educational attainment (MTAG) 7e-09 GWAS_Catalog TagSNP rs149914551 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
62 chr4 88732692 88732692 1 + G A rs1054627 88732692 + 88732672 88732712 41 CGGCAACGGCAGCAGCGGAGGAGACAATGGAGAAGAAGGGG CGGCAACGGCAGCAGCGGAGAAGACAATGGAGAAGAAGGGG Direct Gain 0 0.603661239147186 Functional Gain 0.603661239147186 IBSP ENSG00000029559 CDS Human protein_coding chr4:88732692 chr4:88732692 nonsynonymous SNV 0.413 0 21 hm1A_associated_SNPs_9233 0 21533022 Bone mineral density 8e-07 GWAS_Catalog TagSNP rs1054627 GCST001050 Genome-wide association study using extreme truncate selection identifies novel genes affecting bone mineral density and fracture risk.
63 chr5 72112421 72112421 1 + T A rs34648 72112421 + 72112401 72112441 41 CCAAGGCGACCGCCGCCGAATGTTCCCGCCGCGGGCTCCGC CCAAGGCGACCGCCGCCGAAAGTTCCCGCCGCGGGCTCCGC Direct Gain 0 0.929639101028442 Functional Gain 0.929639101028442 TNPO1 ENSG00000083312 UTR5 Human protein_coding chr5:72112421 chr5:72112421 . . 0 21 hm1A_associated_SNPs_9888 0 30595370 White blood cell count 4e-08 GWAS_Catalog TagSNP rs34648 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
64 chr5 75591710 75591710 1 + C A rs2270927 75591710 + 75591690 75591730 41 AGATAAATATGCAAATTTCACTATTAACTTTACAATGGAAA AGATAAATATGCAAATTTCAATATTAACTTTACAATGGAAA Direct Gain 0 0.562531590461731 Functional Gain 0.562531590461731 SV2C ENSG00000122012 CDS Human protein_coding chr5:75591710 chr5:75591710 nonsynonymous SNV 0.995 1 21 hm1A_associated_SNPs_9914 0 27863252 Mean corpuscular volume 3e-11 GWAS_Catalog TagSNP rs2270927 GCST004602 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
65 chr5 133451683 133451683 1 + C A rs5742913 133451683 + 133451663 133451703 41 TGCTCATGCATTACCCACCCCCCTCGGGAGCAGGGCAGCAC TGCTCATGCATTACCCACCCACCTCGGGAGCAGGGCAGCAC Direct Gain 0 0.850968897342682 Functional Gain 0.850968897342682 TCF7 ENSG00000081059 CDS Human protein_coding chr5:133451683 chr5:133451683 nonsynonymous SNV 0.258 1 21 hm1A_associated_SNPs_10158 0 30595370 Eosinophil counts 1e-16 GWAS_Catalog TagSNP rs5742913 GCST007065 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
66 chr5 154395458 154395458 1 + G A rs17116710 154395458 + 154395438 154395478 41 ACAGTTGAAAGAACGAGACCGTAAGAGGCAATATGAGCTGC ACAGTTGAAAGAACGAGACCATAAGAGGCAATATGAGCTGC Direct Gain 0 0.92768794298172 Functional Gain 0.92768794298172 KIF4B ENSG00000226650 CDS Human protein_coding chr5:154395458 chr5:154395458 nonsynonymous SNV 0.924 3 21 hm1A_associated_SNPs_10597 0 30595370 Mean corpuscular hemoglobin 5e-25 GWAS_Catalog TagSNP rs17116710 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
67 chr5 173491300 173491300 1 + G A rs17076802 173491300 + 173491280 173491320 41 AAAGGGAAGTTCCGGGTGCCGAAAATCGCTGAATTTACGGT AAAGGGAAGTTCCGGGTGCCAAAAATCGCTGAATTTACGGT Direct Gain 0 0.906020283699036 Functional Gain 0.906020283699036 HMP19 ENSG00000170091 CDS Human protein_coding chr5:173491300 chr5:173491300 synonymous SNV . 0 21 hm1A_associated_SNPs_10679 0 16252231 Parkinson's disease 0.011171 Johnson and O'Donnell TagSNP rs17076802 . High-resolution whole-genome association study of Parkinson disease.
68 chr5 176520243 176520243 1 + G A rs351855 176520243 + 176520223 176520263 41 CTGTGCTCCTGCTGCTGGCCGGGCTGTATCGAGGGCAGGCG CTGTGCTCCTGCTGCTGGCCAGGCTGTATCGAGGGCAGGCG Direct Gain 0 0.79144811630249 Functional Gain 0.79144811630249 FGFR4 ENSG00000160867 CDS Human protein_coding chr5:176520243 chr5:176520243 nonsynonymous SNV 0.845 2 21 hm1A_associated_SNPs_10728 1 26785701 Waist-to-hip ratio adjusted for body mass index 2e-06 GWAS_Catalog TagSNP rs351855 GCST003338 Genome-wide association studies in East Asians identify new loci for waist-hip ratio and waist circumference.
69 chr6 7231843 7231843 1 + G A rs9379084 7231843 + 7231823 7231863 41 GCGCCAACAGCGGCGGGGTGGACCTGGACTCCAGCGGGGAG GCGCCAACAGCGGCGGGGTGAACCTGGACTCCAGCGGGGAG Direct Gain 0 0.622281610965729 Functional Gain 0.622281610965729 RREB1 ENSG00000124782 CDS Human protein_coding chr6:7231843 chr6:7231843 nonsynonymous SNV 0.974 4 21 hm1A_associated_SNPs_10879 0 28869591 Heel bone mineral density 6e-09 GWAS_Catalog TagSNP rs9379084 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
70 chr6 7581636 7581636 1 + G A rs6929069 7581636 + 7581616 7581656 41 CGATGACCTGAGGAGAGGACGAAGCGAAGCGGACAGTGATA CGATGACCTGAGGAGAGGACAAAGCGAAGCGGACAGTGATA Direct Gain 0 0.798600792884827 Functional Gain 0.798600792884827 DSP ENSG00000096696 CDS Human protein_coding chr6:7581636 chr6:7581636 nonsynonymous SNV 0.272 0 21 hm1A_associated_SNPs_10894 6 16252231 Parkinson's disease 0.009899 Johnson and O'Donnell TagSNP rs6929069 . High-resolution whole-genome association study of Parkinson disease.
71 chr6 26184102 26184102 1 + G A rs7766641 26184102 + 26184082 26184122 41 CCAAGGCGCAGAAGAAGGACGGCAAGAAGCGCAAGCGCAGC CCAAGGCGCAGAAGAAGGACAGCAAGAAGCGCAAGCGCAGC Direct Gain 0 0.852976679801941 Functional Gain 0.852976679801941 HIST1H2BE ENSG00000197697 CDS Human other chr6:26184102 chr6:26184102 nonsynonymous SNV 0.912 0 21 hm1A_associated_SNPs_11013 0 28552196 Height 1e-18 GWAS_Catalog TagSNP rs7766641 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
72 chr6 26272548 26272548 1 + G A rs61747867 26272548 + 26272528 26272568 41 CGAGCTGCAGGCGTCGGGGGGTGACGCGGGTCTTCTTGTCT CGAGCTGCAGGCGTCGGGGGATGACGCGGGTCTTCTTGTCT Direct Gain 0 0.919676423072815 Functional Gain 0.919676423072815 HIST1H2BI;HIST1H3G ENSG00000218690 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr6:26272548 chr6:26272548 . . 0 21 hm1A_associated_SNPs_11017 0 28540026 Autism spectrum disorder or schizophrenia 2e-09 GWAS_Catalog TagSNP rs61747867 GCST004521 Meta-analysis of GWAS of over 16,000 individuals with autism spectrum disorder highlights a novel locus at 10q24.32 and a significant overlap with schizophrenia.
73 chr6 26569135 26569135 1 + T A rs36162392 26569135 + 26569115 26569155 41 GACTGTAGTTGGCTGTGTCCTTAGACATCCTTAGGTCGCTG GACTGTAGTTGGCTGTGTCCATAGACATCCTTAGGTCGCTG Direct Gain 0 0.986644208431244 Functional Gain 0.986644208431244 LOC105374988 ENSG00000182952;ENSG00000146109 intergenic Human other chr6:26569135 chr6:26569135 . . 0 21 hm1A_associated_SNPs_11039 0 28604730 Lung cancer in ever smokers 6e-07 GWAS_Catalog TagSNP rs36162392 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
74 chr6 29364951 29364951 1 + G A rs2073151 29364951 + 29364931 29364971 41 TCCATGCCCTGCTGCACTCCGTAATGACTTCTCGCTTGAAC TCCATGCCCTGCTGCACTCCATAATGACTTCTCGCTTGAAC Direct Gain 0 0.994175136089325 Functional Gain 0.994175136089325 OR12D2 ENSG00000168787 CDS Human other chr6:29364951 chr6:29364951 nonsynonymous SNV 0.000 0 21 hm1A_associated_SNPs_11103 0 17554300 Multiple complex diseases 1.3e-11 Johnson and O'Donnell TagSNP rs2073151 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
75 chr6 29910759 29910759 1 + T A rs1071742 29910759 + 29910739 29910779 41 CCAGTCACAGACTGACCGAGTGGACCTGGGGACCCTGCGCG CCAGTCACAGACTGACCGAGAGGACCTGGGGACCCTGCGCG Direct Gain 0 0.980751156806946 Functional Gain 0.980751156806946 HLA-A ENSG00000206503 CDS Human protein_coding chr6:29910759 chr6:29910759 nonsynonymous SNV 0.000 0 21 hm1A_associated_SNPs_11184 0 30048462 Heel bone mineral density 2e-17 GWAS_Catalog TagSNP rs1071742 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
76 chr6 30231224 30231224 1 + G A rs3094073 30231224 + 30231204 30231244 41 AGAGATGAATTTTCAAGCCCGTGCAGCTTTTACCCTATTTC AGAGATGAATTTTCAAGCCCATGCAGCTTTTACCCTATTTC Direct Gain 0 0.953565239906311 Functional Gain 0.953565239906311 HLA-L ENSG00000243753 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr6:30231224 chr6:30231224 . . 0 21 hm1A_associated_SNPs_11222 0 17632545 Type I Diabetes 1.67e-11 Johnson and O'Donnell TagSNP rs3094073 . A genome-wide association study identifies KIAA0350 as a type 1 diabetes gene.
77 chr6 30234721 30234721 1 + G A rs3129705 30234721 + 30234701 30234741 41 CTTGCTAGGATTAAAAACCCGTATCTGTAAGACATCAGAGG CTTGCTAGGATTAAAAACCCATATCTGTAAGACATCAGAGG Direct Gain 0 0.972037076950073 Functional Gain 0.972037076950073 HLA-L ENSG00000243753 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr6:30234721 chr6:30234721 . . 0 21 hm1A_associated_SNPs_11223 0 17554300 Multiple complex diseases 2.37e-11 Johnson and O'Donnell TagSNP rs3129705 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
78 chr6 31093482 31093482 1 + G A rs3131003 31093482 + 31093462 31093502 41 AAGGGTGGAATCTACAGTCCGTGAGCCCTGACTTCTTGCCT AAGGGTGGAATCTACAGTCCATGAGCCCTGACTTCTTGCCT Direct Gain 0 0.99760913848877 Functional Gain 0.99760913848877 PSORS1C1 ENSG00000204540 UTR5 Human protein_coding chr6:31093482 chr6:31093482 . . 0 21 hm1A_associated_SNPs_11258 0 17641165 HIV-1 disease progression 1.38e-05 Johnson and O'Donnell TagSNP rs3131003 . A whole-genome association study of major determinants for host control of HIV-1.
79 chr6 31093587 31093587 1 + G A rs3815087 31093587 + 31093567 31093607 41 GAAACCATCACCCCCGGACCGTGGGCTCCATGCCAGTGGGC GAAACCATCACCCCCGGACCATGGGCTCCATGCCAGTGGGC Direct Gain 0 0.984296083450317 Functional Gain 0.984296083450317 PSORS1C1 ENSG00000204540 UTR5 Human protein_coding chr6:31093587 chr6:31093587 . . 0 21 hm1A_associated_SNPs_11259 0 21801394 Drug-induced Stevens-Johnson syndrome or toxic epidermal necrolysis (SJS/TEN) 3e-07 GWAS_Catalog TagSNP rs3815087 GCST001181 Genome-wide association study of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis in Europe.
80 chr6 31915144 31915144 1 + G A rs4151669 31915144 + 31915124 31915164 41 GCGGGGTACTGCTCCAACCCGGGCATCCCCATTGGCACAAG GCGGGGTACTGCTCCAACCCAGGCATCCCCATTGGCACAAG Direct Gain 0 0.539473533630371 Functional Gain 0.539473533630371 CFB ENSG00000243649;ENSG00000244255 CDS Human other chr6:31915144 chr6:31915144 synonymous SNV . 0 21 hm1A_associated_SNPs_11295 3 28240269 Blood protein levels 6e-28 GWAS_Catalog TagSNP rs4151669 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
81 chr6 31996524 31996524 1 + C A rs406658 31996524 + 31996504 31996544 41 GCCCAGGAGCAGGTAGGAGGCTCGCCTGAGAAACTGCAGGA GCCCAGGAGCAGGTAGGAGGATCGCCTGAGAAACTGCAGGA Direct Gain 0 0.922757387161255 Functional Gain 0.922757387161255 C4B;C4B_2 ENSG00000224389 CDS Human protein_coding chr6:31996524 chr6:31996524 synonymous SNV . 0 21 hm1A_associated_SNPs_11308 0 29875488 Blood protein levels 3e-52 GWAS_Catalog TagSNP rs406658 GCST005806 Genomic atlas of the human plasma proteome.
82 chr6 32122472 32122472 1 + C A rs3096696 32122472 + 32122452 32122492 41 AGCCCCCGCGCCCCACCGCGCGTCCTACAAGCCGGTCATCG AGCCCCCGCGCCCCACCGCGAGTCCTACAAGCCGGTCATCG Direct Gain 0 0.963284552097321 Functional Gain 0.963284552097321 PPT2 ENSG00000221988;ENSG00000258388 CDS Human other chr6:32122472 chr6:32122472 nonsynonymous SNV 0.852 1 21 hm1A_associated_SNPs_11312 0 25987655 Asparaginase hypersensitivity in acute lymphoblastic leukemia 4e-06 GWAS_Catalog TagSNP rs3096696 GCST002915 Genome-wide analysis links NFATC2 with asparaginase hypersensitivity.
83 chr6 32412592 32412592 1 + G A rs1051336 32412592 + 32412572 32412612 41 TATGCCTCTTCGATTGCTCCGTACTCTAACATCTAGCTGGC TATGCCTCTTCGATTGCTCCATACTCTAACATCTAGCTGGC Direct Gain 0 0.713583469390869 Functional Gain 0.713583469390869 HLA-DRA ENSG00000204287 UTR3 Human protein_coding chr6:32412592 chr6:32412592 . . 0 21 hm1A_associated_SNPs_11315 0 29857070 Pemphigus vulgaris 3e-06 GWAS_Catalog TagSNP rs1051336 GCST006584 Association study and fine-mapping major histocompatibility complex analysis of pemphigus vulgaris in a Han Chinese population.
84 chr6 43970827 43970827 1 + G A rs2295334 43970827 + 43970807 43970847 41 CCACCGCCGCTGTCATCCGCGGCGCTCCGCGGCGCTGGGCC CCACCGCCGCTGTCATCCGCAGCGCTCCGCGGCGCTGGGCC Direct Gain 0 0.655327796936035 Functional Gain 0.655327796936035 C6orf223 ENSG00000181577 CDS Human protein_coding chr6:43970827 chr6:43970827 synonymous SNV . 0 21 hm1A_associated_SNPs_11582 0 25629512 Exudative age-related macular degeneration 6e-18 GWAS_Catalog TagSNP rs2295334 GCST002766 New loci and coding variants confer risk for age-related macular degeneration in East Asians.
85 chr6 151936677 151936677 1 + G A rs6929137 151936677 + 151936657 151936697 41 CTGAGAAAAAGCTCATGTCTGTCAAGTCAGAACTGGATACC CTGAGAAAAAGCTCATGTCTATCAAGTCAGAACTGGATACC Direct Gain 0 0.776754379272461 Functional Gain 0.776754379272461 CCDC170 ENSG00000120262 CDS Human protein_coding chr6:151936677 chr6:151936677 nonsynonymous SNV 0.483 0 21 hm1A_associated_SNPs_12002 1 19079262 Bone mineral density (spine) 2e-10 GWAS_Catalog TagSNP rs6929137 GCST000295 New sequence variants associated with bone mineral density.
86 chr6 161132830 161132830 1 + G A rs1830519 161132830 + 161132810 161132850 41 GGACTGAAGTAAGCATATCAGGTTAGAACTCTCATCACATG GGACTGAAGTAAGCATATCAAGTTAGAACTCTCATCACATG Direct Gain 0 0.503820598125458 Functional Gain 0.503820598125458 PLG ENSG00000122194 UTR3 Human protein_coding chr6:161132830 chr6:161132830 . . 0 21 hm1A_associated_SNPs_12110 0 17554300 Multiple complex diseases 1.79089e-07 Johnson and O'Donnell TagSNP rs1830519 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
87 chr7 2754118 2754118 1 + G A rs56399783 2754118 + 2754098 2754138 41 TTGCGTAGCTTCAAAAAGGCGTAACAGTGACCTGGGAGGGG TTGCGTAGCTTCAAAAAGGCATAACAGTGACCTGGGAGGGG Direct Gain 0 0.880397081375122 Functional Gain 0.880397081375122 AMZ1 ENSG00000174945 UTR3 Human protein_coding chr7:2754118 chr7:2754118 . . 0 21 hm1A_associated_SNPs_12359 0 28928442 Childhood ear infection 5e-06 GWAS_Catalog TagSNP rs56399783 GCST005013 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
88 chr7 5880377 5880377 1 + G A rs308097 5880377 + 5880357 5880397 41 TCAGCACAAATCCTTTAACCGTTTCTCCCCAAGAGGGTGTC TCAGCACAAATCCTTTAACCATTTCTCCCCAAGAGGGTGTC Direct Gain 0 0.978743016719818 Functional Gain 0.978743016719818 ZNF815P ENSG00000235944 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr7:5880377 chr7:5880377 . . 0 21 hm1A_associated_SNPs_12442 0 23382691 IgG glycosylation 2e-06 GWAS_Catalog TagSNP rs308097 GCST001848 Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers.
89 chr7 45077978 45077978 1 + G A rs2107732 45077978 + 45077958 45077998 41 TGTTGTCATTGCCTGAGCGCGTCGAGCCAGACAGACTGCTG TGTTGTCATTGCCTGAGCGCATCGAGCCAGACAGACTGCTG Direct Gain 0 0.663666367530823 Functional Gain 0.663666367530823 CCM2 ENSG00000136280 CDS Human protein_coding chr7:45077978 chr7:45077978 nonsynonymous SNV 1.000 1 21 hm1A_associated_SNPs_12754 1 29212778 Coronary artery disease 2e-07 GWAS_Catalog TagSNP rs2107732 GCST005194 Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease.
90 chr7 100701610 100701610 1 + T A rs4729656 100701610 + 100701590 100701630 41 GTACTCTGACTGCAACATCTTTCACCCCATTGATCGCCAGG GTACTCTGACTGCAACATCTATCACCCCATTGATCGCCAGG Direct Gain 0 0.561715841293335 Functional Gain 0.561715841293335 MUC17 ENSG00000222636 ncRNA_exonic Human misc_RNA chr7:100701610 chr7:100701610 . . 0 21 hm1A_associated_SNPs_13205 0 17554300 Multiple complex diseases 9.01e-05 Johnson and O'Donnell TagSNP rs4729656 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
91 chr7 150761314 150761314 1 + G A rs2303929 150761314 + 150761294 150761334 41 GCCAGAGAGCTTGGGCCCTGGGACGCCTGGGTTCCCCGAGC GCCAGAGAGCTTGGGCCCTGAGACGCCTGGGTTCCCCGAGC Direct Gain 0 0.572289347648621 Functional Gain 0.572289347648621 SLC4A2 ENSG00000164889 CDS Human protein_coding chr7:150761314 chr7:150761314 nonsynonymous SNV 0.043 1 21 hm1A_associated_SNPs_13616 0 30038396 Educational attainment (years of education) 4e-08 GWAS_Catalog TagSNP rs2303929 GCST006442 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
92 chr8 8092025 8092025 1 + G A rs2980436 8092025 + 8092005 8092045 41 CACGAGGCTGTCCACACGGAGCCTTTGGATGAGCTGTACGA CACGAGGCTGTCCACACGGAACCTTTGGATGAGCTGTACGA Direct Gain 0 0.583395898342133 Functional Gain 0.583395898342133 FAM86B3P ENSG00000173295 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr8:8092025 chr8:8092025 . . 0 21 hm1A_associated_SNPs_13830 0 28991256 Schizophrenia 2e-08 GWAS_Catalog TagSNP rs2980436 GCST004946 Genome-wide association analysis identifies 30 new susceptibility loci for schizophrenia.
93 chr8 21904126 21904126 1 + G A rs3176295 21904126 + 21904106 21904146 41 TACATCTGTATGAACAAGAGGGGCAAGCTCATCGGGAAGGT TACATCTGTATGAACAAGAGAGGCAAGCTCATCGGGAAGGT Direct Gain 0 0.543926060199738 Functional Gain 0.543926060199738 FGF17 ENSG00000158815 CDS Human protein_coding chr8:21904126 chr8:21904126 synonymous SNV . 0 21 hm1A_associated_SNPs_13983 0 17554300 Multiple complex diseases 7.84324e-05 Johnson and O'Donnell TagSNP rs3176295 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
94 chr8 32405979 32405979 1 + T A rs7820838 32405979 + 32405959 32405999 41 AGGACGCGAGCCGCCAGCGGTGGGACCCATCGACGACTTCC AGGACGCGAGCCGCCAGCGGAGGGACCCATCGACGACTTCC Direct Gain 0 0.623040974140167 Functional Gain 0.623040974140167 NRG1 ENSG00000157168 UTR5 Human protein_coding chr8:32405979 chr8:32405979 . . 0 21 hm1A_associated_SNPs_14120 0 28604730 Lung cancer 4e-06 GWAS_Catalog TagSNP rs7820838 GCST004748 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
95 chr8 128428795 128428795 1 + G A rs6998254 128428795 + 128428775 128428815 41 AAAGCAGAAACCCTCATGCAGGCCCGAAAGAGAAAGCGAAC AAAGCAGAAACCCTCATGCAAGCCCGAAAGAGAAAGCGAAC Direct Gain 0 0.651527047157288 Functional Gain 0.651527047157288 POU5F1B ENSG00000212993 CDS Human protein_coding chr8:128428795 chr8:128428795 synonymous SNV . 0 21 hm1A_associated_SNPs_14476 0 17618284 Colorectal cancer 0.0085 Johnson and O'Donnell TagSNP rs6998254 . A genome-wide association scan of tag SNPs identifies a susceptibility variant for colorectal cancer at 8q24.21.
96 chr9 12775488 12775488 1 + G A rs10491742 12775488 + 12775468 12775508 41 ATCTTGATCATCTTAGTGTCGGAGGAGTCGCAGCGGACTGG ATCTTGATCATCTTAGTGTCAGAGGAGTCGCAGCGGACTGG Direct Gain 0 0.503171384334564 Functional Gain 0.503171384334564 LURAP1L-AS1 ENSG00000235448 ncRNA_intronic Human antisense chr9:12775488 chr9:12775488 . . 0 21 hm1A_associated_SNPs_14759 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0002672 Johnson and O'Donnell TagSNP rs10491742 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
97 chr9 35909518 35909518 1 + G A rs748802 35909518 + 35909498 35909538 41 AGCACCCAGGGAGGAACGCCGTGGTCCCTGGGACGGCCACC AGCACCCAGGGAGGAACGCCATGGTCCCTGGGACGGCCACC Direct Gain 0 0.970322728157043 Functional Gain 0.970322728157043 SPAAR ENSG00000235387 ncRNA_exonic Human protein_coding chr9:35909518 chr9:35909518 . . 0 21 hm1A_associated_SNPs_14864 0 27798624 Resting heart rate 1e-08 GWAS_Catalog TagSNP rs748802 GCST003818 Identification of genomic loci associated with resting heart rate and shared genetic predictors with all-cause mortality.
98 chr9 71789104 71789104 1 + G A rs62567129 71789104 + 71789084 71789124 41 GAGGCGCCACGCTCGGGTCGGGGGCGGGCTGACGCCGCCGC GAGGCGCCACGCTCGGGTCGAGGGCGGGCTGACGCCGCCGC Direct Gain 0 0.800746917724609 Functional Gain 0.800746917724609 TJP2 ENSG00000119139 UTR5 Human protein_coding chr9:71789104 chr9:71789104 . . 0 21 hm1A_associated_SNPs_14937 0 30535121 Macular thickness 3e-08 GWAS_Catalog TagSNP rs62567129 GCST006976 Genome-wide association analyses identify 139 loci associated with macular thickness in the UK Biobank cohort.
99 chr9 95375448 95375448 1 + G A rs72754495 95375448 + 95375428 95375468 41 CTAGTTCCAAAACAGTGAACGTGGAGGATGAAGATGCTGCG CTAGTTCCAAAACAGTGAACATGGAGGATGAAGATGCTGCG Direct Gain 0 0.74539577960968 Functional Gain 0.74539577960968 CENPP ENSG00000188312 UTR3 Human protein_coding chr9:95375448 chr9:95375448 . . 0 21 hm1A_associated_SNPs_15053 0 29924316 Familial squamous cell lung carcinoma 8e-08 GWAS_Catalog TagSNP rs72754495 GCST006088 Genome-Wide Association Study of Familial Lung Cancer.
100 chr9 133928345 133928345 1 + C A rs12349966 133928345 + 133928325 133928365 41 CGCGTCAGTCCCGGCCCCAGCCCTGCCGGTCAGTAAAGACA CGCGTCAGTCCCGGCCCCAGACCTGCCGGTCAGTAAAGACA Direct Gain 0 0.765176296234131 Functional Gain 0.765176296234131 LAMC3 ENSG00000050555 CDS Human protein_coding chr9:133928345 chr9:133928345 nonsynonymous SNV 0.154 0 21 hm1A_associated_SNPs_15495 0 30595370 Balding type 1 7e-09 GWAS_Catalog TagSNP rs12349966 GCST007038 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
101 chr9 137023979 137023979 1 + G A rs11556391 137023979 + 137023959 137023999 41 TCATTGTTCAGTGTTGCTGGGGGCGGGGAACGGGGGTGGGG TCATTGTTCAGTGTTGCTGGAGGCGGGGAACGGGGGTGGGG Direct Gain 0 0.712145566940308 Functional Gain 0.712145566940308 WDR5 ENSG00000196363 UTR3 Human protein_coding chr9:137023979 chr9:137023979 . . 0 21 hm1A_associated_SNPs_15592 0 30595370 Waist-hip ratio 1e-08 GWAS_Catalog TagSNP rs11556391 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
102 chr10 5726821 5726821 1 + G A rs11259192 5726821 + 5726801 5726841 41 GCTTCCGGTTGCTAGCGCCGGTCAGAGAGAAAGTCGGCATG GCTTCCGGTTGCTAGCGCCGATCAGAGAGAAAGTCGGCATG Direct Gain 0 0.866970896720886 Functional Gain 0.866970896720886 FAM208B ENSG00000108021 UTR5 Human protein_coding chr10:5726821 chr10:5726821 . . 0 21 hm1A_associated_SNPs_15941 0 17554300 Multiple complex diseases 0.000537539 Johnson and O'Donnell TagSNP rs11259192 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
103 chr10 50025396 50025396 1 + G A rs7097397 50025396 + 50025376 50025416 41 CCCCCAGGACCCAGCGTGGCGAGCCCCGGAGTTCCTCCAGA CCCCCAGGACCCAGCGTGGCAAGCCCCGGAGTTCCTCCAGA Direct Gain 0 0.882383704185486 Functional Gain 0.882383704185486 WDFY4 ENSG00000128815 CDS Human protein_coding chr10:50025396 chr10:50025396 nonsynonymous SNV 0.329 1 21 hm1A_associated_SNPs_16185 0 27399966 Systemic lupus erythematosus 9e-11 GWAS_Catalog TagSNP rs7097397 GCST003622 Genome-wide association meta-analysis in Chinese and European individuals identifies ten new loci associated with systemic lupus erythematosus.
104 chr10 81114060 81114060 1 + G A rs7332 81114060 + 81114040 81114080 41 ACTGCAACACTAACTTCCCCGTGCTGTGGTGTGACCTGAGT ACTGCAACACTAACTTCCCCATGCTGTGGTGTGACCTGAGT Direct Gain 0 0.97443300485611 Functional Gain 0.97443300485611 PPIF ENSG00000108179 UTR3 Human protein_coding chr10:81114060 chr10:81114060 . . 0 21 hm1A_associated_SNPs_16415 0 27863252 High light scatter reticulocyte count 4e-11 GWAS_Catalog TagSNP rs7332 GCST004611 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
105 chr10 101287764 101287764 1 + G A rs10883365 101287764 + 101287744 101287784 41 TTCTCAGACGGTTTGAAGGTGTTTGTGCCAACGTGACCCCC TTCTCAGACGGTTTGAAGGTATTTGTGCCAACGTGACCCCC Direct Gain 0 0.928297877311707 Functional Gain 0.928297877311707 LINC01475 ENSG00000228778;ENSG00000257582 ncRNA_exonic Human other chr10:101287764 chr10:101287764 . . 0 21 hm1A_associated_SNPs_16606 0 17554300 Crohn's disease 6e-08 GWAS_Catalog TagSNP rs10883365 GCST000042 Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
106 chr10 133957761 133957761 1 + G A rs954820 133957761 + 133957741 133957781 41 AAACCAGGATGCGGACGGGGGAAGCGCCAGGGCTTTTCCTG AAACCAGGATGCGGACGGGGAAAGCGCCAGGGCTTTTCCTG Direct Gain 0 0.577147841453552 Functional Gain 0.577147841453552 JAKMIP3 ENSG00000188385 intronic Human protein_coding chr10:133957761 chr10:133957761 . . 0 21 hm1A_associated_SNPs_16898 0 23144326 Chronic obstructive pulmonary disease-related biomarkers 4e-06 GWAS_Catalog TagSNP rs954820 GCST001737 Genome-wide association analysis of blood biomarkers in chronic obstructive pulmonary disease.
107 chr11 831883 831883 1 + G A rs35694355 831883 + 831863 831903 41 AGGGTCCCGGGAGTGGCCAGGGTCCCGTGTGTGCCCTCTGC AGGGTCCCGGGAGTGGCCAGAGTCCCGTGTGTGCCCTCTGC Direct Gain 0 0.796091079711914 Functional Gain 0.796091079711914 CRACR2B ENSG00000255108 ncRNA_intronic Human antisense chr11:831883 chr11:831883 . . 0 21 hm1A_associated_SNPs_17129 0 23251661 Obesity-related traits 3e-06 GWAS_Catalog TagSNP rs35694355 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
108 chr11 1248087 1248087 1 + G A rs56293203 1248087 + 1248067 1248107 41 TGGAGGCGTCCAACGGCTCCGTCCTCATCAATGGGCAGCGG TGGAGGCGTCCAACGGCTCCATCCTCATCAATGGGCAGCGG Direct Gain 0 0.995743274688721 Functional Gain 0.995743274688721 MUC5B ENSG00000117983 CDS Human protein_coding chr11:1248087 chr11:1248087 nonsynonymous SNV 0.008 0 21 hm1A_associated_SNPs_17182 1 27777418 Major depressive disorder 2e-09 GWAS_Catalog TagSNP rs56293203 GCST005547 The PHF21B gene is associated with major depression and modulates the stress response.
109 chr11 11863399 11863399 1 + G A rs113672631 11863399 + 11863379 11863419 41 CGAGGTGACTAGAAGCTAGCGACAAGTGCCGGCCACCTCCG CGAGGTGACTAGAAGCTAGCAACAAGTGCCGGCCACCTCCG Direct Gain 0 0.920386850833893 Functional Gain 0.920386850833893 USP47 ENSG00000170242 UTR5 Human protein_coding chr11:11863399 chr11:11863399 . . 0 21 hm1A_associated_SNPs_17437 0 30072576 Blood protein levels 5e-08 GWAS_Catalog TagSNP rs113672631 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
110 chr11 20129311 20129311 1 + G A rs35891966 20129311 + 20129291 20129331 41 TCCCCTATCTCCTGGAAGCCGTCAGAGAAGGACTCCAGGTG TCCCCTATCTCCTGGAAGCCATCAGAGAAGGACTCCAGGTG Direct Gain 0 0.897272348403931 Functional Gain 0.897272348403931 NAV2 ENSG00000166833 CDS Human protein_coding chr11:20129311 chr11:20129311 nonsynonymous SNV 0.984 3 21 hm1A_associated_SNPs_17524 0 30643258 Smoking status (ever vs never smokers) 7e-09 GWAS_Catalog TagSNP rs35891966 GCST007327 Genome-wide association analyses of risk tolerance and risky behaviors in over 1 million individuals identify hundreds of loci and shared genetic influences.
111 chr11 64009879 64009879 1 + G A rs4672 64009879 + 64009859 64009899 41 CATGAGGCTGAGCTGGTTCCGGGTCCTGACAGTACTGTCCA CATGAGGCTGAGCTGGTTCCAGGTCCTGACAGTACTGTCCA Direct Gain 0 0.974687814712524 Functional Gain 0.974687814712524 FKBP2 ENSG00000173486 CDS Human protein_coding chr11:64009879 chr11:64009879 nonsynonymous SNV 0.971 0 21 hm1A_associated_SNPs_17892 0 30038396 Cognitive performance (MTAG) 6e-09 GWAS_Catalog TagSNP rs4672 GCST006570 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
112 chr11 65561369 65561369 1 + G A rs12797706 65561369 + 65561349 65561389 41 GTGGTGGTCGGGGCAGCCCCGCTCTGCTGCATGCCTGCGAT GTGGTGGTCGGGGCAGCCCCACTCTGCTGCATGCCTGCGAT Direct Gain 0 0.652406215667725 Functional Gain 0.652406215667725 OVOL1 ENSG00000172818 UTR5 Human protein_coding chr11:65561369 chr11:65561369 . . 0 21 hm1A_associated_SNPs_18033 0 30595370 Hair color 1e-21 GWAS_Catalog TagSNP rs12797706 GCST007082 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
113 chr11 65715204 65715204 1 + G A rs71455793 65715204 + 65715184 65715224 41 CCCCAGCTTCAACAACCTCCGAAGGCGACAATGGAGGAAGA CCCCAGCTTCAACAACCTCCAAAGGCGACAATGGAGGAAGA Direct Gain 0 0.704869031906128 Functional Gain 0.704869031906128 TSGA10IP ENSG00000175513 CDS Human protein_coding chr11:65715204 chr11:65715204 unknown 0.000 0 21 hm1A_associated_SNPs_18050 0 30664634 Body fat distribution (trunk fat ratio) 1e-07 GWAS_Catalog TagSNP rs71455793 GCST007294 Genome-wide association study of body fat distribution identifies adiposity loci and sex-specific genetic effects.
114 chr11 65747057 65747057 1 + G A rs754532 65747057 + 65747037 65747077 41 CCTCCTGGGAGACTTGTCCCGTGTACAGTGACCCAGAAAGA CCTCCTGGGAGACTTGTCCCATGTACAGTGACCCAGAAAGA Direct Gain 0 0.993981838226318 Functional Gain 0.993981838226318 SART1 ENSG00000175467 UTR3 Human protein_coding chr11:65747057 chr11:65747057 . . 0 21 hm1A_associated_SNPs_18056 0 30595370 Height 1e-17 GWAS_Catalog TagSNP rs754532 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
115 chr11 68174189 68174189 1 + G A rs4988321 68174189 + 68174169 68174209 41 TCGAGACCAATAACAACGACGTGGCCATCCCGCTCACGGGC TCGAGACCAATAACAACGACATGGCCATCCCGCTCACGGGC Direct Gain 0 0.809713840484619 Functional Gain 0.809713840484619 LRP5 ENSG00000162337 CDS Human protein_coding chr11:68174189 chr11:68174189 nonsynonymous SNV 0.978 3 21 hm1A_associated_SNPs_18168 3 28869591 Heel bone mineral density 7e-15 GWAS_Catalog TagSNP rs4988321 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
116 chr11 111411608 111411608 1 + G A rs11213935 111411608 + 111411588 111411628 41 TACAGGCCGTGCTGCTGGCCGTGCTGCTGGTGGGGCTGCGG TACAGGCCGTGCTGCTGGCCATGCTGCTGGTGGGGCTGCGG Direct Gain 0 0.991945266723633 Functional Gain 0.991945266723633 LAYN ENSG00000204381 CDS Human protein_coding chr11:111411608 chr11:111411608 nonsynonymous SNV 0.020 0 21 hm1A_associated_SNPs_18519 0 23251661 Obesity-related traits 4e-06 GWAS_Catalog TagSNP rs11213935 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
117 chr11 124017493 124017493 1 + G A rs4936894 124017493 + 124017473 124017513 41 TAGGAAGAAAGGAGCTCCCCGTAATCGTTCCTGACCCTTGT TAGGAAGAAAGGAGCTCCCCATAATCGTTCCTGACCCTTGT Direct Gain 0 0.948282420635223 Functional Gain 0.948282420635223 VWA5A ENSG00000110002 UTR3 Human protein_coding chr11:124017493 chr11:124017493 . . 0 21 hm1A_associated_SNPs_18677 0 21782286 Aging (time to death) 2e-06 GWAS_Catalog TagSNP rs4936894 GCST001167 A genome-wide association study of aging.
118 chr12 29542777 29542777 1 + G A rs117154046 29542777 + 29542757 29542797 41 AACGGACAAAGGCCTTCAGGGGCCTGGAAGGTGAGTGAAGT AACGGACAAAGGCCTTCAGGAGCCTGGAAGGTGAGTGAAGT Direct Gain 0 0.852697134017944 Functional Gain 0.852697134017944 OVCH1-AS1 ENSG00000257599 CDS Human antisense chr12:29542777 chr12:29542777 synonymous SNV . 0 21 hm1A_associated_SNPs_19081 0 26830138 Alzheimer disease and age of onset 6e-07 GWAS_Catalog TagSNP rs117154046 GCST003427 Family-based association analyses of imputed genotypes reveal genome-wide significant association of Alzheimer's disease with OSBPL6, PTPRG, and PDCL3.
119 chr12 53442956 53442956 1 + G A rs12369033 53442956 + 53442936 53442976 41 GGGTGGAGTATGTGTTGGGAGGGGGGACCTCCTGTCCAGTC GGGTGGAGTATGTGTTGGGAAGGGGGACCTCCTGTCCAGTC Direct Gain 0 0.512848913669586 Functional Gain 0.512848913669586 TNS2 ENSG00000111077 CDS Human protein_coding chr12:53442956 chr12:53442956 nonsynonymous SNV 0.944 1 21 hm1A_associated_SNPs_19272 0 30595370 Systolic blood pressure 7e-17 GWAS_Catalog TagSNP rs12369033 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
120 chr12 107713696 107713696 1 + G A rs111260184 107713696 + 107713676 107713716 41 CGGCCGCCGCAGTCCCGCCGGCAGCCGCCGCCAACCACCAC CGGCCGCCGCAGTCCCGCCGACAGCCGCCGCCAACCACCAC Direct Gain 0 0.998946666717529 Functional Gain 0.998946666717529 BTBD11 ENSG00000151136 CDS Human protein_coding chr12:107713696 chr12:107713696 nonsynonymous SNV 0.121 1 21 hm1A_associated_SNPs_19621 0 30595370 Body mass index 3e-09 GWAS_Catalog TagSNP rs111260184 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
121 chr12 112241766 112241766 1 + G A rs671 112241766 + 112241746 112241786 41 ACGGGCTGCAGGCATACACTGAAGTGAAAACTGTGAGTGTG ACGGGCTGCAGGCATACACTAAAGTGAAAACTGTGAGTGTG Direct Gain 0 0.551118195056915 Functional Gain 0.551118195056915 ALDH2 ENSG00000111275 CDS Human protein_coding chr12:112241766 chr12:112241766 nonsynonymous SNV 0.952 4 21 hm1A_associated_SNPs_19696 5 21971053 Coronary heart disease 2e-34 GWAS_Catalog TagSNP rs671 GCST001260 Genome-wide association study of coronary artery disease in the Japanese.
122 chr12 127230195 127230195 1 + G A rs1194029 127230195 + 127230175 127230215 41 GGAACCAGACCATCAGATCCGTAGAGATCCAACCAATGAAG GGAACCAGACCATCAGATCCATAGAGATCCAACCAATGAAG Direct Gain 0 0.938370108604431 Functional Gain 0.938370108604431 LINC00943 ENSG00000189238 ncRNA_exonic Human lincRNA chr12:127230195 chr12:127230195 . . 0 21 hm1A_associated_SNPs_19903 0 17463246 Multiple continuous traits in DGI samples 0.0008152 Johnson and O'Donnell TagSNP rs1194029 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
123 chr12 132325239 132325239 1 + G A rs6598163 132325239 + 132325219 132325259 41 TCCACGAGGTGGCGGGCAGCGCCGCCGACATCCAGATCGAC TCCACGAGGTGGCGGGCAGCACCGCCGACATCCAGATCGAC Direct Gain 0 0.788081109523773 Functional Gain 0.788081109523773 MMP17 ENSG00000198598 CDS Human protein_coding chr12:132325239 chr12:132325239 nonsynonymous SNV 0.001 0 21 hm1A_associated_SNPs_19951 0 22683712 Migraine 5e-07 GWAS_Catalog TagSNP rs6598163 GCST001563 Genome-wide association analysis identifies susceptibility loci for migraine without aura.
124 chr13 24553861 24553861 1 + G A rs9510982 24553861 + 24553841 24553881 41 TGGGCGGGGAGCCAGAGACTGATTCGCTGCGGTCCTGGGCC TGGGCGGGGAGCCAGAGACTAATTCGCTGCGGTCCTGGGCC Direct Gain 0 0.566828846931458 Functional Gain 0.566828846931458 SPATA13 ENSG00000273167 UTR5 Human protein_coding chr13:24553861 chr13:24553861 . . 0 21 hm1A_associated_SNPs_20070 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 3.1e-05 Johnson and O'Donnell TagSNP rs9510982 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
125 chr13 99101426 99101426 1 + G A rs9584850 99101426 + 99101406 99101446 41 CACCATTTGTGGTATGTTCCGTGATGAGCGTTTAGTGAGCC CACCATTTGTGGTATGTTCCATGATGAGCGTTTAGTGAGCC Direct Gain 0 0.78190004825592 Functional Gain 0.78190004825592 FARP1 ENSG00000152767 UTR3 Human protein_coding chr13:99101426 chr13:99101426 . . 0 21 hm1A_associated_SNPs_20325 0 27089181 Neuroticism 7e-08 GWAS_Catalog TagSNP rs9584850 GCST003770 Genetic variants associated with subjective well-being, depressive symptoms, and neuroticism identified through genome-wide analyses.
126 chr13 109793177 109793177 1 + G A rs150813880 109793177 + 109793157 109793197 41 CTGACACCCCTGGAGGTGAAGAAGCTGCCAGTCCTGGAGAC CTGACACCCCTGGAGGTGAAAAAGCTGCCAGTCCTGGAGAC Direct Gain 0 0.927980780601501 Functional Gain 0.927980780601501 MYO16 ENSG00000041515 CDS Human protein_coding chr13:109793177 chr13:109793177 synonymous SNV . 0 21 hm1A_associated_SNPs_20363 0 26830138 Alzheimer disease and age of onset 1e-06 GWAS_Catalog TagSNP rs150813880 GCST003427 Family-based association analyses of imputed genotypes reveal genome-wide significant association of Alzheimer's disease with OSBPL6, PTPRG, and PDCL3.
127 chr13 115002305 115002305 1 + G A rs8002514 115002305 + 115002285 115002325 41 GACATCTATTGGTTGGCTCAGTGTCTTTACCTGACAGCACA GACATCTATTGGTTGGCTCAATGTCTTTACCTGACAGCACA Direct Gain 0 0.939303874969482 Functional Gain 0.939303874969482 CDC16 ENSG00000130177 CDS Human protein_coding chr13:115002305 chr13:115002305 synonymous SNV . 0 21 hm1A_associated_SNPs_20490 0 30595370 Height 3e-42 GWAS_Catalog TagSNP rs8002514 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
128 chr13 115047305 115047305 1 + G A rs3752105 115047305 + 115047285 115047325 41 CAAACCTCGCGAGGAGAAGAGGACGGCCCTGAGCAAGGTGG CAAACCTCGCGAGGAGAAGAAGACGGCCCTGAGCAAGGTGG Direct Gain 0 0.863952159881592 Functional Gain 0.863952159881592 UPF3A ENSG00000169062 CDS Human protein_coding chr13:115047305 chr13:115047305 nonsynonymous SNV 0.979 0 21 hm1A_associated_SNPs_20493 0 30595370 Cardiovascular disease 8e-09 GWAS_Catalog TagSNP rs3752105 GCST007072 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
129 chr13 115090193 115090193 1 + G A rs3813133 115090193 + 115090173 115090213 41 TCTCCTGAACCTTGGAAGCCGTTCCCTGCTGTCTCCCCAGA TCTCCTGAACCTTGGAAGCCATTCCCTGCTGTCTCCCCAGA Direct Gain 0 0.990508377552032 Functional Gain 0.990508377552032 CHAMP1 ENSG00000198824 CDS Human protein_coding chr13:115090193 chr13:115090193 synonymous SNV . 0 21 hm1A_associated_SNPs_20496 0 18057069 Amyotrophic Lateral Sclerosis (ALS) 1.67e-05 Johnson and O'Donnell TagSNP rs3813133 . A genome-wide association study of sporadic ALS in a homogenous Irish population.
130 chr14 23312594 23312594 1 + G A rs1042704 23312594 + 23312574 23312614 41 CGGAGAATTTTGTGCTGCCCGATGATGACCGCCGGGGCATC CGGAGAATTTTGTGCTGCCCAATGATGACCGCCGGGGCATC Direct Gain 0 0.71746152639389 Functional Gain 0.71746152639389 MMP14 ENSG00000157227 CDS Human protein_coding chr14:23312594 chr14:23312594 nonsynonymous SNV 0.696 1 21 hm1A_associated_SNPs_20540 0 28869591 Heel bone mineral density 6e-07 GWAS_Catalog TagSNP rs1042704 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
131 chr14 23777099 23777099 1 + G A rs2231301 23777099 + 23777079 23777119 41 GAGGGCCCAGCAGCTGACCCGCTGCACCAAGCCATGCGGGC GAGGGCCCAGCAGCTGACCCACTGCACCAAGCCATGCGGGC Direct Gain 0 0.67024838924408 Functional Gain 0.67024838924408 BCL2L2;BCL2L2-PABPN1 ENSG00000129473;ENSG00000258643 CDS Human other chr14:23777099 chr14:23777099 synonymous SNV . 0 21 hm1A_associated_SNPs_20556 0 28552196 Height 3e-07 GWAS_Catalog TagSNP rs2231301 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
132 chr15 29033909 29033909 1 + G A rs56166703 29033909 + 29033889 29033929 41 AGGGCGACGCCGCGGCCGCAGCCATGGGTGCTGGGCCTGCA AGGGCGACGCCGCGGCCGCAACCATGGGTGCTGGGCCTGCA Direct Gain 0 0.954346239566803 Functional Gain 0.954346239566803 LOC100289656 ENSG00000232431 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr15:29033909 chr15:29033909 . . 0 21 hm1A_associated_SNPs_21415 0 30595370 Hair color 1e-245 GWAS_Catalog TagSNP rs56166703 GCST007082 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
133 chr15 31202961 31202961 1 + G A rs150393409 31202961 + 31202941 31202981 41 TCTCAAATTGGCCAAACAGCGTTCAGTCTGCACTTGGGGCA TCTCAAATTGGCCAAACAGCATTCAGTCTGCACTTGGGGCA Direct Gain 0 0.524639189243317 Functional Gain 0.524639189243317 FAN1 ENSG00000198690 CDS Human protein_coding chr15:31202961 chr15:31202961 nonsynonymous SNV 0.846 2 21 hm1A_associated_SNPs_21440 0 29750799 Huntington's disease (age at onset) 2e-20 GWAS_Catalog TagSNP rs150393409 GCST007113 Population-specific genetic modification of Huntington's disease in Venezuela.
134 chr15 65153690 65153690 1 + G A rs12595292 65153690 + 65153670 65153710 41 CTCCAGGTAAAGGTGGACAAGAGCTGCGCCCTGGAGCATGT CTCCAGGTAAAGGTGGACAAAAGCTGCGCCCTGGAGCATGT Direct Gain 0 0.661536037921906 Functional Gain 0.661536037921906 PLEKHO2 ENSG00000241839;ENSG00000249240 CDS Human other chr15:65153690 chr15:65153690 synonymous SNV . 0 21 hm1A_associated_SNPs_21745 0 21347282 LDL cholesterol 9e-06 GWAS_Catalog TagSNP rs12595292 GCST000975 Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project.
135 chr15 74466271 74466271 1 + G A rs923118 74466271 + 74466251 74466291 41 AAGTCCTCCCTTGGGCGCCCGTGGCCCTGCAGACTCTCAGG AAGTCCTCCCTTGGGCGCCCATGGCCCTGCAGACTCTCAGG Direct Gain 0 0.794370830059052 Functional Gain 0.794370830059052 ISLR ENSG00000261543 ncRNA_intronic Human antisense chr15:74466271 chr15:74466271 . . 0 21 hm1A_associated_SNPs_21854 0 30072576 Blood protein levels 2e-11 GWAS_Catalog TagSNP rs923118 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
136 chr15 78792439 78792439 1 + G A rs7174348 78792439 + 78792419 78792459 41 CTTGACCTCGTGATCCGCCCGCCTTGGCCTCCACAAGTGCT CTTGACCTCGTGATCCGCCCACCTTGGCCTCCACAAGTGCT Direct Gain 0 0.548857927322388 Functional Gain 0.548857927322388 IREB2 ENSG00000136381 UTR3 Human protein_coding chr15:78792439 chr15:78792439 . . 0 21 hm1A_associated_SNPs_21934 0 26634245 Post bronchodilator FEV1/FVC ratio 2e-06 GWAS_Catalog TagSNP rs7174348 GCST003264 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
137 chr15 78833036 78833036 1 + C A rs57064725 78833036 + 78833016 78833056 41 CTCCTCTGTGACGGACCGACCGCCGGGAATGGCCCCCGCCG CTCCTCTGTGACGGACCGACAGCCGGGAATGGCCCCCGCCG Direct Gain 0 0.932379484176636 Functional Gain 0.932379484176636 PSMA4 ENSG00000041357 intronic Human protein_coding chr15:78833036 chr15:78833036 . . 0 21 hm1A_associated_SNPs_21940 0 26634245 Post bronchodilator FEV1 6e-07 GWAS_Catalog TagSNP rs57064725 GCST003262 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
138 chr15 78857896 78857896 1 + T A rs503464 78857896 + 78857876 78857916 41 CCCGCCAGAAGCTGCTAGGCTGAGGCTGCTGTCCCGGCGGG CCCGCCAGAAGCTGCTAGGCAGAGGCTGCTGTCCCGGCGGG Direct Gain 0 0.868688941001892 Functional Gain 0.868688941001892 CHRNA5 ENSG00000169684 UTR5 Human protein_coding chr15:78857896 chr15:78857896 . . 0 21 hm1A_associated_SNPs_21944 0 26030696 Emphysema imaging phenotypes 3e-07 GWAS_Catalog TagSNP rs503464 GCST002945 A Genome-Wide Association Study of Emphysema and Airway Quantitative Imaging Phenotypes.
139 chr15 78882925 78882925 1 + G A rs16969968 78882925 + 78882905 78882945 41 ACACATTGGAAGCTGCGCTCGATTCTATTCGCTACATTACA ACACATTGGAAGCTGCGCTCAATTCTATTCGCTACATTACA Direct Gain 0 0.513068735599518 Functional Gain 0.513068735599518 CHRNA5 ENSG00000169684 CDS Human protein_coding chr15:78882925 chr15:78882925 nonsynonymous SNV 0.039 0 21 hm1A_associated_SNPs_21946 2 26634245 Pre bronchodilator FEV1 2e-09 GWAS_Catalog TagSNP rs16969968 GCST003266 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
140 chr15 91427692 91427692 1 + G A rs138682554 91427692 + 91427672 91427712 41 AACTGAAACCGCGGGAGGAGGAAGCGCGGAATCAGGAACTG AACTGAAACCGCGGGAGGAGAAAGCGCGGAATCAGGAACTG Direct Gain 0 0.899999380111694 Functional Gain 0.899999380111694 FES ENSG00000182511 UTR5 Human protein_coding chr15:91427692 chr15:91427692 . . 0 21 hm1A_associated_SNPs_22104 0 28135244 Systolic blood pressure 1e-09 GWAS_Catalog TagSNP rs138682554 GCST004279 Genome-wide association analysis identifies novel blood pressure loci and offers biological insights into cardiovascular risk.
141 chr16 334580 334580 1 + G A rs432925 334580 + 334560 334600 41 AATGGGAACCGCACGCACCCGGAGGAGTACACAGGTGAGGG AATGGGAACCGCACGCACCCAGAGGAGTACACAGGTGAGGG Direct Gain 0 0.525287389755249 Functional Gain 0.525287389755249 PDIA2 ENSG00000185615 CDS Human protein_coding chr16:334580 chr16:334580 synonymous SNV . 0 21 hm1A_associated_SNPs_22284 0 26835600 Morning vs. evening chronotype 6e-06 GWAS_Catalog TagSNP rs432925 GCST003429 GWAS of 89,283 individuals identifies genetic variants associated with self-reporting of being a morning person.
142 chr16 1129010 1129010 1 + C A rs4988483 1129010 + 1128990 1129030 41 TGCTGGTGCCCGTGCTGTACCTGCTGGTGTGTGCGGCCGGG TGCTGGTGCCCGTGCTGTACATGCTGGTGTGTGCGGCCGGG Direct Gain 0 0.694055795669556 Functional Gain 0.694055795669556 SSTR5 ENSG00000162009 CDS Human protein_coding chr16:1129010 chr16:1129010 nonsynonymous SNV 0.427 0 21 hm1A_associated_SNPs_22460 0 30048462 Heel bone mineral density 2e-17 GWAS_Catalog TagSNP rs4988483 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
143 chr16 1252369 1252369 1 + C A rs61734410 1252369 + 1252349 1252389 41 GGGGAAGTGGGCCGGTGGACCGCCAGGCACCGGGGGGCACG GGGGAAGTGGGCCGGTGGACAGCCAGGCACCGGGGGGCACG Direct Gain 0 0.596914052963257 Functional Gain 0.596914052963257 CACNA1H ENSG00000196557 CDS Human protein_coding chr16:1252369 chr16:1252369 nonsynonymous SNV 0.001 1 21 hm1A_associated_SNPs_22483 0 30038396 Educational attainment (MTAG) 6e-21 GWAS_Catalog TagSNP rs61734410 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
144 chr16 28333411 28333411 1 + G A rs2650492 28333411 + 28333391 28333431 41 AATGGGGGCGGTGGACACCAGGGGGCGAGTGTGTGACTAGG AATGGGGGCGGTGGACACCAAGGGGCGAGTGTGTGACTAGG Direct Gain 0 0.857340335845947 Functional Gain 0.857340335845947 SBK1 ENSG00000188322 UTR3 Human protein_coding chr16:28333411 chr16:28333411 . . 0 21 hm1A_associated_SNPs_23144 0 25673413 Body mass index 5e-06 GWAS_Catalog TagSNP rs2650492 GCST002783 Genetic studies of body mass index yield new insights for obesity biology.
145 chr16 30546488 30546488 1 + G A rs6565191 30546488 + 30546468 30546508 41 TCGGACTTCAGCCCATCACTGTCTCGTTTTGTCCTCAGAAA TCGGACTTCAGCCCATCACTATCTCGTTTTGTCCTCAGAAA Direct Gain 0 0.526775360107422 Functional Gain 0.526775360107422 ZNF747 ENSG00000235560 ncRNA_exonic Human antisense chr16:30546488 chr16:30546488 . . 0 21 hm1A_associated_SNPs_23237 0 17554300 Multiple complex diseases 0.00072162 Johnson and O'Donnell TagSNP rs6565191 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
146 chr16 31121793 31121793 1 + G A rs14235 31121793 + 31121773 31121813 41 GGAATCCGCATGTTGGCCACGCATCACCTGGCGCTGCATGA GGAATCCGCATGTTGGCCACACATCACCTGGCGCTGCATGA Direct Gain 0 0.544826865196228 Functional Gain 0.544826865196228 BCKDK ENSG00000103507 CDS Human protein_coding chr16:31121793 chr16:31121793 synonymous SNV . 0 21 hm1A_associated_SNPs_23291 1 28892059 Parkinson's disease 5e-12 GWAS_Catalog TagSNP rs14235 GCST004902 A meta-analysis of genome-wide association studies identifies 17 new Parkinson's disease risk loci.
147 chr16 50745199 50745199 1 + C A rs2066843 50745199 + 50745179 50745219 41 GAGCTGTACCTGAGGAAGCGCCATCATGAGCCCGGGGTGGC GAGCTGTACCTGAGGAAGCGACATCATGAGCCCGGGGTGGC Direct Gain 0 0.611998200416565 Functional Gain 0.611998200416565 NOD2 ENSG00000167207 CDS Human protein_coding chr16:50745199 chr16:50745199 synonymous SNV . 0 21 hm1A_associated_SNPs_23353 0 17068223 Crohn's disease 2.86e-09 Johnson and O'Donnell TagSNP rs2066843 . A genome-wide association study identifies IL23R as an inflammatory bowel disease gene.
148 chr16 57016092 57016092 1 + G A rs5882 57016092 + 57016072 57016112 41 GGCAGAGCAGCTCCGAGTCCGTCCAGAGCTTCCTGCAGTCA GGCAGAGCAGCTCCGAGTCCATCCAGAGCTTCCTGCAGTCA Direct Gain 0 0.991268992424011 Functional Gain 0.991268992424011 CETP ENSG00000087237 CDS Human protein_coding chr16:57016092 chr16:57016092 nonsynonymous SNV 0.000 0 21 hm1A_associated_SNPs_23409 2 18193046 HDL cholesterol 7.8e-09 Johnson and O'Donnell TagSNP rs5882 . Genome-wide scan identifies variation in MLXIPL associated with plasma triglycerides.
149 chr16 67680806 67680806 1 + G A rs117556162 67680806 + 67680786 67680826 41 ATCTCCTTCTCACCCAGGACGTGGACACCATTTACCATCGC ATCTCCTTCTCACCCAGGACATGGACACCATTTACCATCGC Direct Gain 0 0.567284405231476 Functional Gain 0.567284405231476 CARMIL2 ENSG00000159753 CDS Human protein_coding chr16:67680806 chr16:67680806 nonsynonymous SNV 0.980 4 21 hm1A_associated_SNPs_23516 0 30595370 Eosinophil counts 1e-15 GWAS_Catalog TagSNP rs117556162 GCST007065 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
150 chr16 72130815 72130815 1 + C A rs1050362 72130815 + 72130795 72130835 41 GGCAGAGAGAGCGGGAGCGGCGGGAACATGGTGTCTATGCC GGCAGAGAGAGCGGGAGCGGAGGGAACATGGTGTCTATGCC Direct Gain 0 0.842916369438171 Functional Gain 0.842916369438171 DHX38 ENSG00000140829 CDS Human protein_coding chr16:72130815 chr16:72130815 synonymous SNV . 0 21 hm1A_associated_SNPs_23612 0 29212778 Coronary artery disease 3e-11 GWAS_Catalog TagSNP rs1050362 GCST005196 Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease.
151 chr16 85319399 85319399 1 + C A rs12447206 85319399 + 85319379 85319419 41 AAACCCCACATCTGTGATCCCTGTCCACAGTAAAGGCTGAG AAACCCCACATCTGTGATCCATGTCCACAGTAAAGGCTGAG Direct Gain 0 0.89116907119751 Functional Gain 0.89116907119751 LINC00311 ENSG00000179219 ncRNA_exonic Human lincRNA chr16:85319399 chr16:85319399 . . 0 21 hm1A_associated_SNPs_23717 0 28196072 Male-pattern baldness 2e-08 GWAS_Catalog TagSNP rs12447206 GCST006661 Genetic prediction of male pattern baldness.
152 chr16 89704365 89704365 1 + G A rs1126464 89704365 + 89704345 89704385 41 ACAACCTGCTGAGGGTCTTCGAGGCTGTGGAACAGGTGAGG ACAACCTGCTGAGGGTCTTCAAGGCTGTGGAACAGGTGAGG Direct Gain 0 0.529227435588837 Functional Gain 0.529227435588837 DPEP1 ENSG00000015413 CDS Human protein_coding chr16:89704365 chr16:89704365 nonsynonymous SNV 0.003 0 21 hm1A_associated_SNPs_23935 0 27618447 Diastolic blood pressure 6e-15 GWAS_Catalog TagSNP rs1126464 GCST006020 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
153 chr16 89726035 89726035 1 + T A rs154663 89726035 + 89726015 89726055 41 GACCCGGGAGGCAGAAGTAGTGGTGAGCGAGATCGCACCAC GACCCGGGAGGCAGAAGTAGAGGTGAGCGAGATCGCACCAC Direct Gain 0 0.536933839321136 Functional Gain 0.536933839321136 SPATA33 ENSG00000167523 UTR3 Human protein_coding chr16:89726035 chr16:89726035 . . 0 21 hm1A_associated_SNPs_23941 0 23456168 Height 9e-07 GWAS_Catalog TagSNP rs154663 GCST001885 Genome-wide association study in Han Chinese identifies three novel loci for human height.
154 chr16 89985940 89985940 1 + G A rs2228479 89985940 + 89985920 89985960 41 TGCTGGTGAGCGGGAGCAACGTGCTGGAGACGGCCGTCATC TGCTGGTGAGCGGGAGCAACATGCTGGAGACGGCCGTCATC Direct Gain 0 0.585522055625916 Functional Gain 0.585522055625916 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89985940 chr16:89985940 nonsynonymous SNV 0.138 0 21 hm1A_associated_SNPs_23984 4 17999355 Skin pigmentation 0.00068 Johnson and O'Donnell TagSNP rs2228479 . A genomewide association study of skin pigmentation in a South Asian population.
155 chr17 3214106 3214106 1 + C A rs9911226 3214106 + 3214086 3214126 41 CCCAAACTGTTGCCCTGTCTCCTCTTAACTTCTGTGGCCCC CCCAAACTGTTGCCCTGTCTACTCTTAACTTCTGTGGCCCC Direct Gain 0 0.518236696720123 Functional Gain 0.518236696720123 OR3A4P ENSG00000180068 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr17:3214106 chr17:3214106 . . 0 21 hm1A_associated_SNPs_24121 0 17554300 Multiple complex diseases 0.000959449 Johnson and O'Donnell TagSNP rs9911226 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
156 chr17 4441309 4441309 1 + C A rs10521140 4441309 + 4441289 4441329 41 TTGGGGATATTGGACGCAACCTGGCAAATGAAGCTGGGCGC TTGGGGATATTGGACGCAACATGGCAAATGAAGCTGGGCGC Direct Gain 0 0.934367179870605 Functional Gain 0.934367179870605 SPNS2 ENSG00000183018 UTR3 Human protein_coding chr17:4441309 chr17:4441309 . . 0 21 hm1A_associated_SNPs_24138 0 17641165 HIV-1 disease progression 0.0006096 Johnson and O'Donnell TagSNP rs10521140 . A whole-genome association study of major determinants for host control of HIV-1.
157 chr17 4837195 4837195 1 + C A rs553749201 4837195 + 4837175 4837215 41 CCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCCAGAGCC CCCACCTCAGAGCCCGCCCCAAGCCCGACCACCCCAGAGCC Direct Gain 0 0.609844565391541 Functional Gain 0.609844565391541 GP1BA ENSG00000185245 CDS Human protein_coding chr17:4837195 chr17:4837195 synonymous SNV . 0 21 hm1A_associated_SNPs_24177 0 27863252 Mean platelet volume 8e-10 GWAS_Catalog TagSNP rs553749201 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
158 chr17 7185062 7185062 1 + C A rs5417 7185062 + 7185042 7185082 41 TTCCCCCAGCCCCGCTCCACCAGATCCGCGGGAGCCCCACT TTCCCCCAGCCCCGCTCCACAAGATCCGCGGGAGCCCCACT Direct Gain 0 0.888434052467346 Functional Gain 0.888434052467346 SLC2A4 ENSG00000181856 UTR5 Human protein_coding chr17:7185062 chr17:7185062 . . 0 21 hm1A_associated_SNPs_24241 0 28135244 Diastolic blood pressure 1e-13 GWAS_Catalog TagSNP rs5417 GCST004280 Genome-wide association analysis identifies novel blood pressure loci and offers biological insights into cardiovascular risk.
159 chr17 7484812 7484812 1 + G A rs9901675 7484812 + 7484792 7484832 41 TCATCCGGAGACGCCCATCCGCCTACCAGGCCCTCTGAGCA TCATCCGGAGACGCCCATCCACCTACCAGGCCCTCTGAGCA Direct Gain 0 0.604473412036896 Functional Gain 0.604473412036896 CD68 ENSG00000129226 CDS Human protein_coding chr17:7484812 chr17:7484812 nonsynonymous SNV 0.009 0 21 hm1A_associated_SNPs_24299 0 22829776 Sex hormone-binding globulin levels 1e-07 GWAS_Catalog TagSNP rs9901675 GCST001612 A genome-wide association meta-analysis of circulating sex hormone-binding globulin reveals multiple Loci implicated in sex steroid hormone regulation.
160 chr17 40985648 40985648 1 + C A rs139945697 40985648 + 40985628 40985668 41 CGGACACGGCCCGGCCCGGCCATGGCCTCGTTGCTGAAGGT CGGACACGGCCCGGCCCGGCAATGGCCTCGTTGCTGAAGGT Direct Gain 0 0.663874268531799 Functional Gain 0.663874268531799 PSME3 ENSG00000131467 UTR5 Human protein_coding chr17:40985648 chr17:40985648 . . 0 21 hm1A_associated_SNPs_24841 0 30595370 Waist-hip ratio 4e-08 GWAS_Catalog TagSNP rs139945697 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
161 chr17 42827673 42827673 1 + G A rs3744477 42827673 + 42827653 42827693 41 TCTCACCCTTCTCTGCGTCCGTGCATTTAAAGAGTTGTCTC TCTCACCCTTCTCTGCGTCCATGCATTTAAAGAGTTGTCTC Direct Gain 0 0.974489569664001 Functional Gain 0.974489569664001 DBF4B ENSG00000161692 intronic Human protein_coding chr17:42827673 chr17:42827673 . . 0 21 hm1A_associated_SNPs_24883 0 17671248 Sporadic Amyotrophic Lateral Sclerosis (ALS) 0.03 Johnson and O'Donnell TagSNP rs3744477 . Whole-genome analysis of sporadic amyotrophic lateral sclerosis.
162 chr17 74381555 74381555 1 + G A rs2247856 74381555 + 74381535 74381575 41 CAGCCGCCGCAGGGAATGACGCCGGTGCTCCTGCAGCCACG CAGCCGCCGCAGGGAATGACACCGGTGCTCCTGCAGCCACG Direct Gain 0 0.765817999839783 Functional Gain 0.765817999839783 SPHK1 ENSG00000176170 CDS Human protein_coding chr17:74381555 chr17:74381555 nonsynonymous SNV 0.294 1 21 hm1A_associated_SNPs_25448 0 27863252 Reticulocyte fraction of red cells 2e-27 GWAS_Catalog TagSNP rs2247856 GCST004619 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
163 chr17 76219591 76219591 1 + G A rs2071214 76219591 + 76219571 76219611 41 AAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATC AAGAATTTGAGGAAACTGCGAAGAAAGTGCGCCGTGCCATC Direct Gain 0 0.516873598098755 Functional Gain 0.516873598098755 BIRC5 ENSG00000089685;ENSG00000268310 CDS Human other chr17:76219591 chr17:76219591 nonsynonymous SNV 0.001 0 21 hm1A_associated_SNPs_25527 0 23942779 Behavioural disinhibition (generation interaction) 8e-06 GWAS_Catalog TagSNP rs2071214 GCST002131 A genome-wide association study of behavioral disinhibition.
164 chr17 78305871 78305871 1 + G A rs10782008 78305871 + 78305851 78305891 41 GTAAAAGATTAAATGACACCGTGACAGTGAGACTGTCCACC GTAAAAGATTAAATGACACCATGACAGTGAGACTGTCCACC Direct Gain 0 0.994433164596558 Functional Gain 0.994433164596558 RNF213 ENSG00000173821 CDS Human protein_coding chr17:78305871 chr17:78305871 nonsynonymous SNV 0.018 0 21 hm1A_associated_SNPs_25625 0 29273593 Moyamoya disease 2e-44 GWAS_Catalog TagSNP rs10782008 GCST005575 Novel Susceptibility Loci for Moyamoya Disease Revealed by a Genome-Wide Association Study.
165 chr17 79419025 79419025 1 + G A rs35572189 79419025 + 79419005 79419045 41 CCTGAAGGCCGCCATCGACCGGCTGGACACGCAGGAGGTGG CCTGAAGGCCGCCATCGACCAGCTGGACACGCAGGAGGTGG Direct Gain 0 0.636197924613953 Functional Gain 0.636197924613953 BAHCC1 ENSG00000171282 CDS Human other chr17:79419025 chr17:79419025 nonsynonymous SNV 1.000 0 21 hm1A_associated_SNPs_25726 0 30220432 Urinary albumin excretion 1e-09 GWAS_Catalog TagSNP rs35572189 GCST006586 Genetic Association of Albuminuria with Cardiometabolic Disease and Blood Pressure.
166 chr18 34289285 34289285 1 + G A rs61735998 34289285 + 34289265 34289305 41 ACAACTGCTCTGCCTCCAGCGTCTCGTCCTCCAGCAGCACG ACAACTGCTCTGCCTCCAGCATCTCGTCCTCCAGCAGCACG Direct Gain 0 0.774636745452881 Functional Gain 0.774636745452881 FHOD3 ENSG00000134775 CDS Human protein_coding chr18:34289285 chr18:34289285 nonsynonymous SNV 0.993 0 21 hm1A_associated_SNPs_26054 0 27798624 Resting heart rate 2e-14 GWAS_Catalog TagSNP rs61735998 GCST003818 Identification of genomic loci associated with resting heart rate and shared genetic predictors with all-cause mortality.
167 chr18 77156171 77156171 1 + G A rs74183647 77156171 + 77156151 77156191 41 GACCCCGGCAGCGCGGGGCGGCCGCTTCTCCTGTGCCTCCG GACCCCGGCAGCGCGGGGCGACCGCTTCTCCTGTGCCTCCG Direct Gain 0 0.999541163444519 Functional Gain 0.999541163444519 NFATC1 ENSG00000131196 UTR5 Human protein_coding chr18:77156171 chr18:77156171 . . 0 21 hm1A_associated_SNPs_26281 0 29779033 Estimated glomerular filtration rate 2e-11 GWAS_Catalog TagSNP rs74183647 GCST006392 Genome-Wide Association Study of Renal Function Traits: Results from the Japan Multi-Institutional Collaborative Cohort Study.
168 chr19 844020 844020 1 + G A rs351111 844020 + 844000 844040 41 CGGAGAACAAACTGAACGACGTTCTCCTCATCCAGGTGGGC CGGAGAACAAACTGAACGACATTCTCCTCATCCAGGTGGGC Direct Gain 0 0.559132397174835 Functional Gain 0.559132397174835 PRTN3 ENSG00000196415 CDS Human protein_coding chr19:844020 chr19:844020 nonsynonymous SNV 0.001 0 21 hm1A_associated_SNPs_26402 0 29875488 Blood protein levels 4e-66 GWAS_Catalog TagSNP rs351111 GCST005806 Genomic atlas of the human plasma proteome.
169 chr19 1104078 1104078 1 + G A rs4807542 1104078 + 1104058 1104098 41 CTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCT CTTTGCCGCCTACTGAAGCCAGCGCTGCTCTGTGGGGCTCT Direct Gain 0 0.8921018242836 Functional Gain 0.8921018242836 GPX4 ENSG00000167468 CDS Human protein_coding chr19:1104078 chr19:1104078 unknown . 0 21 hm1A_associated_SNPs_26490 0 27863252 Eosinophil percentage of granulocytes 3e-11 GWAS_Catalog TagSNP rs4807542 GCST004617 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
170 chr19 10577843 10577843 1 + C A rs1051738 10577843 + 10577823 10577863 41 AGCCCAAGAGGCATTGACTGCGCAGGGATTGTCAGGAGTCG AGCCCAAGAGGCATTGACTGAGCAGGGATTGTCAGGAGTCG Direct Gain 0 0.624931454658508 Functional Gain 0.624931454658508 PDE4A ENSG00000065989 CDS Human protein_coding chr19:10577843 chr19:10577843 nonsynonymous SNV 0.000 1 21 hm1A_associated_SNPs_27040 0 28240269 Blood protein levels 5e-13 GWAS_Catalog TagSNP rs1051738 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
171 chr19 11222300 11222300 1 + G A rs11669576 11222300 + 11222280 11222320 41 AGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGGGTGAG AGCTGGACCCCCACACGAAGACCTGCAAGGCTGTGGGTGAG Direct Gain 0 0.571949183940887 Functional Gain 0.571949183940887 LDLR ENSG00000130164 CDS Human protein_coding chr19:11222300 chr19:11222300 nonsynonymous SNV 0.887 1 21 hm1A_associated_SNPs_27079 3 31217584 Low density lipoprotein cholesterol levels 1e-12 GWAS_Catalog TagSNP rs11669576 GCST008037 Genetic analyses of diverse populations improves discovery for complex traits.
172 chr19 18530161 18530161 1 + T A rs28375303 18530161 + 18530141 18530181 41 AGCTGCGCCCGCGGGCGGCGTAGAGGCAGCGGGCGGGGGCG AGCTGCGCCCGCGGGCGGCGAAGAGGCAGCGGGCGGGGGCG Direct Gain 0 0.965054869651794 Functional Gain 0.965054869651794 SSBP4 ENSG00000130511 UTR5 Human protein_coding chr19:18530161 chr19:18530161 . . 0 21 hm1A_associated_SNPs_27392 0 27863252 Monocyte count 2e-10 GWAS_Catalog TagSNP rs28375303 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
173 chr19 19329924 19329924 1 + C A rs2228603 19329924 + 19329904 19329944 41 CGGGCCAGCGACAGGACTTGCCCATCCTGGTGGCCAAGGAC CGGGCCAGCGACAGGACTTGACCATCCTGGTGGCCAAGGAC Direct Gain 0 0.825094103813171 Functional Gain 0.825094103813171 NCAN ENSG00000130287 CDS Human protein_coding chr19:19329924 chr19:19329924 nonsynonymous SNV 0.998 2 21 hm1A_associated_SNPs_27432 0 27286809 C-reactive protein levels or total cholesterol levels (pleiotropy) 1e-35 GWAS_Catalog TagSNP rs2228603 GCST003678 Bivariate genome-wide association study identifies novel pleiotropic loci for lipids and inflammation.
174 chr19 39888511 39888511 1 + G A rs3746082 39888511 + 39888491 39888531 41 CTCGCAGGCCGGGCCCCTGCGTCCCTGCCCCTTCTTCCTGC CTCGCAGGCCGGGCCCCTGCATCCCTGCCCCTTCTTCCTGC Direct Gain 0 0.85766077041626 Functional Gain 0.85766077041626 MED29 ENSG00000063322 UTR3 Human protein_coding chr19:39888511 chr19:39888511 . . 0 21 hm1A_associated_SNPs_27817 0 27989323 Eotaxin levels 5e-07 GWAS_Catalog TagSNP rs3746082 GCST004460 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
175 chr19 41257046 41257046 1 + G A rs1455434 41257046 + 41257026 41257066 41 CAATGGGAATCGCCATTTAGGGTGCTCCGCCCACCGGGTCG CAATGGGAATCGCCATTTAGAGTGCTCCGCCCACCGGGTCG Direct Gain 0 0.884738445281982 Functional Gain 0.884738445281982 SNRPA ENSG00000077312 UTR5 Human protein_coding chr19:41257046 chr19:41257046 . . 0 21 hm1A_associated_SNPs_27892 0 28240269 Blood protein levels 2e-28 GWAS_Catalog TagSNP rs1455434 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
176 chr19 47548678 47548678 1 + G A rs889169 47548678 + 47548658 47548698 41 GTGCGGCCATGGGGCCTGGCGCCTCCCGGGGACCCCCCGCC GTGCGGCCATGGGGCCTGGCACCTCCCGGGGACCCCCCGCC Direct Gain 0 0.679387748241425 Functional Gain 0.679387748241425 NPAS1 ENSG00000130751 CDS Human protein_coding chr19:47548678 chr19:47548678 synonymous SNV . 0 21 hm1A_associated_SNPs_28170 0 30038396 Cognitive performance 6e-09 GWAS_Catalog TagSNP rs889169 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
177 chr19 49206674 49206674 1 + G A rs601338 49206674 + 49206654 49206694 41 CACCGGCTACCCCTGCTCCTGGACCTTCTACCACCACCTCC CACCGGCTACCCCTGCTCCTAGACCTTCTACCACCACCTCC Direct Gain 0 0.523374557495117 Functional Gain 0.523374557495117 FUT2 ENSG00000176920 CDS Human protein_coding chr19:49206674 chr19:49206674 stopgain 1.000 0 21 hm1A_associated_SNPs_28278 3 28928442 Number of common colds 4e-07 GWAS_Catalog TagSNP rs601338 GCST005019 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
178 chr19 49208865 49208865 1 + G A rs504963 49208865 + 49208845 49208885 41 AGTGAACTTCAGGGCGTTCCGTTCATTCTTTCAGTAAATGT AGTGAACTTCAGGGCGTTCCATTCATTCTTTCAGTAAATGT Direct Gain 0 0.993671834468842 Functional Gain 0.993671834468842 FUT2 ENSG00000176920 UTR3 Human protein_coding chr19:49208865 chr19:49208865 . . 0 21 hm1A_associated_SNPs_28282 0 20570966 Crohn's disease 2e-08 GWAS_Catalog TagSNP rs504963 GCST000705 Fucosyltransferase 2 (FUT2) non-secretor status is associated with Crohn's disease.
179 chr19 49605705 49605705 1 + G A rs73046792 49605705 + 49605685 49605725 41 TTGGGTTCCACCCAGCCTCTGATGACCCGGCTTCGTGATGT TTGGGTTCCACCCAGCCTCTAATGACCCGGCTTCGTGATGT Direct Gain 0 0.755161046981812 Functional Gain 0.755161046981812 SNRNP70 ENSG00000104852 UTR3 Human protein_coding chr19:49605705 chr19:49605705 . . 0 21 hm1A_associated_SNPs_28317 0 30595370 Systolic blood pressure 1e-17 GWAS_Catalog TagSNP rs73046792 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
180 chr19 55145093 55145093 1 + G A rs2114511 55145093 + 55145073 55145113 41 TCATTCTTTTACCCAGGACCGTCTGGGGGCCCCAGCTCCCC TCATTCTTTTACCCAGGACCATCTGGGGGCCCCAGCTCCCC Direct Gain 0 0.94792377948761 Functional Gain 0.94792377948761 LILRB1 ENSG00000104972 CDS Human protein_coding chr19:55145093 chr19:55145093 synonymous SNV . 0 21 hm1A_associated_SNPs_28646 0 29875488 Blood protein levels 0 GWAS_Catalog TagSNP rs2114511 GCST005806 Genomic atlas of the human plasma proteome.
181 chr19 56652592 56652592 1 + G A rs3745836 56652592 + 56652572 56652612 41 GTTGTTGGGCTGAACGAGCGGCTCGGAGTATGGGATTGGGG GTTGTTGGGCTGAACGAGCGACTCGGAGTATGGGATTGGGG Direct Gain 0 0.972619950771332 Functional Gain 0.972619950771332 ZNF444 ENSG00000167685 UTR5 Human protein_coding chr19:56652592 chr19:56652592 . . 0 21 hm1A_associated_SNPs_28759 0 17554300 Multiple complex diseases 0.000864359 Johnson and O'Donnell TagSNP rs3745836 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
182 chr20 25202892 25202892 1 + G A rs6037062 25202892 + 25202872 25202912 41 GGAGCATGGGTCTGTGGACCGTGGGAACCCTGGAAGCACTC GGAGCATGGGTCTGTGGACCATGGGAACCCTGGAAGCACTC Direct Gain 0 0.998125910758972 Functional Gain 0.998125910758972 ENTPD6 ENSG00000197586 intronic Human protein_coding chr20:25202892 chr20:25202892 . . 0 21 hm1A_associated_SNPs_29090 0 30595370 Lung function (FVC) 5e-12 GWAS_Catalog TagSNP rs6037062 GCST007081 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
183 chr20 48569127 48569127 1 + G A rs2235616 48569127 + 48569107 48569147 41 GTGTGCAGACTTTGGCAGCCGTGCACCTGACCAGAGCTGAA GTGTGCAGACTTTGGCAGCCATGCACCTGACCAGAGCTGAA Direct Gain 0 0.599661529064178 Functional Gain 0.599661529064178 RNF114 ENSG00000124226 UTR3 Human protein_coding chr20:48569127 chr20:48569127 . . 0 21 hm1A_associated_SNPs_29402 0 17052657 Parkinson's disease 1.40999e-05 Johnson and O'Donnell TagSNP rs2235616 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
184 chr20 61288593 61288593 1 + G A rs140267842 61288593 + 61288573 61288613 41 TCAAGTCCAGCTGCTCGCCCGTCTACATTGGTGAGTGGGGC TCAAGTCCAGCTGCTCGCCCATCTACATTGGTGAGTGGGGC Direct Gain 0 0.719017386436462 Functional Gain 0.719017386436462 SLCO4A1 ENSG00000101187 CDS Human protein_coding chr20:61288593 chr20:61288593 nonsynonymous SNV 0.678 0 21 hm1A_associated_SNPs_29560 0 26414677 Menopause (age at onset) 2e-08 GWAS_Catalog TagSNP rs140267842 GCST005560 Large-scale genomic analyses link reproductive aging to hypothalamic signaling, breast cancer susceptibility and BRCA1-mediated DNA repair.
185 chr21 46930092 46930092 1 + G A rs144147445 46930092 + 46930072 46930112 41 GGCTGGCGGGCACCTTCCGCGCCTTCCTGTCCTCGCGCCTG GGCTGGCGGGCACCTTCCGCACCTTCCTGTCCTCGCGCCTG Direct Gain 0 0.502102315425873 Functional Gain 0.502102315425873 COL18A1 ENSG00000182871 CDS Human protein_coding chr21:46930092 chr21:46930092 nonsynonymous SNV 0.982 3 21 hm1A_associated_SNPs_30042 1 29875488 Blood protein levels 6e-44 GWAS_Catalog TagSNP rs144147445 GCST005806 Genomic atlas of the human plasma proteome.
186 chr21 46931109 46931109 1 + G A rs12483377 46931109 + 46931089 46931129 41 GGGCACGCATCTTCTCCTTTGACGGCAAGGACGTCCTGAGG GGGCACGCATCTTCTCCTTTAACGGCAAGGACGTCCTGAGG Direct Gain 0 0.518025159835815 Functional Gain 0.518025159835815 COL18A1 ENSG00000182871 CDS Human protein_coding chr21:46931109 chr21:46931109 nonsynonymous SNV 0.595 3 21 hm1A_associated_SNPs_30046 2 29875488 Blood protein levels 0 GWAS_Catalog TagSNP rs12483377 GCST005806 Genomic atlas of the human plasma proteome.
187 chr22 19951271 19951271 1 + G A rs4680 19951271 + 19951251 19951291 41 GGATGGTGGATTTCGCTGGCGTGAAGGACAAGGTGTGCATG GGATGGTGGATTTCGCTGGCATGAAGGACAAGGTGTGCATG Direct Gain 0 0.662086606025696 Functional Gain 0.662086606025696 COMT ENSG00000093010 CDS Human protein_coding chr22:19951271 chr22:19951271 nonsynonymous SNV 0.920 0 21 hm1A_associated_SNPs_30228 3 24816252 Blood metabolite levels 5e-178 GWAS_Catalog TagSNP rs4680 GCST002443 An atlas of genetic influences on human blood metabolites.
188 chr22 40075400 40075400 1 + G A rs2294369 40075400 + 40075380 40075420 41 GGCCGGGAGGGGCGGGCGGCGGGGGCGACACCGAGGGCGGC GGCCGGGAGGGGCGGGCGGCAGGGGCGACACCGAGGGCGGC Direct Gain 0 0.692821621894836 Functional Gain 0.692821621894836 CACNA1I ENSG00000100346 CDS Human protein_coding chr22:40075400 chr22:40075400 nonsynonymous SNV 0.000 1 21 hm1A_associated_SNPs_30808 0 24709693 Response to methotrexate in juvenile idiopathic arthritis 9e-08 GWAS_Catalog TagSNP rs2294369 GCST002408 Genome-wide data reveal novel genes for methotrexate response in a large cohort of juvenile idiopathic arthritis cases.
189 chr22 51042336 51042336 1 + G A rs116947359 51042336 + 51042316 51042356 41 GCAGTCGCCAGTGCGCCCGGGTTGCGACTGCGAAGGGAACC GCAGTCGCCAGTGCGCCCGGATTGCGACTGCGAAGGGAACC Direct Gain 0 0.989226460456848 Functional Gain 0.989226460456848 MAPK8IP2 ENSG00000008735 CDS Human protein_coding chr22:51042336 chr22:51042336 nonsynonymous SNV 0.498 0 21 hm1A_associated_SNPs_31063 0 30072576 Blood protein levels 1e-07 GWAS_Catalog TagSNP rs116947359 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
190 chrX 48436426 48436426 1 + G A rs3200611 48436426 + 48436406 48436446 41 TTGCAGTGAGCTAAGATCGCGCCACTGTACTCCAGCCTGGG TTGCAGTGAGCTAAGATCGCACCACTGTACTCCAGCCTGGG Direct Gain 0 0.777627885341644 Functional Gain 0.777627885341644 RBM3 ENSG00000102317 UTR3 Human protein_coding chrX:48436426 chrX:48436426 . . 0 21 hm1A_associated_SNPs_31319 0 28928442 Hepatitis A 9e-06 GWAS_Catalog TagSNP rs3200611 GCST005017 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
191 chrX 56313931 56313931 1 + G A rs3922927 56313931 + 56313911 56313951 41 GTTTACAACAGCAAAGCACCGTTAGCCTGGACAGTTGCTTA GTTTACAACAGCAAAGCACCATTAGCCTGGACAGTTGCTTA Direct Gain 0 0.986006915569305 Functional Gain 0.986006915569305 KLF8 ENSG00000102349 UTR3 Human protein_coding chrX:56313931 chrX:56313931 . . 0 21 hm1A_associated_SNPs_31359 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0001656 Johnson and O'Donnell TagSNP rs3922927 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
192 chrX 105152282 105152282 1 + G A rs209373 105152282 + 105152262 105152302 41 CTATTAAGGAACAGTACACCGTGAGAAGATTCAGGTGCGTT CTATTAAGGAACAGTACACCATGAGAAGATTCAGGTGCGTT Direct Gain 0 0.802136063575745 Functional Gain 0.802136063575745 NRK ENSG00000123572 CDS Human protein_coding chrX:105152282 chrX:105152282 nonsynonymous SNV 0.994 0 21 hm1A_associated_SNPs_31465 0 31217584 Height 7e-06 GWAS_Catalog TagSNP rs209373 GCST008053 Genetic analyses of diverse populations improves discovery for complex traits.
193 chrX 148622745 148622745 1 + T A rs3747442 148622745 + 148622725 148622765 41 GGGGAGGCAGAGGACTGTTCTTTCCTGTGGCGAAAAGCCGG GGGGAGGCAGAGGACTGTTCATTCCTGTGGCGAAAAGCCGG Direct Gain 0 0.999288558959961 Functional Gain 0.999288558959961 CXorf40A ENSG00000197620 UTR5 Human protein_coding chrX:148622745 chrX:148622745 . . 0 21 hm1A_associated_SNPs_31593 0 17052657 Parkinson's disease 0.000510495 Johnson and O'Donnell TagSNP rs3747442 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
194 chr1 3328659 3328659 1 + C T rs2493292 3328659 - 3328639 3328679 41 CCTTGCCCTTGTCCTTGTCAGGGTCGCTGTCCACGTCGCTG CCTTGCCCTTGTCCTTGTCAAGGTCGCTGTCCACGTCGCTG Direct Gain 0 0.593169569969177 Functional Gain 0.593169569969177 PRDM16 ENSG00000142611 CDS Human protein_coding chr1:3328659 chr1:3328659 nonsynonymous SNV 0.009 1 21 hm1A_associated_SNPs_102676 1 27618448 Systolic blood pressure 1e-08 GWAS_Catalog TagSNP rs2493292 GCST006228 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
195 chr1 55505447 55505447 1 + C T rs45448095 55505447 - 55505427 55505467 41 GGCCGTGCGCGGTCCACGCCGGCGGCGCCTTGAGCCTTGCG GGCCGTGCGCGGTCCACGCCAGCGGCGCCTTGAGCCTTGCG Direct Gain 0 0.54485821723938 Functional Gain 0.54485821723938 PCSK9 ENSG00000169174 UTR5 Human protein_coding chr1:55505447 chr1:55505447 . . 0 21 hm1A_associated_SNPs_103227 2 29748315 Plasma proprotein convertase subtilisin/kexin type 9 levels in stable coronary artery disease 4e-12 GWAS_Catalog TagSNP rs45448095 GCST006284 Genetic Regulation of PCSK9 (Proprotein Convertase Subtilisin/Kexin Type 9) Plasma Levels and Its Impact on Atherosclerotic Vascular Disease Phenotypes.
196 chr1 109818306 109818306 1 + G T rs629301 109818306 - 109818286 109818326 41 AACAACAACAAAACGCTACCCTATTTACAGCAACAACCAAA AACAACAACAAAACGCTACCATATTTACAGCAACAACCAAA Direct Gain 0 0.907140731811523 Functional Gain 0.907140731811523 CELSR2 ENSG00000143126 UTR3 Human protein_coding chr1:109818306 chr1:109818306 . . 0 21 hm1A_associated_SNPs_103344 0 20686565 LDL cholesterol 1e-170 GWAS_Catalog TagSNP rs629301 GCST000759 Biological, clinical and population relevance of 95 loci for blood lipids.
197 chr1 113231503 113231503 1 + G T rs12129649 113231503 - 113231483 113231523 41 AAGGCAGGGCTCGAGGGAGGCAGGGCGGCGGGTGGGAAAGG AAGGCAGGGCTCGAGGGAGGAAGGGCGGCGGGTGGGAAAGG Direct Gain 0 0.62938392162323 Functional Gain 0.62938392162323 MOV10 ENSG00000155363 UTR5 Human protein_coding chr1:113231503 chr1:113231503 . . 0 21 hm1A_associated_SNPs_103378 0 28739976 Diastolic blood pressure 1e-10 GWAS_Catalog TagSNP rs12129649 GCST004777 Novel Blood Pressure Locus and Gene Discovery Using Genome-Wide Association Study and Expression Data Sets From Blood and the Kidney.
198 chr1 155178782 155178782 1 + A T rs760077 155178782 - 155178762 155178802 41 CGGCCCGGCGCGCCTCGGAGTGTCACGGCGCCTCGTCCAAG CGGCCCGGCGCGCCTCGGAGAGTCACGGCGCCTCGTCCAAG Direct Gain 0 0.638692259788513 Functional Gain 0.638692259788513 MTX1 ENSG00000173171 CDS Human protein_coding chr1:155178782 chr1:155178782 nonsynonymous SNV . 0 21 hm1A_associated_SNPs_103500 0 27863252 Hematocrit 2e-23 GWAS_Catalog TagSNP rs760077 GCST004604 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
199 chr1 169101935 169101935 1 + C T rs1138486 169101935 - 169101915 169101955 41 TGTTCATTCTTTTATTGTCCGTTGTTTTAACCTGACTGAAT TGTTCATTCTTTTATTGTCCATTGTTTTAACCTGACTGAAT Direct Gain 0 0.83153760433197 Functional Gain 0.83153760433197 ATP1B1;NME7 ENSG00000143153;ENSG00000143156 UTR3 Human other chr1:169101935 chr1:169101935 . . 0 21 hm1A_associated_SNPs_103614 0 29213071 QT interval 7e-15 GWAS_Catalog TagSNP rs1138486 GCST005171 GWAS of the electrocardiographic QT interval in Hispanics/Latinos generalizes previously identified loci and identifies population-specific signals.
200 chr1 176809368 176809368 1 + C T rs12118034 176809368 - 176809348 176809388 41 GAAGAGCAGCAGTCTCCCCCGTCATAGTGGCAGTAGGCTCG GAAGAGCAGCAGTCTCCCCCATCATAGTGGCAGTAGGCTCG Direct Gain 0 0.977640867233276 Functional Gain 0.977640867233276 PAPPA2 ENSG00000116183 CDS Human protein_coding chr1:176809368 chr1:176809368 synonymous SNV . 0 21 hm1A_associated_SNPs_103639 0 17463246 Multiple continuous traits in DGI samples 0.000733 Johnson and O'Donnell TagSNP rs12118034 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
201 chr1 176812896 176812896 1 + C T rs1883431 176812896 - 176812876 176812916 41 GGAGACTTGGAACAAGGACCGAGTCTCCCTGATCACTTCCA GGAGACTTGGAACAAGGACCAAGTCTCCCTGATCACTTCCA Direct Gain 0 0.850099444389343 Functional Gain 0.850099444389343 PAPPA2 ENSG00000116183 UTR3 Human protein_coding chr1:176812896 chr1:176812896 . . 0 21 hm1A_associated_SNPs_103640 0 17463246 Multiple continuous traits in DGI samples 0.0002385 Johnson and O'Donnell TagSNP rs1883431 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
202 chr1 180905694 180905694 1 + C T rs3795503 180905694 - 180905674 180905714 41 TGCAGCCCCCGAGGTGCGCTGTTGTTGCAGTTGTTGGTGGA TGCAGCCCCCGAGGTGCGCTATTGTTGCAGTTGTTGGTGGA Direct Gain 0 0.682823956012726 Functional Gain 0.682823956012726 KIAA1614 ENSG00000135835 CDS Human protein_coding chr1:180905694 chr1:180905694 synonymous SNV . 0 21 hm1A_associated_SNPs_103668 0 31015462 Estimated glomerular filtration rate 8e-13 GWAS_Catalog TagSNP rs3795503 GCST007876 Sex-specific and pleiotropic effects underlying kidney function identified from GWAS meta-analysis.
203 chr1 196706642 196706642 1 + C T rs35292876 196706642 - 196706622 196706662 41 CTGGATGAATTAATGGTTCCGTGTTCTATCTGAGGTGGTTG CTGGATGAATTAATGGTTCCATGTTCTATCTGAGGTGGTTG Direct Gain 0 0.968702495098114 Functional Gain 0.968702495098114 CFH ENSG00000000971 CDS Human protein_coding chr1:196706642 chr1:196706642 synonymous SNV . 0 21 hm1A_associated_SNPs_103702 4 26691988 Advanced age-related macular degeneration 8e-37 GWAS_Catalog TagSNP rs35292876 GCST003219 A large genome-wide association study of age-related macular degeneration highlights contributions of rare and common variants.
204 chr1 230416399 230416399 1 + G T rs1043897 230416399 - 230416379 230416419 41 TCCCCAGGCCAGCAGGTGTGCAGGACTGTGAGCCAGGCCTG TCCCCAGGCCAGCAGGTGTGAAGGACTGTGAGCCAGGCCTG Direct Gain 0 0.7706179022789 Functional Gain 0.7706179022789 GALNT2 ENSG00000224407 ncRNA_exonic Human antisense chr1:230416399 chr1:230416399 . . 0 21 hm1A_associated_SNPs_103926 0 30595370 Red cell distribution width 3e-09 GWAS_Catalog TagSNP rs1043897 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
205 chr2 25369002 25369002 1 + C T rs1561288 25369002 - 25368982 25369022 41 CACCCAGATGTGTGTCCTCCGTACTTCTTGTGAACTGTAAC CACCCAGATGTGTGTCCTCCATACTTCTTGTGAACTGTAAC Direct Gain 0 0.984575569629669 Functional Gain 0.984575569629669 EFR3B ENSG00000084710 UTR3 Human protein_coding chr2:25369002 chr2:25369002 . . 0 21 hm1A_associated_SNPs_104097 0 23669352 Body mass index 5e-08 GWAS_Catalog TagSNP rs1561288 GCST002021 Genome-wide analysis of BMI in adolescents and young adults reveals additional insight into the effects of genetic loci over the life course.
206 chr2 128176040 128176040 1 + A T rs1799810 128176040 - 128176020 128176060 41 GTCGTGGAGATACTGCAAGTTCGCCGTCCTGCCGCCATGAC GTCGTGGAGATACTGCAAGTACGCCGTCCTGCCGCCATGAC Direct Gain 0 0.514632046222687 Functional Gain 0.514632046222687 PROC ENSG00000115718 CDS Human protein_coding chr2:128176040 chr2:128176040 synonymous SNV . 0 21 hm1A_associated_SNPs_104408 2 20707712 Self-rated health 9e-06 GWAS_Catalog TagSNP rs1799810 GCST000747 A genome-wide association study of self-rated health.
207 chr2 203777226 203777226 1 + C T rs149163995 203777226 - 203777206 203777246 41 CCGGCGGGTCAGGAGGTGACGGGAGGAGGAGGAGGCAGGAG CCGGCGGGTCAGGAGGTGACAGGAGGAGGAGGAGGCAGGAG Direct Gain 0 0.507367610931396 Functional Gain 0.507367610931396 CARF ENSG00000138380 UTR5 Human protein_coding chr2:203777226 chr2:203777226 . . 0 21 hm1A_associated_SNPs_104586 0 27182965 Migraine 4e-10 GWAS_Catalog TagSNP rs149163995 GCST003986 Detection and interpretation of shared genetic influences on 42 human traits.
208 chr2 241569692 241569692 1 + C T rs3749171 241569692 - 241569672 241569712 41 AGCGGTCCACGGCGATGGCCGTGACCAGGCTGATGCTCATG AGCGGTCCACGGCGATGGCCATGACCAGGCTGATGCTCATG Direct Gain 0 0.998899221420288 Functional Gain 0.998899221420288 GPR35 ENSG00000178623 CDS Human protein_coding chr2:241569692 chr2:241569692 nonsynonymous SNV 0.011 1 21 hm1A_associated_SNPs_104798 0 29562276 Childhood onset ulcerative colitis 9e-07 GWAS_Catalog TagSNP rs3749171 GCST005815 Enhanced Contribution of HLA in Pediatric Onset Ulcerative Colitis.
209 chr4 941518 941518 1 + C T rs2290402 941518 - 941498 941538 41 GGCTGGGACATGGCGGGGCCGCTGCCTGGCGGTTACAGGAG GGCTGGGACATGGCGGGGCCACTGCCTGGCGGTTACAGGAG Direct Gain 0 0.899443507194519 Functional Gain 0.899443507194519 TMEM175 ENSG00000127419 UTR5 Human protein_coding chr4:941518 chr4:941518 . . 0 21 hm1A_associated_SNPs_105444 0 25102180 Type 2 diabetes 7e-06 GWAS_Catalog TagSNP rs2290402 GCST002560 Meta-analysis of genome-wide association studies in African Americans provides insights into the genetic architecture of type 2 diabetes.
210 chr4 3446091 3446091 1 + G T rs3748034 3446091 - 3446071 3446111 41 GTGGCCCTGGCGCACGCGGGCCCAGCGGTCGCCCCCCTCCA GTGGCCCTGGCGCACGCGGGACCAGCGGTCGCCCCCCTCCA Direct Gain 0 0.788309812545776 Functional Gain 0.788309812545776 HGFAC ENSG00000109758 CDS Human protein_coding chr4:3446091 chr4:3446091 nonsynonymous SNV 0.560 1 21 hm1A_associated_SNPs_105531 0 27989323 Hepatocyte growth factor levels 2e-10 GWAS_Catalog TagSNP rs3748034 GCST004449 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
211 chr4 37849004 37849004 1 + C T rs2290741 37849004 - 37848984 37849024 41 CTGGAGAGGCAAAATAAACCGTGTTTCACTGTGGATCTTTG CTGGAGAGGCAAAATAAACCATGTTTCACTGTGGATCTTTG Direct Gain 0 0.908711194992065 Functional Gain 0.908711194992065 PGM2 ENSG00000169299 UTR3 Human protein_coding chr4:37849004 chr4:37849004 . . 0 21 hm1A_associated_SNPs_105671 0 17554300 Multiple complex diseases 0.000150749 Johnson and O'Donnell TagSNP rs2290741 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
212 chr5 14488128 14488128 1 + C T rs115054458 14488128 - 14488108 14488148 41 CCTTGCCGAGAGAAGGGACCGCGCTGGAGAGCGGCGAGTTC CCTTGCCGAGAGAAGGGACCACGCTGGAGAGCGGCGAGTTC Direct Gain 0 0.57271134853363 Functional Gain 0.57271134853363 TRIO ENSG00000038382 CDS Human protein_coding chr5:14488128 chr5:14488128 nonsynonymous SNV 0.039 1 21 hm1A_associated_SNPs_106052 0 27777418 Major depressive disorder 3e-07 GWAS_Catalog TagSNP rs115054458 GCST005547 The PHF21B gene is associated with major depression and modulates the stress response.
213 chr5 72144005 72144005 1 + C T rs34651 72144005 - 72143985 72144025 41 TCCTGGCAGCCCGGCCGCCAGCGTCTGCTGCTGCTGCCGCC TCCTGGCAGCCCGGCCGCCAACGTCTGCTGCTGCTGCCGCC Direct Gain 0 0.713361024856567 Functional Gain 0.713361024856567 TNPO1 ENSG00000083312 intronic Human protein_coding chr5:72144005 chr5:72144005 . . 0 21 hm1A_associated_SNPs_106159 0 27863252 Mean platelet volume 4e-16 GWAS_Catalog TagSNP rs34651 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
214 chr5 109221026 109221026 1 + C T rs112724034 109221026 - 109221006 109221046 41 CGAGGCGCCGGCCTGGGCGTGGGGCACGCGGCCGAGCCTCA CGAGGCGCCGGCCTGGGCGTAGGGCACGCGGCCGAGCCTCA Direct Gain 0 0.56393027305603 Functional Gain 0.56393027305603 LINC01848 ENSG00000253224 ncRNA_exonic Human processed_pseudogene chr5:109221026 chr5:109221026 . . 0 21 hm1A_associated_SNPs_106218 0 23535033 Alzheimer's disease (cognitive decline) 9e-13 GWAS_Catalog TagSNP rs112724034 GCST001915 Genome-wide association study of the rate of cognitive decline in Alzheimer's disease.
215 chr5 118729286 118729286 1 + C T rs1045241 118729286 - 118729266 118729306 41 TCTCCCATGGTCTGTTACCCGTTAGGAAGCTTTTAACCAGA TCTCCCATGGTCTGTTACCCATTAGGAAGCTTTTAACCAGA Direct Gain 0 0.740469217300415 Functional Gain 0.740469217300415 TNFAIP8 ENSG00000145779 UTR3 Human protein_coding chr5:118729286 chr5:118729286 . . 0 21 hm1A_associated_SNPs_106233 0 25673412 Waist-hip ratio 3e-08 GWAS_Catalog TagSNP rs1045241 GCST004064 New genetic loci link adipose and insulin biology to body fat distribution.
216 chr5 131607721 131607721 1 + C T rs10479001 131607721 - 131607701 131607741 41 TCCCGTGCCTTGACGATGGTGCCCCTGATGGGGGGAACGAG TCCCGTGCCTTGACGATGGTACCCCTGATGGGGGGAACGAG Direct Gain 0 0.576669752597809 Functional Gain 0.576669752597809 PDLIM4 ENSG00000131435 CDS Human protein_coding chr5:131607721 chr5:131607721 nonsynonymous SNV 0.989 0 21 hm1A_associated_SNPs_106259 0 28957414 Red cell distribution width 1e-08 GWAS_Catalog TagSNP rs10479001 GCST006804 Red blood cell distribution width: Genetic evidence for aging pathways in 116,666 volunteers.
217 chr5 179126090 179126090 1 + C T rs1134924 179126090 - 179126070 179126110 41 CTCTCACCTCTAGCCTCCCGGGGACCGCGGGGGTGCCCGTG CTCTCACCTCTAGCCTCCCGAGGACCGCGGGGGTGCCCGTG Direct Gain 0 0.814442038536072 Functional Gain 0.814442038536072 CANX ENSG00000127022 CDS Human protein_coding chr5:179126090 chr5:179126090 unknown . 0 21 hm1A_associated_SNPs_106595 0 27863252 White blood cell count 2e-10 GWAS_Catalog TagSNP rs1134924 GCST004610 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
218 chr6 29911030 29911030 1 + C T rs9260151 29911030 - 29911010 29911050 41 GAGAACCTGGCCCCGACCCCGCGGTCAGCCCAGTCCCCCGA GAGAACCTGGCCCCGACCCCACGGTCAGCCCAGTCCCCCGA Direct Gain 0 0.532192349433899 Functional Gain 0.532192349433899 HLA-A ENSG00000206503 intronic Human protein_coding chr6:29911030 chr6:29911030 . . 0 21 hm1A_associated_SNPs_106819 0 29404672 C-peptide levels in type I diabetes 8e-08 GWAS_Catalog TagSNP rs9260151 GCST005436 Meta-genome-wide association studies identify a locus on chromosome 1 and multiple variants in the MHC region for serum C-peptide in type 1 diabetes.
219 chr6 30114955 30114955 1 + C T rs757262 30114955 - 30114935 30114975 41 TGGTGTCTAATTCCTTGGCCGTCCTTTCCAGATCAATGACC TGGTGTCTAATTCCTTGGCCATCCTTTCCAGATCAATGACC Direct Gain 0 0.986261188983917 Functional Gain 0.986261188983917 TRIM40 ENSG00000204614 CDS Human protein_coding chr6:30114955 chr6:30114955 nonsynonymous SNV 0.001 0 21 hm1A_associated_SNPs_106829 0 17554300 Multiple complex diseases 1.89e-12 Johnson and O'Donnell TagSNP rs757262 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
220 chr6 30876152 30876152 1 + C T rs1052693 30876152 - 30876132 30876172 41 CGATCCTCCTCGCGCACCCCGAGTCTCGGGCCGTCGCTTAA CGATCCTCCTCGCGCACCCCAAGTCTCGGGCCGTCGCTTAA Direct Gain 0 0.976228952407837 Functional Gain 0.976228952407837 GTF2H4 ENSG00000213780 UTR5 Human protein_coding chr6:30876152 chr6:30876152 . . 0 21 hm1A_associated_SNPs_106845 0 23028341 Complement C3 and C4 levels 3e-48 GWAS_Catalog TagSNP rs1052693 GCST001679 Genome-wide association study for serum complement C3 and C4 levels in healthy Chinese subjects.
221 chr6 31002616 31002616 1 + C T rs4248154 31002616 - 31002596 31002636 41 CCCACTCCATATCCAAAGCCGTGTGTTCCTCCATGTCCCAT CCCACTCCATATCCAAAGCCATGTGTTCCTCCATGTCCCAT Direct Gain 0 0.98322594165802 Functional Gain 0.98322594165802 MUC22 ENSG00000261272 CDS Human protein_coding chr6:31002616 chr6:31002616 synonymous SNV . 0 21 hm1A_associated_SNPs_106858 0 21900946 Graves' disease 1e-13 GWAS_Catalog TagSNP rs4248154 GCST001219 Identification of independent risk loci for Graves' disease within the MHC in the Japanese population.
222 chr6 31583931 31583931 1 + C T rs2269475 31583931 - 31583911 31583951 41 CCTGCCCCCGCAAATCACCCGTTTCTCACCAATATCGCCAT CCTGCCCCCGCAAATCACCCATTTCTCACCAATATCGCCAT Direct Gain 0 0.998738527297974 Functional Gain 0.998738527297974 AIF1 ENSG00000204472 intronic Human protein_coding chr6:31583931 chr6:31583931 . . 0 21 hm1A_associated_SNPs_106870 0 17804836 Rheumatoid Arthritis 3.65e-12 Johnson and O'Donnell TagSNP rs2269475 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
223 chr6 32948804 32948804 1 + C T rs1049526 32948804 - 32948784 32948824 41 TAGAAGTGAATAGGGCAGCTGTGGCCTCAGGTAACTCCAGA TAGAAGTGAATAGGGCAGCTATGGCCTCAGGTAACTCCAGA Direct Gain 0 0.756294310092926 Functional Gain 0.756294310092926 BRD2 ENSG00000204256 UTR3 Human protein_coding chr6:32948804 chr6:32948804 . . 0 21 hm1A_associated_SNPs_106911 0 28008999 Ulcerative colitis 2e-08 GWAS_Catalog TagSNP rs1049526 GCST003960 Genetic architecture differences between pediatric and adult-onset inflammatory bowel diseases in the Polish population.
224 chr6 33056897 33056897 1 + C T rs9277565 33056897 - 33056877 33056917 41 TCAAGAGCATCTTCACACCCGATGCCCAACTCCCACCTCCT TCAAGAGCATCTTCACACCCAATGCCCAACTCCCACCTCCT Direct Gain 0 0.652688086032867 Functional Gain 0.652688086032867 HLA-DPB1 ENSG00000223865;ENSG00000231461 intergenic Human other chr6:33056897 chr6:33056897 . . 0 21 hm1A_associated_SNPs_106914 0 17804836 Rheumatoid Arthritis 2.26e-06 Johnson and O'Donnell TagSNP rs9277565 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
225 chr6 154407967 154407967 1 + C T rs563649 154407967 - 154407947 154407987 41 TAACTTTTGCTAGATTCACCGTTGGTTATAGACCTGCATGA TAACTTTTGCTAGATTCACCATTGGTTATAGACCTGCATGA Direct Gain 0 0.9550701379776 Functional Gain 0.9550701379776 OPRM1 ENSG00000112038 UTR5 Human protein_coding chr6:154407967 chr6:154407967 . . 0 21 hm1A_associated_SNPs_107281 0 17052657 Parkinson's disease 0.000374696 Johnson and O'Donnell TagSNP rs563649 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
226 chr6 160769811 160769811 1 + C T rs668871 160769811 - 160769791 160769831 41 CACGGCACAAGGGGAGCCGAGCGGTTGGGGAAGGCGGCGAG CACGGCACAAGGGGAGCCGAACGGTTGGGGAAGGCGGCGAG Direct Gain 0 0.973711252212524 Functional Gain 0.973711252212524 SLC22A3 ENSG00000146477 CDS Human protein_coding chr6:160769811 chr6:160769811 synonymous SNV . 0 21 hm1A_associated_SNPs_107325 0 30595370 Waist-hip ratio 8e-30 GWAS_Catalog TagSNP rs668871 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
227 chr6 161152905 161152905 1 + C T rs4252129 161152905 - 161152885 161152925 41 ATTTTTTTCCAGACCCGCCCGTGGATTTGTCTCTGGAGTGA ATTTTTTTCCAGACCCGCCCATGGATTTGTCTCTGGAGTGA Direct Gain 0 0.988340258598328 Functional Gain 0.988340258598328 PLG ENSG00000122194 CDS Human protein_coding chr6:161152905 chr6:161152905 nonsynonymous SNV 0.951 0 21 hm1A_associated_SNPs_107327 0 29875488 Blood protein levels 1e-25 GWAS_Catalog TagSNP rs4252129 GCST005806 Genomic atlas of the human plasma proteome.
228 chr6 167754975 167754975 1 + G T rs12528714 167754975 - 167754955 167754995 41 TTGGTCTTGCAGGAGTGCGACTGGAAGAGGGACGCGTAGGG TTGGTCTTGCAGGAGTGCGAATGGAAGAGGGACGCGTAGGG Direct Gain 0 0.533908784389496 Functional Gain 0.533908784389496 TTLL2 ENSG00000120440 CDS Human protein_coding chr6:167754975 chr6:167754975 nonsynonymous SNV 0.000 2 21 hm1A_associated_SNPs_107341 0 23382691 IgG glycosylation 8e-06 GWAS_Catalog TagSNP rs12528714 GCST001848 Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers.
229 chr7 1885178 1885178 1 + C T rs140364877 1885178 - 1885158 1885198 41 CGTGAACCAGAGCCGGACGCGTGTCTGCGTGGAGCACGTCC CGTGAACCAGAGCCGGACGCATGTCTGCGTGGAGCACGTCC Direct Gain 0 0.800783574581146 Functional Gain 0.800783574581146 MAD1L1 ENSG00000002822;ENSG00000176349 intronic Human other chr7:1885178 chr7:1885178 . . 0 21 hm1A_associated_SNPs_107434 0 28540026 Autism spectrum disorder or schizophrenia 2e-11 GWAS_Catalog TagSNP rs140364877 GCST004521 Meta-analysis of GWAS of over 16,000 individuals with autism spectrum disorder highlights a novel locus at 10q24.32 and a significant overlap with schizophrenia.
230 chr7 4832198 4832198 1 + C T rs11971803 4832198 - 4832178 4832218 41 TTCCTGGGCTGGAACCTGGCGGTGAGGACCCCGCGGTTCGG TTCCTGGGCTGGAACCTGGCAGTGAGGACCCCGCGGTTCGG Direct Gain 0 0.535200774669647 Functional Gain 0.535200774669647 AP5Z1 ENSG00000242802 downstream Human protein_coding chr7:4832198 chr7:4832198 . . 0 21 hm1A_associated_SNPs_107518 1 27082954 Peripheral arterial disease (traffic-related air pollution interaction) 9e-06 GWAS_Catalog TagSNP rs11971803 GCST004482 Genetic Variants in the Bone Morphogenic Protein Gene Family Modify the Association between Residential Exposure to Traffic and Peripheral Arterial Disease.
231 chr7 21582917 21582917 1 + C T rs2285942 21582917 - 21582897 21582937 41 GCCCCCGAGGTTAGGCGAAGGGTCGGGGCTTCTCTGAAGTC GCCCCCGAGGTTAGGCGAAGAGTCGGGGCTTCTCTGAAGTC Direct Gain 0 0.959874868392944 Functional Gain 0.959874868392944 DNAH11 ENSG00000105877 CDS Human protein_coding chr7:21582917 chr7:21582917 synonymous SNV . 0 21 hm1A_associated_SNPs_107581 2 29507422 Total cholesterol levels 4e-07 GWAS_Catalog TagSNP rs2285942 GCST007143 A large electronic-health-record-based genome-wide study of serum lipids.
232 chr7 22612164 22612164 1 + C T rs2023718 22612164 - 22612144 22612184 41 AATAACTTTCTGTTGAAGCCGTCCAGTTTTGAAGCCACCCA AATAACTTTCTGTTGAAGCCATCCAGTTTTGAAGCCACCCA Direct Gain 0 0.83306097984314 Functional Gain 0.83306097984314 LOC100506178 ENSG00000225541;ENSG00000232759 ncRNA_exonic Human other chr7:22612164 chr7:22612164 . . 0 21 hm1A_associated_SNPs_107585 0 17554300 Multiple complex diseases 0.000588953 Johnson and O'Donnell TagSNP rs2023718 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
233 chr7 50610613 50610613 1 + C T rs3807553 50610613 - 50610593 50610633 41 GAAGGCATAAGGTCAGACAAGGTTACAGTCCACTGATCATG GAAGGCATAAGGTCAGACAAAGTTACAGTCCACTGATCATG Direct Gain 0 0.560335576534271 Functional Gain 0.560335576534271 DDC-AS1 ENSG00000226122 ncRNA_exonic Human antisense chr7:50610613 chr7:50610613 . . 0 21 hm1A_associated_SNPs_107734 0 29594489 Clostridium difficile infection in multiple myeloma 2e-06 GWAS_Catalog TagSNP rs3807553 GCST005686 Host genetic susceptibility to Clostridium difficile infections in patients undergoing autologous stem cell transplantation: a genome-wide association study.
234 chr7 72395789 72395789 1 + C T rs141884613 72395789 - 72395769 72395809 41 CGGCACGAGGTACAGTAAGAGGCCAACCAGCGACAGGCCCA CGGCACGAGGTACAGTAAGAAGCCAACCAGCGACAGGCCCA Direct Gain 0 0.596421718597412 Functional Gain 0.596421718597412 POM121 ENSG00000196313 CDS Human protein_coding chr7:72395789 chr7:72395789 nonsynonymous SNV 0.054 3 21 hm1A_associated_SNPs_107774 0 30595370 Body mass index 8e-09 GWAS_Catalog TagSNP rs141884613 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
235 chr9 2622134 2622134 1 + C T rs34881325 2622134 - 2622114 2622154 41 CGCCGCCGTTCGCTCCGCACGACAAGTTACCAGTCCTTCCG CGCCGCCGTTCGCTCCGCACAACAAGTTACCAGTCCTTCCG Direct Gain 0 0.750682592391968 Functional Gain 0.750682592391968 VLDLR-AS1 ENSG00000236404 ncRNA_exonic Human antisense chr9:2622134 chr9:2622134 . . 0 21 hm1A_associated_SNPs_108766 1 27989323 Vascular endothelial growth factor levels 3e-10 GWAS_Catalog TagSNP rs34881325 GCST004422 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
236 chr9 78505692 78505692 1 + C T rs76937529 78505692 - 78505672 78505712 41 GACCAGCGGGAGCGGTACAGGCAGCGACCGGGCGCCCCCTC GACCAGCGGGAGCGGTACAGACAGCGACCGGGCGCCCCCTC Direct Gain 0 0.760505199432373 Functional Gain 0.760505199432373 PCSK5 ENSG00000099139 UTR5 Human protein_coding chr9:78505692 chr9:78505692 . . 0 21 hm1A_associated_SNPs_108876 0 30595370 Waist-hip ratio 5e-09 GWAS_Catalog TagSNP rs76937529 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
237 chr9 123914874 123914874 1 + C T rs9408926 123914874 - 123914854 123914894 41 ATCATCAATATTATGATGCAGTTCTTCCATTTCTTTCTCCG ATCATCAATATTATGATGCAATTCTTCCATTTCTTTCTCCG Direct Gain 0 0.962912619113922 Functional Gain 0.962912619113922 CNTRL ENSG00000119397 CDS Human protein_coding chr9:123914874 chr9:123914874 synonymous SNV . 0 21 hm1A_associated_SNPs_109026 0 22610502 Immune reponse to smallpox (secreted IFN-alpha) 4e-08 GWAS_Catalog TagSNP rs9408926 GCST001538 Genome-wide analysis of polymorphisms associated with cytokine responses in smallpox vaccine recipients.
238 chr9 136243324 136243324 1 + C T rs3739893 136243324 - 136243304 136243344 41 GATCAGTAGCGACCGCGTACGGGCGAGCGTCCACCCCTGGC GATCAGTAGCGACCGCGTACAGGCGAGCGTCCACCCCTGGC Direct Gain 0 0.544743120670319 Functional Gain 0.544743120670319 STKLD1 ENSG00000198870 UTR5 Human protein_coding chr9:136243324 chr9:136243324 . . 0 21 hm1A_associated_SNPs_109233 0 29296746 ADAMTS13 levels 1e-30 GWAS_Catalog TagSNP rs3739893 GCST005945 Genetic variants in ADAMTS13 as well as smoking are major determinants of plasma ADAMTS13 levels.
239 chr9 136291063 136291063 1 + C T rs3118667 136291063 - 136291043 136291083 41 AGGTTGGCTGTGATATTTGGGGCACCCTGCGGACCCACAGC AGGTTGGCTGTGATATTTGGAGCACCCTGCGGACCCACAGC Direct Gain 0 0.523435413837433 Functional Gain 0.523435413837433 ADAMTS13 ENSG00000160323 CDS Human protein_coding chr9:136291063 chr9:136291063 synonymous SNV . 0 21 hm1A_associated_SNPs_109236 0 25934476 ADAMTS13 activity 1e-20 GWAS_Catalog TagSNP rs3118667 GCST002881 Genetic variants in the ADAMTS13 and SUPT3H genes are associated with ADAMTS13 activity.
240 chr10 12875208 12875208 1 + C T rs10906233 12875208 - 12875188 12875228 41 CAGATGAGTGGGATGAGTACGGGGTAGGTAAACCGAGTCCG CAGATGAGTGGGATGAGTACAGGGTAGGTAAACCGAGTCCG Direct Gain 0 0.700100243091583 Functional Gain 0.700100243091583 CAMK1D ENSG00000183049 UTR3 Human protein_coding chr10:12875208 chr10:12875208 . . 0 21 hm1A_associated_SNPs_109524 0 23568457 Eating disorders 4e-06 GWAS_Catalog TagSNP rs10906233 GCST001960 Genetic variants associated with disordered eating.
241 chr10 104835919 104835919 1 + C T rs943037 104835919 - 104835899 104835939 41 CTCCCCAGTGTTGGTGTGACGGCGTCAATCCGGTCGCTTCG CTCCCCAGTGTTGGTGTGACAGCGTCAATCCGGTCGCTTCG Direct Gain 0 0.54829329252243 Functional Gain 0.54829329252243 CNNM2 ENSG00000148842 CDS Human protein_coding chr10:104835919 chr10:104835919 synonymous SNV . 0 21 hm1A_associated_SNPs_109901 1 27618452 Systolic blood pressure 2e-27 GWAS_Catalog TagSNP rs943037 GCST006259 The genetics of blood pressure regulation and its target organs from association studies in 342,415 individuals.
242 chr10 111967555 111967555 1 + C T rs1475502 111967555 - 111967535 111967575 41 TTTGCCCATGGAGGAGCGGGGGTCCGCCGAGCTCGTCCTCT TTTGCCCATGGAGGAGCGGGAGTCCGCCGAGCTCGTCCTCT Direct Gain 0 0.937868356704712 Functional Gain 0.937868356704712 MXI1 ENSG00000119950 UTR5 Human protein_coding chr10:111967555 chr10:111967555 . . 0 21 hm1A_associated_SNPs_109925 0 30595370 Height 1e-09 GWAS_Catalog TagSNP rs1475502 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
243 chr11 1874221 1874221 1 + C T rs907612 1874221 - 1874201 1874241 41 CAGGTTGAGGTTTGGAACCTGTCTCGGCTTGGGTCAGGGTG CAGGTTGAGGTTTGGAACCTATCTCGGCTTGGGTCAGGGTG Direct Gain 0 0.894725561141968 Functional Gain 0.894725561141968 LSP1 ENSG00000130592 UTR5 Human protein_coding chr11:1874221 chr11:1874221 . . 0 21 hm1A_associated_SNPs_110269 0 27863252 Monocyte count 5e-16 GWAS_Catalog TagSNP rs907612 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
244 chr11 1892562 1892562 1 + G T rs78405116 1892562 - 1892542 1892582 41 CTGTTTCACATCTCTGCCCCCATCTGCGGCGACCAGCCTGG CTGTTTCACATCTCTGCCCCAATCTGCGGCGACCAGCCTGG Direct Gain 0 0.636587083339691 Functional Gain 0.636587083339691 LSP1 ENSG00000130592 UTR5 Human protein_coding chr11:1892562 chr11:1892562 . . 0 21 hm1A_associated_SNPs_110274 0 25710614 Milk allergy 2e-06 GWAS_Catalog TagSNP rs78405116 GCST002788 Genome-wide association study identifies peanut allergy-specific loci and evidence of epigenetic mediation in US children.
245 chr11 47270255 47270255 1 + C T rs2167079 47270255 - 47270235 47270275 41 GGTGGTGATGCCGCCCACCCGGGCCCGGAGTCTGCGCTTCG GGTGGTGATGCCGCCCACCCAGGCCCGGAGTCTGCGCTTCG Direct Gain 0 0.680372357368469 Functional Gain 0.680372357368469 ACP2 ENSG00000134575 CDS Human protein_coding chr11:47270255 chr11:47270255 nonsynonymous SNV 0.992 0 21 hm1A_associated_SNPs_110476 0 17357082 Progressive Supranuclear Palsy 0.002 Johnson and O'Donnell TagSNP rs2167079 . Identification of a novel risk locus for progressive supranuclear palsy by a pooled genomewide scan of 500,288 single-nucleotide polymorphisms.
246 chr11 47587452 47587452 1 + C T rs11537751 47587452 - 47587432 47587472 41 CTCGTCCTGTACCAGCTGCCGAGGCAAAGAGGTGGCTCAGC CTCGTCCTGTACCAGCTGCCAAGGCAAAGAGGTGGCTCAGC Direct Gain 0 0.91196608543396 Functional Gain 0.91196608543396 PTPMT1 ENSG00000110536 CDS Human protein_coding chr11:47587452 chr11:47587452 nonsynonymous SNV 0.988 3 21 hm1A_associated_SNPs_110487 0 27618448 Hypertension 7e-08 GWAS_Catalog TagSNP rs11537751 GCST006229 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
247 chr11 55889895 55889895 1 + C T rs61751933 55889895 - 55889875 55889915 41 CTTCAGAGTCTGACAGTCCCGTAAGGATGAAGTCAGCCACA CTTCAGAGTCTGACAGTCCCATAAGGATGAAGTCAGCCACA Direct Gain 0 0.980462312698364 Functional Gain 0.980462312698364 OR8H3 ENSG00000181761 CDS Human protein_coding chr11:55889895 chr11:55889895 nonsynonymous SNV 0.003 0 21 hm1A_associated_SNPs_110493 0 29617998 Intraocular pressure 2e-11 GWAS_Catalog TagSNP rs61751933 GCST005580 Genome-Wide Association Analyses Identify New Loci Influencing Intraocular Pressure.
248 chr11 102980324 102980324 1 + C T rs17301028 102980324 - 102980304 102980344 41 AAGATGAAGAGCTTCCGAACGTCCGCAGTCCCGTTCGCCAT AAGATGAAGAGCTTCCGAACATCCGCAGTCCCGTTCGCCAT Direct Gain 0 0.717411577701569 Functional Gain 0.717411577701569 DYNC2H1 ENSG00000187240 CDS Human protein_coding chr11:102980324 chr11:102980324 synonymous SNV . 0 21 hm1A_associated_SNPs_110937 3 17998437 Alzheimer's disease 0.000489 Johnson and O'Donnell TagSNP rs17301028 . Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.
249 chr11 117070361 117070361 1 + C T rs74949440 117070361 - 117070341 117070381 41 CGGGGCATTTCAATGAGCCCGGGGCTGCCCAGTCTGAGAGA CGGGGCATTTCAATGAGCCCAGGGCTGCCCAGTCTGAGAGA Direct Gain 0 0.879843533039093 Functional Gain 0.879843533039093 LOC100652768 ENSG00000149591 UTR5 Human protein_coding chr11:117070361 chr11:117070361 . . 0 21 hm1A_associated_SNPs_110978 0 29059430 Breast cancer in childhood cancer survivors treated with more than 10 gray radiotherapy 6e-08 GWAS_Catalog TagSNP rs74949440 GCST005112 Genome-Wide Association Study to Identify Susceptibility Loci That Modify Radiation-Related Risk for Breast Cancer After Childhood Cancer.
250 chr12 6938872 6938872 1 + C T rs3741920 6938872 - 6938852 6938892 41 ATCAGAACCGCCCACCGCCCGAACTGCAGATCCCCTAGAGG ATCAGAACCGCCCACCGCCCAAACTGCAGATCCCCTAGAGG Direct Gain 0 0.741790294647217 Functional Gain 0.741790294647217 P3H3 ENSG00000110811;ENSG00000250510 intronic Human other chr12:6938872 chr12:6938872 . . 0 21 hm1A_associated_SNPs_111179 0 22437554 Response to Vitamin E supplementation 4e-06 GWAS_Catalog TagSNP rs3741920 GCST001450 Genome-wide association study identifies three common variants associated with serologic response to vitamin E supplementation in men.
251 chr12 10170161 10170161 1 + G T rs1054611 10170161 - 10170141 10170181 41 TCTAACCTGTGTTTGACATGCTGGCTTGTCTGACAGCTGCA TCTAACCTGTGTTTGACATGATGGCTTGTCTGACAGCTGCA Direct Gain 0 0.849853277206421 Functional Gain 0.849853277206421 LOC102724020 ENSG00000256803 ncRNA_intronic Human antisense chr12:10170161 chr12:10170161 . . 0 21 hm1A_associated_SNPs_111219 0 23834954 Sensory disturbances after bilateral sagittal split ramus osteotomy 6e-06 GWAS_Catalog TagSNP rs1054611 GCST002090 Genome-wide association study of sensory disturbances in the inferior alveolar nerve after bilateral sagittal split ramus osteotomy.
252 chr12 52471159 52471159 1 + C T rs11521 52471159 - 52471139 52471179 41 AGTAGAGGCAGGACTGAACCGTCAGCAAAGATTAAAAGGAT AGTAGAGGCAGGACTGAACCATCAGCAAAGATTAAAAGGAT Direct Gain 0 0.844428062438965 Functional Gain 0.844428062438965 ATG101 ENSG00000257663 ncRNA_exonic Human antisense chr12:52471159 chr12:52471159 . . 0 21 hm1A_associated_SNPs_111356 0 30595370 Red blood cell count 8e-09 GWAS_Catalog TagSNP rs11521 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
253 chr14 23848311 23848311 1 + C T rs723840 23848311 - 23848291 23848331 41 AAAGCAGCAATGGCAGCTCCGTCCCGGGAGGTCACAGCTGC AAAGCAGCAATGGCAGCTCCATCCCGGGAGGTCACAGCTGC Direct Gain 0 0.995154738426208 Functional Gain 0.995154738426208 CMTM5 ENSG00000166091 CDS Human protein_coding chr14:23848311 chr14:23848311 synonymous SNV . 0 21 hm1A_associated_SNPs_112107 0 31085060 Emotional lability in attention deficit hyperactivity disorder 4e-06 GWAS_Catalog TagSNP rs723840 GCST007880 Genome-wide analysis of emotional lability in adult attention deficit hyperactivity disorder (ADHD).
254 chr15 25355468 25355468 1 + C T rs8030752 25355468 - 25355448 25355488 41 GCATATGTGTCTGCTGGTCCGTCAAGCACAAGACAGTGGGA GCATATGTGTCTGCTGGTCCATCAAGCACAAGACAGTGGGA Direct Gain 0 0.971269965171814 Functional Gain 0.971269965171814 SNHG14 ENSG00000224078 ncRNA_exonic Human processed_transcript chr15:25355468 chr15:25355468 . . 0 21 hm1A_associated_SNPs_112591 0 17463246 Multiple continuous traits in DGI samples 0.0008194 Johnson and O'Donnell TagSNP rs8030752 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
255 chr15 33025627 33025627 1 + C T rs3743103 33025627 - 33025607 33025647 41 TGCCAACTTAAGTCATCTCCGTTAACGAAATTGCATTCTTG TGCCAACTTAAGTCATCTCCATTAACGAAATTGCATTCTTG Direct Gain 0 0.740186929702759 Functional Gain 0.740186929702759 GREM1 ENSG00000166923 UTR3 Human protein_coding chr15:33025627 chr15:33025627 . . 0 21 hm1A_associated_SNPs_112623 0 27182965 Monobrow 5e-25 GWAS_Catalog TagSNP rs3743103 GCST003996 Detection and interpretation of shared genetic influences on 42 human traits.
256 chr15 41136885 41136885 1 + C T rs11549914 41136885 - 41136865 41136905 41 CAGGCAGTCGGCTCCCGCGGGCAGCCCAGGGGGCGCGGGCG CAGGCAGTCGGCTCCCGCGGACAGCCCAGGGGGCGCGGGCG Direct Gain 0 0.94860565662384 Functional Gain 0.94860565662384 SPINT1 ENSG00000166145 CDS Human protein_coding chr15:41136885 chr15:41136885 nonsynonymous SNV 0.383 0 21 hm1A_associated_SNPs_112663 0 29875488 Blood protein levels 6e-19 GWAS_Catalog TagSNP rs11549914 GCST005806 Genomic atlas of the human plasma proteome.
257 chr15 44720011 44720011 1 + C T rs116908763 44720011 - 44719991 44720031 41 CCTGGAAGAGGAGGAGGACTGAGATTGGAAGCAGCGGCGGC CCTGGAAGAGGAGGAGGACTAAGATTGGAAGCAGCGGCGGC Direct Gain 0 0.979173541069031 Functional Gain 0.979173541069031 CTDSPL2 ENSG00000137770 UTR5 Human protein_coding chr15:44720011 chr15:44720011 . . 0 21 hm1A_associated_SNPs_112720 0 27863252 Mean corpuscular hemoglobin 2e-10 GWAS_Catalog TagSNP rs116908763 GCST004630 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
258 chr15 74338462 74338462 1 + C T rs1036673 74338462 - 74338442 74338482 41 GCCAGATGGCCGCTCTGACCGTGGAGGCCAATCAGCCCATT GCCAGATGGCCGCTCTGACCATGGAGGCCAATCAGCCCATT Direct Gain 0 0.97283399105072 Functional Gain 0.97283399105072 PML ENSG00000140464 UTR3 Human protein_coding chr15:74338462 chr15:74338462 . . 0 21 hm1A_associated_SNPs_112869 0 17690259 Glaucoma 0.0013 Johnson and O'Donnell TagSNP rs1036673 . Common sequence variants in the LOXL1 gene confer susceptibility to exfoliation glaucoma.
259 chr15 89398105 89398105 1 + C T rs2351491 89398105 - 89398085 89398125 41 TCCTCTGTTGCTGCGCCAGTGGGAGGCCAAGTAGGAAGGAT TCCTCTGTTGCTGCGCCAGTAGGAGGCCAAGTAGGAAGGAT Direct Gain 0 0.927289664745331 Functional Gain 0.927289664745331 ACAN ENSG00000157766 CDS Human protein_coding chr15:89398105 chr15:89398105 synonymous SNV . 0 21 hm1A_associated_SNPs_113003 0 21998595 Height 2e-09 GWAS_Catalog TagSNP rs2351491 GCST001263 Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry.
260 chr16 632138 632138 1 + C T rs4262946 632138 - 632118 632158 41 GCACCCGGGTGCTGCTGGCCGTGGCCACCCACGAAGCTCTC GCACCCGGGTGCTGCTGGCCATGGCCACCCACGAAGCTCTC Direct Gain 0 0.968684613704681 Functional Gain 0.968684613704681 PIGQ ENSG00000007541 intronic Human protein_coding chr16:632138 chr16:632138 . . 0 21 hm1A_associated_SNPs_113154 0 30595370 Red cell distribution width 2e-09 GWAS_Catalog TagSNP rs4262946 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
261 chr16 2222286 2222286 1 + C T rs11547311 2222286 - 2222266 2222306 41 CTGCCCGCTACCCGGCAGCCGTGCCGGCAGTGGATGAAGAG CTGCCCGCTACCCGGCAGCCATGCCGGCAGTGGATGAAGAG Direct Gain 0 0.995600759983063 Functional Gain 0.995600759983063 TRAF7 ENSG00000131653 CDS Human protein_coding chr16:2222286 chr16:2222286 synonymous SNV . 0 21 hm1A_associated_SNPs_113323 0 28552196 Height 7e-07 GWAS_Catalog TagSNP rs11547311 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
262 chr16 28875204 28875204 1 + A T rs11864750 28875204 - 28875184 28875224 41 CGGCGGCGGCTCCCGCTCCCTGCGCCCCCACCCACTACGCG CGGCGGCGGCTCCCGCTCCCAGCGCCCCCACCCACTACGCG Direct Gain 0 0.935160756111145 Functional Gain 0.935160756111145 SH2B1 ENSG00000178188 UTR5 Human protein_coding chr16:28875204 chr16:28875204 . . 0 21 hm1A_associated_SNPs_113623 0 30038396 Highest math class taken (MTAG) 7e-37 GWAS_Catalog TagSNP rs11864750 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
263 chr16 30492823 30492823 1 + C T rs1064524 30492823 - 30492803 30492843 41 CAGAGCATCAGGGTCCTTCCGTTTAACATAATCTGAGAAAT CAGAGCATCAGGGTCCTTCCATTTAACATAATCTGAGAAAT Direct Gain 0 0.997532844543457 Functional Gain 0.997532844543457 ITGAL ENSG00000005844 CDS Human protein_coding chr16:30492823 chr16:30492823 nonsynonymous SNV 0.006 2 21 hm1A_associated_SNPs_113666 0 24556642 Smooth-surface caries 2e-07 GWAS_Catalog TagSNP rs1064524 GCST002361 Genome-wide association study of primary dentition pit-and-fissure and smooth surface caries.
264 chr16 31141993 31141993 1 + C T rs1549293 31141993 - 31141973 31142013 41 CCAGGATGGTGACAGGGTATGAGGAAGCAGGATCGTGGCCC CCAGGATGGTGACAGGGTATAAGGAAGCAGGATCGTGGCCC Direct Gain 0 0.737429857254028 Functional Gain 0.737429857254028 KAT8 ENSG00000103510 UTR3 Human protein_coding chr16:31141993 chr16:31141993 . . 0 21 hm1A_associated_SNPs_113692 0 25673412 Waist circumference 7e-09 GWAS_Catalog TagSNP rs1549293 GCST004065 New genetic loci link adipose and insulin biology to body fat distribution.
265 chr16 31343005 31343005 1 + C T rs1143678 31343005 - 31342985 31343025 41 CTGGGGTTCGGCCCCCGGGGGACCCCCTTCACTCATCATGT CTGGGGTTCGGCCCCCGGGGAACCCCCTTCACTCATCATGT Direct Gain 0 0.965160369873047 Functional Gain 0.965160369873047 ITGAM ENSG00000169896 CDS Human protein_coding chr16:31343005 chr16:31343005 nonsynonymous SNV 0.183 1 21 hm1A_associated_SNPs_113702 0 18204446 Systemic Lupus Erythematosus (SLE), gender differentiated in women 3.7e-16 Johnson and O'Donnell TagSNP rs1143678 . Genome-wide association scan in women with systemic lupus erythematosus identifies susceptibility variants in ITGAM, PXK, KIAA1542 and other loci.
266 chr16 57413660 57413660 1 + C T rs62037084 57413660 - 57413640 57413680 41 AGGGCAGTACCTACATGATTGCGCGTTTGCCGCATGATGCC AGGGCAGTACCTACATGATTACGCGTTTGCCGCATGATGCC Direct Gain 0 0.594658672809601 Functional Gain 0.594658672809601 CX3CL1 ENSG00000006210 CDS Human protein_coding chr16:57413660 chr16:57413660 nonsynonymous SNV 0.108 1 21 hm1A_associated_SNPs_113773 0 29875488 Blood protein levels 3e-15 GWAS_Catalog TagSNP rs62037084 GCST005806 Genomic atlas of the human plasma proteome.
267 chr16 67572130 67572130 1 + C T rs567068501 67572130 - 67572110 67572150 41 GCGACTCGGCCTCGGACTCAGCGTGGCCTCGGCTCGGCCCC GCGACTCGGCCTCGGACTCAACGTGGCCTCGGCTCGGCCCC Direct Gain 0 0.933475852012634 Functional Gain 0.933475852012634 RIPOR1 ENSG00000039523 UTR5 Human protein_coding chr16:67572130 chr16:67572130 . . 0 21 hm1A_associated_SNPs_113839 0 30598549 Heel bone mineral density 5e-15 GWAS_Catalog TagSNP rs567068501 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
268 chr16 84698110 84698110 1 + C T rs16974367 84698110 - 84698090 84698130 41 AATATGAAGCGCAGGACGTCGTATGTAACTCATGAGGCACA AATATGAAGCGCAGGACGTCATATGTAACTCATGAGGCACA Direct Gain 0 0.588315904140472 Functional Gain 0.588315904140472 KLHL36 ENSG00000135686;ENSG00000103194 intergenic Human other chr16:84698110 chr16:84698110 . . 0 21 hm1A_associated_SNPs_113937 0 17554300 Multiple complex diseases 0.000462206 Johnson and O'Donnell TagSNP rs16974367 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
269 chr16 87259939 87259939 1 + C T rs12599613 87259939 - 87259919 87259959 41 CAGGTCTATGCTGGAAGGACGTTTACGGAGGTCTCCTGTGT CAGGTCTATGCTGGAAGGACATTTACGGAGGTCTCCTGTGT Direct Gain 0 0.949277281761169 Functional Gain 0.949277281761169 LOC101928708 ENSG00000261095 ncRNA_exonic Human lincRNA chr16:87259939 chr16:87259939 . . 0 21 hm1A_associated_SNPs_113979 0 17463246 Multiple continuous traits in DGI samples 0.0003456 Johnson and O'Donnell TagSNP rs12599613 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
270 chr16 89235401 89235401 1 + C T rs117156175 89235401 - 89235381 89235421 41 CTTAGGCCAGTCACAGCCCCGTTACCGAAGAGGCAGTGGGG CTTAGGCCAGTCACAGCCCCATTACCGAAGAGGCAGTGGGG Direct Gain 0 0.999063313007355 Functional Gain 0.999063313007355 LINC02138 ENSG00000205015 ncRNA_exonic Human lincRNA chr16:89235401 chr16:89235401 . . 0 21 hm1A_associated_SNPs_114040 0 29739929 Low tan response 1e-173 GWAS_Catalog TagSNP rs117156175 GCST005897 Genome-wide association study in 176,678 Europeans reveals genetic loci for tanning response to sun exposure.
271 chr16 90032455 90032455 1 + C T rs117204628 90032455 - 90032435 90032475 41 GCCAGGGCCGCACCCCAGGGGTCTCCGGAGCAGAAGGAACA GCCAGGGCCGCACCCCAGGGATCTCCGGAGCAGAAGGAACA Direct Gain 0 0.722843706607819 Functional Gain 0.722843706607819 DEF8 ENSG00000140995 UTR3 Human protein_coding chr16:90032455 chr16:90032455 . . 0 21 hm1A_associated_SNPs_114079 0 30531825 Brown vs. black hair color 8e-28 GWAS_Catalog TagSNP rs117204628 GCST006989 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
272 chr17 1673276 1673276 1 + C T rs1136287 1673276 - 1673256 1673296 41 GCACGTTGGTCGTGGGGCTCGTGCTGGATCGCACCCGGTAC GCACGTTGGTCGTGGGGCTCATGCTGGATCGCACCCGGTAC Direct Gain 0 0.715135991573334 Functional Gain 0.715135991573334 SERPINF1 ENSG00000132386 CDS Human protein_coding chr17:1673276 chr17:1673276 nonsynonymous SNV 0.003 1 21 hm1A_associated_SNPs_114116 1 30072576 Blood protein levels 5e-49 GWAS_Catalog TagSNP rs1136287 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
273 chr17 7417640 7417640 1 + C T rs8753 7417640 - 7417620 7417660 41 TGCATCAGAAACGGGATCCAGAAGTTCACCGGGAGCTCTGC TGCATCAGAAACGGGATCCAAAAGTTCACCGGGAGCTCTGC Direct Gain 0 0.637164354324341 Functional Gain 0.637164354324341 POLR2A ENSG00000181222 UTR3 Human protein_coding chr17:7417640 chr17:7417640 . . 0 21 hm1A_associated_SNPs_114231 0 26424050 Non-glioblastoma glioma 8e-18 GWAS_Catalog TagSNP rs8753 GCST003227 Genome-wide association study identifies multiple susceptibility loci for glioma.
274 chr17 7554772 7554772 1 + C T rs1642762 7554772 - 7554752 7554792 41 GAGAAGCGGGGGCGCCGCGCGCTGAAGCCCTCCACACACCC GAGAAGCGGGGGCGCCGCGCACTGAAGCCCTCCACACACCC Direct Gain 0 0.701058626174927 Functional Gain 0.701058626174927 ATP1B2 ENSG00000129244 UTR5 Human protein_coding chr17:7554772 chr17:7554772 . . 0 21 hm1A_associated_SNPs_114240 0 29875488 Blood protein levels 2e-29 GWAS_Catalog TagSNP rs1642762 GCST005806 Genomic atlas of the human plasma proteome.
275 chr17 38173637 38173637 1 + C T rs146890554 38173637 - 38173617 38173657 41 GCCAAGGGGATGCAGGGGCCGCTGTGCAGTCGGCTGAGGCC GCCAAGGGGATGCAGGGGCCACTGTGCAGTCGGCTGAGGCC Direct Gain 0 0.533103823661804 Functional Gain 0.533103823661804 CSF3 ENSG00000108342 UTR3 Human protein_coding chr17:38173637 chr17:38173637 . . 0 21 hm1A_associated_SNPs_114498 0 27863252 Neutrophil percentage of white cells 1e-13 GWAS_Catalog TagSNP rs146890554 GCST004633 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
276 chr17 40716235 40716235 1 + C T rs668799 40716235 - 40716215 40716255 41 CCCTCAAAATGGCCTTCCCCGTCCCCCATCCACTCCCTCTG CCCTCAAAATGGCCTTCCCCATCCCCCATCCACTCCCTCTG Direct Gain 0 0.999387979507446 Functional Gain 0.999387979507446 COASY ENSG00000068120 intronic Human protein_coding chr17:40716235 chr17:40716235 . . 0 21 hm1A_associated_SNPs_114526 0 31015401 Medication use (drugs used in diabetes) 7e-09 GWAS_Catalog TagSNP rs668799 GCST007923 Genome-wide association study of medication-use and associated disease in the UK Biobank.
277 chr17 40913366 40913366 1 + C T rs9892728 40913366 - 40913346 40913386 41 CCGCGCTCACCGCCCAGCAGGAGGAGGAGGCGGAGCGCTGC CCGCGCTCACCGCCCAGCAGAAGGAGGAGGCGGAGCGCTGC Direct Gain 0 0.930658280849457 Functional Gain 0.930658280849457 RAMP2 ENSG00000131477 CDS Human protein_coding chr17:40913366 chr17:40913366 synonymous SNV . 0 21 hm1A_associated_SNPs_114535 0 30718926 Type 2 diabetes 4e-08 GWAS_Catalog TagSNP rs9892728 GCST007847 Identification of 28 new susceptibility loci for type 2 diabetes in the Japanese population.
278 chr17 48919039 48919039 1 + C T rs3803884 48919039 - 48919019 48919059 41 TGAACTAGATCGACAAACCAGTGCAGCCAAGGAGAAGAAAT TGAACTAGATCGACAAACCAATGCAGCCAAGGAGAAGAAAT Direct Gain 0 0.737504124641418 Functional Gain 0.737504124641418 WFIKKN2 ENSG00000173714 UTR3 Human protein_coding chr17:48919039 chr17:48919039 . . 0 21 hm1A_associated_SNPs_114674 0 28240269 Blood protein levels 1e-40 GWAS_Catalog TagSNP rs3803884 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
279 chr17 75211208 75211208 1 + C T rs3744064 75211208 - 75211188 75211228 41 ACTAAGTTTCCACTCACCCCGTCCCCCCAGCACCCCCACCG ACTAAGTTTCCACTCACCCCATCCCCCCAGCACCCCCACCG Direct Gain 0 0.956685602664948 Functional Gain 0.956685602664948 SEC14L1 ENSG00000129657 UTR3 Human protein_coding chr17:75211208 chr17:75211208 . . 0 21 hm1A_associated_SNPs_114896 0 19734545 Cognitive performance 7e-07 GWAS_Catalog TagSNP rs3744064 GCST000477 A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB.
280 chr17 79682051 79682051 1 + C T rs3204270 79682051 - 79682031 79682071 41 TAGAGTGCCAGGATGCCGTCGGTACGCACCACCCGCAGCGC TAGAGTGCCAGGATGCCGTCAGTACGCACCACCCGCAGCGC Direct Gain 0 0.829266369342804 Functional Gain 0.829266369342804 SLC25A10 ENSG00000183048;ENSG00000262660 CDS Human other chr17:79682051 chr17:79682051 stopgain . 0 21 hm1A_associated_SNPs_115054 0 23259602 Dental caries 5e-06 GWAS_Catalog TagSNP rs3204270 GCST001786 Genome-wide association scan of dental caries in the permanent dentition.
281 chr19 1026477 1026477 1 + G T rs4807440 1026477 - 1026457 1026497 41 GCGGCCGCGGACTTCCTGAGCCCCCTCGGTCGCCCCCGGAC GCGGCCGCGGACTTCCTGAGACCCCTCGGTCGCCCCCGGAC Direct Gain 0 0.55706399679184 Functional Gain 0.55706399679184 CNN2 ENSG00000064666 UTR5 Human protein_coding chr19:1026477 chr19:1026477 . . 0 21 hm1A_associated_SNPs_115406 0 27863252 Monocyte count 3e-11 GWAS_Catalog TagSNP rs4807440 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
282 chr19 2249477 2249477 1 + G T rs10407022 2249477 - 2249457 2249497 41 GGCACAGAGGCTCTTGTGGGCTGCCTGGAGGCCAGTCCAAG GGCACAGAGGCTCTTGTGGGATGCCTGGAGGCCAGTCCAAG Direct Gain 0 0.673655927181244 Functional Gain 0.673655927181244 AMH ENSG00000104899 CDS Human protein_coding chr19:2249477 chr19:2249477 nonsynonymous SNV 0.001 2 21 hm1A_associated_SNPs_115501 0 27618447 Pulse pressure 3e-08 GWAS_Catalog TagSNP rs10407022 GCST006022 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
283 chr19 8468485 8468485 1 + C T rs2241588 8468485 - 8468465 8468505 41 CAGAGGATACCGTGGCGGGGGCGGGCGGAGGACGTGCACGC CAGAGGATACCGTGGCGGGGACGGGCGGAGGACGTGCACGC Direct Gain 0 0.886246800422668 Functional Gain 0.886246800422668 RAB11B ENSG00000185236 UTR3 Human protein_coding chr19:8468485 chr19:8468485 . . 0 21 hm1A_associated_SNPs_115709 0 30595370 Waist-hip ratio 5e-08 GWAS_Catalog TagSNP rs2241588 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
284 chr19 10397230 10397230 1 + C T rs75407602 10397230 - 10397210 10397250 41 GGGCAATGTTGCGAGACCCCGTCTCTGGAAAAAAAAAAAAA GGGCAATGTTGCGAGACCCCATCTCTGGAAAAAAAAAAAAA Direct Gain 0 0.995636761188507 Functional Gain 0.995636761188507 ICAM1 ENSG00000267607 ncRNA_exonic Human antisense chr19:10397230 chr19:10397230 . . 0 21 hm1A_associated_SNPs_115731 0 29875488 Blood protein levels 8e-86 GWAS_Catalog TagSNP rs75407602 GCST005806 Genomic atlas of the human plasma proteome.
285 chr19 11227602 11227602 1 + C T rs688 11227602 - 11227582 11227622 41 ATGGTCTTCCGGTTGCCCCCGTTGACATCGATGCTTGAGAT ATGGTCTTCCGGTTGCCCCCATTGACATCGATGCTTGAGAT Direct Gain 0 0.905963718891144 Functional Gain 0.905963718891144 LDLR ENSG00000130164 CDS Human protein_coding chr19:11227602 chr19:11227602 synonymous SNV . 0 21 hm1A_associated_SNPs_115762 2 29507422 Total cholesterol levels 1e-25 GWAS_Catalog TagSNP rs688 GCST007143 A large electronic-health-record-based genome-wide study of serum lipids.
286 chr19 11350488 11350488 1 + C T rs2278426 11350488 - 11350468 11350508 41 GTTCCTGGCCTTTGTCAGCCGTCCCTCCGTGGTCCTGTACA GTTCCTGGCCTTTGTCAGCCATCCCTCCGTGGTCCTGTACA Direct Gain 0 0.894669651985168 Functional Gain 0.894669651985168 ANGPTL8 ENSG00000130173 CDS Human protein_coding chr19:11350488 chr19:11350488 nonsynonymous SNV 0.526 2 21 hm1A_associated_SNPs_115764 0 23505323 HDL cholesterol 3e-09 GWAS_Catalog TagSNP rs2278426 GCST001904 Genomic study in Mexicans identifies a new locus for triglycerides and refines European lipid loci.
287 chr19 21666210 21666210 1 + C T rs2562456 21666210 - 21666190 21666230 41 TCCATGGGGACTTGGGAAAAGAAATCGGCCAGAGCCTCAAA TCCATGGGGACTTGGGAAAAAAAATCGGCCAGAGCCTCAAA Direct Gain 0 0.521764814853668 Functional Gain 0.521764814853668 LINC00664 ENSG00000268658 ncRNA_exonic Human lincRNA chr19:21666210 chr19:21666210 . . 0 21 hm1A_associated_SNPs_116000 0 19207018 Pain 2e-10 GWAS_Catalog TagSNP rs2562456 GCST000326 Genome-wide association study of acute post-surgical pain in humans.
288 chr19 33635761 33635761 1 + C T rs3848596 33635761 - 33635741 33635781 41 AAATCGCGAACCACAGAACCGTCCACCGGATCCTCAAATCA AAATCGCGAACCACAGAACCATCCACCGGATCCTCAAATCA Direct Gain 0 0.996529042720795 Functional Gain 0.996529042720795 WDR88 ENSG00000166359 CDS Human protein_coding chr19:33635761 chr19:33635761 synonymous SNV . 0 21 hm1A_associated_SNPs_116033 0 17463246 Multiple continuous traits in DGI samples 0.0003427 Johnson and O'Donnell TagSNP rs3848596 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
289 chr19 41305138 41305138 1 + G T rs184088518 41305138 - 41305118 41305158 41 TCCTCCGGCCCCGGCGCCGCCGTTTGTGCCAGCCGCCCTGC TCCTCCGGCCCCGGCGCCGCAGTTTGTGCCAGCCGCCCTGC Direct Gain 0 0.742327332496643 Functional Gain 0.742327332496643 RAB4B-EGLN2 ENSG00000269858 UTR5 Human protein_coding chr19:41305138 chr19:41305138 . . 0 21 hm1A_associated_SNPs_116216 0 27863252 Hemoglobin concentration 4e-16 GWAS_Catalog TagSNP rs184088518 GCST004615 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
290 chr19 45147340 45147340 1 + G T rs11540084 45147340 - 45147320 45147360 41 TCTCCTCGCTTCCCGGCGCCCGCTCGCTCTGCCGCGGTCGC TCTCCTCGCTTCCCGGCGCCAGCTCGCTCTGCCGCGGTCGC Direct Gain 0 0.970868229866028 Functional Gain 0.970868229866028 PVR ENSG00000266903 ncRNA_intronic Human antisense chr19:45147340 chr19:45147340 . . 0 21 hm1A_associated_SNPs_116296 0 27863252 Mean platelet volume 1e-17 GWAS_Catalog TagSNP rs11540084 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
291 chr19 49206631 49206631 1 + A T rs1047781 49206631 - 49206611 49206651 41 GCGGACGTACTCCCCCGGGATGTGGCGGTATTCCTCCTCCA GCGGACGTACTCCCCCGGGAAGTGGCGGTATTCCTCCTCCA Direct Gain 0 0.953927516937256 Functional Gain 0.953927516937256 FUT2 ENSG00000176920 CDS Human protein_coding chr19:49206631 chr19:49206631 nonsynonymous SNV 0.262 3 21 hm1A_associated_SNPs_116427 1 22367966 Vitamin B12 levels 4e-36 GWAS_Catalog TagSNP rs1047781 GCST001424 Genome-wide association study identifies novel loci associated with serum level of vitamin B12 in Chinese men.
292 chr19 50099422 50099422 1 + C T rs73058052 50099422 - 50099402 50099442 41 CCCTTGTAGCCACCTGCTCCGGCTGCATAGCTGCCAGCTCC CCCTTGTAGCCACCTGCTCCAGCTGCATAGCTGCCAGCTCC Direct Gain 0 0.609259843826294 Functional Gain 0.609259843826294 PRR12 ENSG00000126464 CDS Human protein_coding chr19:50099422 chr19:50099422 synonymous SNV . 0 21 hm1A_associated_SNPs_116472 0 26561523 Fibrinogen levels 2e-08 GWAS_Catalog TagSNP rs73058052 GCST003194 A meta-analysis of 120 246 individuals identifies 18 new loci for fibrinogen concentration.
293 chr19 51228746 51228746 1 + C T rs13866 51228746 - 51228726 51228766 41 GCCGGGTGGTGGGATGGGCAGGGAGGCGGGGTACCGGCCCC GCCGGGTGGTGGGATGGGCAAGGAGGCGGGGTACCGGCCCC Direct Gain 0 0.725919246673584 Functional Gain 0.725919246673584 CLEC11A ENSG00000105472 UTR3 Human protein_coding chr19:51228746 chr19:51228746 . . 0 21 hm1A_associated_SNPs_116538 0 30072576 Blood protein levels 4e-09 GWAS_Catalog TagSNP rs13866 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
294 chr19 55993436 55993436 1 + G T rs147110934 55993436 - 55993416 55993456 41 CCATCGCAGCGGTACACCAGCTCCACCGTGGTCTCCGCCGC CCATCGCAGCGGTACACCAGATCCACCGTGGTCTCCGCCGC Direct Gain 0 0.825403034687042 Functional Gain 0.825403034687042 ZNF628 ENSG00000197483 CDS Human protein_coding chr19:55993436 chr19:55993436 nonsynonymous SNV 0.952 0 21 hm1A_associated_SNPs_116667 0 30593698 Fat-free mass 8e-09 GWAS_Catalog TagSNP rs147110934 GCST007063 Genomics of body fat percentage may contribute to sex bias in anorexia nervosa.
295 chr21 37692507 37692507 1 + C T rs62229372 37692507 - 37692487 37692527 41 CGCAACCCGACTGGGAGGTGGCGGAACGACTGTGGAGCCCT CGCAACCCGACTGGGAGGTGACGGAACGACTGTGGAGCCCT Direct Gain 0 0.8335942029953 Functional Gain 0.8335942029953 MORC3 ENSG00000273199 ncRNA_exonic Human antisense chr21:37692507 chr21:37692507 . . 0 21 hm1A_associated_SNPs_117343 0 30595370 Systolic blood pressure 2e-08 GWAS_Catalog TagSNP rs62229372 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
296 chr21 43443498 43443498 1 + C T rs2839440 43443498 - 43443478 43443518 41 CAGGTACTAATACTGAACCCGTTGGGAAACTCCAATTCTTA CAGGTACTAATACTGAACCCATTGGGAAACTCCAATTCTTA Direct Gain 0 0.663611590862274 Functional Gain 0.663611590862274 ZNF295-AS1 ENSG00000237232 ncRNA_exonic Human lincRNA chr21:43443498 chr21:43443498 . . 0 21 hm1A_associated_SNPs_117379 0 23551011 Preeclampsia 1e-06 GWAS_Catalog TagSNP rs2839440 GCST001949 Genome-wide association study of pre-eclampsia detects novel maternal single nucleotide polymorphisms and copy-number variants in subsets of the Hyperglycemia and Adverse Pregnancy Outcome (HAPO) study cohort.
297 chr21 47423482 47423482 1 + C T rs150432347 47423482 - 47423462 47423502 41 GCTCTGGGCGCTGCTGGCCCGTGCCGCTGTACTGCACCACC GCTCTGGGCGCTGCTGGCCCATGCCGCTGTACTGCACCACC Direct Gain 0 0.996456384658813 Functional Gain 0.996456384658813 COL6A1 ENSG00000142156 CDS Human protein_coding chr21:47423482 chr21:47423482 nonsynonymous SNV 0.001 1 21 hm1A_associated_SNPs_117495 2 28234671 Systolic blood pressure 1e-07 GWAS_Catalog TagSNP rs150432347 GCST007829 Rare coding variants associated with blood pressure variation in 15 914 individuals of African ancestry.
298 chr22 17577965 17577965 1 + C T rs143008696 17577965 - 17577945 17577985 41 ATGACTTACTATTCTTGACCGTGCAGTTTAGCCCCTGTGGA ATGACTTACTATTCTTGACCATGCAGTTTAGCCCCTGTGGA Direct Gain 0 0.985910356044769 Functional Gain 0.985910356044769 IL17RA ENSG00000177663 CDS Human protein_coding chr22:17577965 chr22:17577965 nonsynonymous SNV 0.498 1 21 hm1A_associated_SNPs_117539 1 27863252 White blood cell count 5e-12 GWAS_Catalog TagSNP rs143008696 GCST004610 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
299 chr22 19712094 19712094 1 + C T rs1059196 19712094 - 19712074 19712114 41 TTGGGCAGCGGAGGAGGCGGGGACCGGTCCAGGTTGGCGCG TTGGGCAGCGGAGGAGGCGGAGACCGGTCCAGGTTGGCGCG Direct Gain 0 0.913734912872314 Functional Gain 0.913734912872314 SEPT5-GP1BB ENSG00000184702;ENSG00000203618 UTR3 Human other chr22:19712094 chr22:19712094 . . 0 21 hm1A_associated_SNPs_117572 0 27863252 Mean platelet volume 2e-21 GWAS_Catalog TagSNP rs1059196 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
300 chr22 42666026 42666026 1 + C T rs187166731 42666026 - 42666006 42666046 41 GGAGGGAAGGTCTACCTGCTGGTCGCGCGAGGCCTTGGGTG GGAGGGAAGGTCTACCTGCTAGTCGCGCGAGGCCTTGGGTG Direct Gain 0 0.745224237442017 Functional Gain 0.745224237442017 OGFRP1 ENSG00000182057 ncRNA_exonic Human lincRNA chr22:42666026 chr22:42666026 . . 0 21 hm1A_associated_SNPs_117929 0 27989323 Interleukin-1-receptor antagonist levels 5e-06 GWAS_Catalog TagSNP rs187166731 GCST004447 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
301 chr22 46722560 46722560 1 + C T rs6008700 46722560 - 46722540 46722580 41 ACCAATTTATTACCACCTTCGTGTCTTACCTCATTGCAGAG ACCAATTTATTACCACCTTCATGTCTTACCTCATTGCAGAG Direct Gain 0 0.554806470870972 Functional Gain 0.554806470870972 GTSE1 ENSG00000075218 intronic Human protein_coding chr22:46722560 chr22:46722560 . . 0 21 hm1A_associated_SNPs_117996 0 17554300 Multiple complex diseases 0.000191459 Johnson and O'Donnell TagSNP rs6008700 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.