1 chr6 28912399 28912399 1 + C T rs140736187 28912399 + 28912379 28912419 41 CAGTCTCATAATCTGAAGGTCCTGAGTTCGAACCTCAGAGG CAGTCTCATAATCTGAAGGTTCTGAGTTCGAACCTCAGAGG Direct Loss 1 0 Functional Loss -1 LINC01556 ENSG00000204709 downstream Human lincRNA chr6:28912399 chr6:28912399 . . 0 21 hm5C_associated_SNPs_191 0 28928442 Tonsillectomy 2e-07 GWAS_Catalog TagSNP rs140736187 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
2 chr1 16349137 16349137 1 + G A rs9442189 16349157 + 16349137 16349177 41 GTGAGGGCTTCTCAGGGGACCCTGTGACTCTGCAGGAGCTG ATGAGGGCTTCTCAGGGGACCCTGTGACTCTGCAGGAGCTG < 41bp 1 0.0836345851421356 Functional Loss -0.916365414857864 CLCNKA ENSG00000186510 CDS Human protein_coding chr1:16349157 chr1:16349137 nonsynonymous SNV 0.734 2 1 hm5C_associated_SNPs_2235 0 28552196 Waist circumference adjusted for body mass index 6e-06 GWAS_Catalog TagSNP rs9442189 GCST008161 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
3 chr1 19934900 19934900 1 + G A rs61740466 19934893 + 19934873 19934913 41 GTATCATTGCCCTACACATCCAACTCCGGGCCACAGGAGGA GTATCATTGCCCTACACATCCAACTCCAGGCCACAGGAGGA < 41bp 1 0.0838013887405396 Functional Loss -0.91619861125946 RPS14P3 ENSG00000226396 ncRNA_exonic Human processed_pseudogene chr1:19934893 chr1:19934900 . . 0 28 hm5C_associated_SNPs_2328 0 30595370 Body mass index 3e-08 GWAS_Catalog TagSNP rs61740466 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
4 chr1 76255228 76255228 1 + G A rs11161620 76255231 + 76255211 76255251 41 TTCTAAAATTACACTGAGACCTTGGAGGGTAAAATTTTTAT TTCTAAAATTACACTGAAACCTTGGAGGGTAAAATTTTTAT < 41bp 1 0.217123329639435 Functional Loss -0.782876670360565 SNORD45B ENSG00000201487 ncRNA_exonic Human snoRNA chr1:76255231 chr1:76255228 . . 0 18 hm5C_associated_SNPs_2737 0 23093944 Serum metabolite levels 5e-16 GWAS_Catalog TagSNP rs11161620 GCST006249 Mining the unknown: a systems approach to metabolite identification combining genetic and metabolic information.
5 chr1 156202173 156202173 1 + A C rs1052053 156202172 + 156202152 156202192 41 TGCAGCCTGCGATGACACAGCAAATCTATGACAAGTTTATA TGCAGCCTGCGATGACACAGCCAATCTATGACAAGTTTATA < 41bp 1 0.14225235581398 Functional Loss -0.85774764418602 PMF1;PMF1-BGLAP ENSG00000160783;ENSG00000260238 CDS Human other chr1:156202172 chr1:156202173 nonsynonymous SNV 0.812 0 22 hm5C_associated_SNPs_2914 0 29531354 Stroke 3e-14 GWAS_Catalog TagSNP rs1052053 GCST005838 Multiancestry genome-wide association study of 520,000 subjects identifies 32 loci associated with stroke and stroke subtypes.
6 chr1 210847740 210847740 1 + A C rs4366378 210847733 + 210847713 210847753 41 ACGGACTAATGCTGTTGGGCCCAGGCCAGTCCTTGTTGCTG ACGGACTAATGCTGTTGGGCCCAGGCCCGTCCTTGTTGCTG < 41bp 1 0.216660737991333 Functional Loss -0.783339262008667 HHAT ENSG00000054392 UTR3 Human protein_coding chr1:210847733 chr1:210847740 . . 0 28 hm5C_associated_SNPs_3075 0 17434096 Ischemic stroke 2.13e-05 Johnson and O'Donnell TagSNP rs4366378 . A genome-wide genotyping study in patients with ischaemic stroke: initial analysis and data release.
7 chr1 220970028 220970028 1 + A G rs2642438 220970029 + 220970009 220970049 41 CAGGGACTGTGGCGAGGCCACCGCCCAGTGGATAACCAGCT CAGGGACTGTGGCGAGGCCGCCGCCCAGTGGATAACCAGCT < 41bp 1 0.301815450191498 Functional Loss -0.698184549808502 MARC1 ENSG00000186205 CDS Human protein_coding chr1:220970029 chr1:220970028 nonsynonymous SNV 0.005 0 20 hm5C_associated_SNPs_3103 0 28334899 Total cholesterol levels 1e-22 GWAS_Catalog TagSNP rs2642438 GCST004235 Association analyses of East Asian individuals and trans-ancestry analyses with European individuals reveal new loci associated with cholesterol and triglyceride levels.
8 chr2 86438146 86438146 1 + A G rs2241432 86438144 + 86438124 86438164 41 CATTATTTCAAGGATATGTGCCAGGGAATTCAGGAACCACC CATTATTTCAAGGATATGTGCCGGGGAATTCAGGAACCACC < 41bp 1 0.485408961772919 Functional Loss -0.514591038227081 MRPL35 ENSG00000132313 UTR3 Human protein_coding chr2:86438144 chr2:86438146 . . 0 23 hm5C_associated_SNPs_3424 0 30595370 Systolic blood pressure 4e-13 GWAS_Catalog TagSNP rs2241432 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
9 chr2 241569692 241569692 1 + C T rs3749171 241569690 + 241569670 241569710 41 TACATGAGCATCAGCCTGGTCACGGCCATCGCCGTGGACCG TACATGAGCATCAGCCTGGTCATGGCCATCGCCGTGGACCG < 41bp 1 0.18079885840416 Functional Loss -0.81920114159584 GPR35 ENSG00000178623 CDS Human protein_coding chr2:241569690 chr2:241569692 nonsynonymous SNV 0.011 1 23 hm5C_associated_SNPs_3721 0 29562276 Childhood onset ulcerative colitis 9e-07 GWAS_Catalog TagSNP rs3749171 GCST005815 Enhanced Contribution of HLA in Pediatric Onset Ulcerative Colitis.
10 chr3 57994398 57994398 1 + G A rs142568031 57994397 + 57994377 57994417 41 ACCTCAAGTGCGTGAACAAACGCATCGGCAACCTGCAGACC ACCTCAAGTGCGTGAACAAACACATCGGCAACCTGCAGACC < 41bp 1 0.0732654631137848 Functional Loss -0.926734536886215 FLNB ENSG00000136068 CDS Human protein_coding chr3:57994397 chr3:57994398 nonsynonymous SNV 0.999 5 22 hm5C_associated_SNPs_3931 0 31217584 Height 5e-11 GWAS_Catalog TagSNP rs142568031 GCST008053 Genetic analyses of diverse populations improves discovery for complex traits.
11 chr3 57994398 57994398 1 + G A rs142568031 57994399 + 57994379 57994419 41 CTCAAGTGCGTGAACAAACGCATCGGCAACCTGCAGACCGA CTCAAGTGCGTGAACAAACACATCGGCAACCTGCAGACCGA < 41bp 1 0.143116116523743 Functional Loss -0.856883883476257 FLNB ENSG00000136068 CDS Human protein_coding chr3:57994399 chr3:57994398 nonsynonymous SNV 0.999 5 20 hm5C_associated_SNPs_3932 0 31217584 Height 5e-11 GWAS_Catalog TagSNP rs142568031 GCST008053 Genetic analyses of diverse populations improves discovery for complex traits.
12 chr3 132226100 132226100 1 + A G rs79953286 132226097 + 132226077 132226117 41 AAAGGGTGATTGTGACAAAACTTATGGATCAGAATTTGTCT AAAGGGTGATTGTGACAAAACTTGTGGATCAGAATTTGTCT < 41bp 1 0.0961592495441437 Functional Loss -0.903840750455856 DNAJC13 ENSG00000138246 CDS Human protein_coding chr3:132226097 chr3:132226100 nonsynonymous SNV 1.000 2 24 hm5C_associated_SNPs_4003 0 30595370 Mean corpuscular hemoglobin 2e-34 GWAS_Catalog TagSNP rs79953286 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
13 chr3 148562310 148562310 1 + G A rs1059502 148562291 + 148562271 148562311 41 CGTACCTATGGACGTGAGATCCAAGTGACAGAGCTTCTCGA CGTACCTATGGACGTGAGATCCAAGTGACAGAGCTTCTCAA < 41bp 1 0.327300429344177 Functional Loss -0.672699570655823 CPB1 ENSG00000153002 CDS Human protein_coding chr3:148562291 chr3:148562310 nonsynonymous SNV 0.415 0 40 hm5C_associated_SNPs_4029 0 17903301 ECG dimensions, brachial artery endothelial function, treadmill exercise responses 0.005 Johnson and O'Donnell TagSNP rs1059502 . Genome-wide association of echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Heart Study.
14 chr3 148562310 148562310 1 + G A rs1059502 148562299 + 148562279 148562319 41 TGGACGTGAGATCCAAGTGACAGAGCTTCTCGACAAGTTAG TGGACGTGAGATCCAAGTGACAGAGCTTCTCAACAAGTTAG < 41bp 1 0.264892816543579 Functional Loss -0.735107183456421 CPB1 ENSG00000153002 CDS Human protein_coding chr3:148562299 chr3:148562310 nonsynonymous SNV 0.415 0 32 hm5C_associated_SNPs_4030 0 17903301 ECG dimensions, brachial artery endothelial function, treadmill exercise responses 0.005 Johnson and O'Donnell TagSNP rs1059502 . Genome-wide association of echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Heart Study.
15 chr3 148562310 148562310 1 + G A rs1059502 148562304 + 148562284 148562324 41 GTGAGATCCAAGTGACAGAGCTTCTCGACAAGTTAGACTTT GTGAGATCCAAGTGACAGAGCTTCTCAACAAGTTAGACTTT < 41bp 1 0.11014586687088 Functional Loss -0.88985413312912 CPB1 ENSG00000153002 CDS Human protein_coding chr3:148562304 chr3:148562310 nonsynonymous SNV 0.415 0 27 hm5C_associated_SNPs_4031 0 17903301 ECG dimensions, brachial artery endothelial function, treadmill exercise responses 0.005 Johnson and O'Donnell TagSNP rs1059502 . Genome-wide association of echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Heart Study.
16 chr3 148562310 148562310 1 + G A rs1059502 148562307 + 148562287 148562327 41 AGATCCAAGTGACAGAGCTTCTCGACAAGTTAGACTTTTAT AGATCCAAGTGACAGAGCTTCTCAACAAGTTAGACTTTTAT < 41bp 1 0.475427240133286 Functional Loss -0.524572759866714 CPB1 ENSG00000153002 CDS Human protein_coding chr3:148562307 chr3:148562310 nonsynonymous SNV 0.415 0 24 hm5C_associated_SNPs_4032 0 17903301 ECG dimensions, brachial artery endothelial function, treadmill exercise responses 0.005 Johnson and O'Donnell TagSNP rs1059502 . Genome-wide association of echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Heart Study.
17 chr3 148562310 148562310 1 + G A rs1059502 148562312 + 148562292 148562332 41 CAAGTGACAGAGCTTCTCGACAAGTTAGACTTTTATGTCCT CAAGTGACAGAGCTTCTCAACAAGTTAGACTTTTATGTCCT < 41bp 1 0.195338875055313 Functional Loss -0.804661124944687 CPB1 ENSG00000153002 CDS Human protein_coding chr3:148562312 chr3:148562310 nonsynonymous SNV 0.415 0 19 hm5C_associated_SNPs_4033 0 17903301 ECG dimensions, brachial artery endothelial function, treadmill exercise responses 0.005 Johnson and O'Donnell TagSNP rs1059502 . Genome-wide association of echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Heart Study.
18 chr3 148562310 148562310 1 + G A rs1059502 148562321 + 148562301 148562341 41 GAGCTTCTCGACAAGTTAGACTTTTATGTCCTGCCTGTGCT GAGCTTCTCAACAAGTTAGACTTTTATGTCCTGCCTGTGCT < 41bp 1 0.0274061858654022 Functional Loss -0.972593814134598 CPB1 ENSG00000153002 CDS Human protein_coding chr3:148562321 chr3:148562310 nonsynonymous SNV 0.415 0 10 hm5C_associated_SNPs_4034 0 17903301 ECG dimensions, brachial artery endothelial function, treadmill exercise responses 0.005 Johnson and O'Donnell TagSNP rs1059502 . Genome-wide association of echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Heart Study.
19 chr3 148562310 148562310 1 + G A rs1059502 148562330 + 148562310 148562350 41 GACAAGTTAGACTTTTATGTCCTGCCTGTGCTCAATATTGA AACAAGTTAGACTTTTATGTCCTGCCTGTGCTCAATATTGA < 41bp 1 0.0561227202415466 Functional Loss -0.943877279758453 CPB1 ENSG00000153002 CDS Human protein_coding chr3:148562330 chr3:148562310 nonsynonymous SNV 0.415 0 1 hm5C_associated_SNPs_4035 0 17903301 ECG dimensions, brachial artery endothelial function, treadmill exercise responses 0.005 Johnson and O'Donnell TagSNP rs1059502 . Genome-wide association of echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Heart Study.
20 chr5 118729327 118729327 1 + A G rs1045242 118729326 + 118729306 118729346 41 AGATATGTGGTTGGGTAATGCAAATGTAGTTATACAAAGAA AGATATGTGGTTGGGTAATGCGAATGTAGTTATACAAAGAA < 41bp 1 0.418798506259918 Functional Loss -0.581201493740082 TNFAIP8 ENSG00000145779 UTR3 Human protein_coding chr5:118729326 chr5:118729327 . . 0 22 hm5C_associated_SNPs_4560 0 30595370 White blood cell count 5e-17 GWAS_Catalog TagSNP rs1045242 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
21 chr6 26569135 26569135 1 + T A rs36162392 26569117 + 26569097 26569137 41 TCAGTTGGTAGAGCGGAGGACTGTAGTTGGCTGTGTCCTTA TCAGTTGGTAGAGCGGAGGACTGTAGTTGGCTGTGTCCATA < 41bp 1 0.0649234354496002 Functional Loss -0.9350765645504 LOC105374988 ENSG00000182952;ENSG00000146109 intergenic Human other chr6:26569117 chr6:26569135 . . 0 39 hm5C_associated_SNPs_5103 0 28604730 Lung cancer in ever smokers 6e-07 GWAS_Catalog TagSNP rs36162392 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
22 chr6 26569135 26569135 1 + T A rs36162392 26569127 + 26569107 26569147 41 GAGCGGAGGACTGTAGTTGGCTGTGTCCTTAGACATCCTTA GAGCGGAGGACTGTAGTTGGCTGTGTCCATAGACATCCTTA < 41bp 1 0.118205606937408 Functional Loss -0.881794393062592 LOC105374988 ENSG00000182952;ENSG00000146109 intergenic Human other chr6:26569127 chr6:26569135 . . 0 29 hm5C_associated_SNPs_5104 0 28604730 Lung cancer in ever smokers 6e-07 GWAS_Catalog TagSNP rs36162392 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
23 chr6 26569135 26569135 1 + T A rs36162392 26569133 + 26569113 26569153 41 AGGACTGTAGTTGGCTGTGTCCTTAGACATCCTTAGGTCGC AGGACTGTAGTTGGCTGTGTCCATAGACATCCTTAGGTCGC < 41bp 1 0.434670567512512 Functional Loss -0.565329432487488 LOC105374988 ENSG00000182952;ENSG00000146109 intergenic Human other chr6:26569133 chr6:26569135 . . 0 23 hm5C_associated_SNPs_5105 0 28604730 Lung cancer in ever smokers 6e-07 GWAS_Catalog TagSNP rs36162392 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
24 chr6 26569135 26569135 1 + T A rs36162392 26569140 + 26569120 26569160 41 TAGTTGGCTGTGTCCTTAGACATCCTTAGGTCGCTGGTTCG TAGTTGGCTGTGTCCATAGACATCCTTAGGTCGCTGGTTCG < 41bp 1 0.120133459568024 Functional Loss -0.879866540431976 LOC105374988 ENSG00000182952;ENSG00000146109 intergenic Human other chr6:26569140 chr6:26569135 . . 0 16 hm5C_associated_SNPs_5106 0 28604730 Lung cancer in ever smokers 6e-07 GWAS_Catalog TagSNP rs36162392 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
25 chr6 26569135 26569135 1 + T A rs36162392 26569143 + 26569123 26569163 41 TTGGCTGTGTCCTTAGACATCCTTAGGTCGCTGGTTCGAAT TTGGCTGTGTCCATAGACATCCTTAGGTCGCTGGTTCGAAT < 41bp 1 0.0254406929016113 Functional Loss -0.974559307098389 LOC105374988 ENSG00000182952;ENSG00000146109 intergenic Human other chr6:26569143 chr6:26569135 . . 0 13 hm5C_associated_SNPs_5107 0 28604730 Lung cancer in ever smokers 6e-07 GWAS_Catalog TagSNP rs36162392 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
26 chr6 26569135 26569135 1 + T A rs36162392 26569144 + 26569124 26569164 41 TGGCTGTGTCCTTAGACATCCTTAGGTCGCTGGTTCGAATC TGGCTGTGTCCATAGACATCCTTAGGTCGCTGGTTCGAATC < 41bp 1 0.119005501270294 Functional Loss -0.880994498729706 LOC105374988 ENSG00000182952;ENSG00000146109 intergenic Human other chr6:26569144 chr6:26569135 . . 0 12 hm5C_associated_SNPs_5108 0 28604730 Lung cancer in ever smokers 6e-07 GWAS_Catalog TagSNP rs36162392 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
27 chr6 26569135 26569135 1 + T A rs36162392 26569151 + 26569131 26569171 41 GTCCTTAGACATCCTTAGGTCGCTGGTTCGAATCCGGCTCG GTCCATAGACATCCTTAGGTCGCTGGTTCGAATCCGGCTCG < 41bp 1 0.190785765647888 Functional Loss -0.809214234352112 LOC105374988 ENSG00000182952;ENSG00000146109 intergenic Human other chr6:26569151 chr6:26569135 . . 0 5 hm5C_associated_SNPs_5109 0 28604730 Lung cancer in ever smokers 6e-07 GWAS_Catalog TagSNP rs36162392 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
28 chr6 26569135 26569135 1 + T A rs36162392 26569153 + 26569133 26569173 41 CCTTAGACATCCTTAGGTCGCTGGTTCGAATCCGGCTCGAA CCATAGACATCCTTAGGTCGCTGGTTCGAATCCGGCTCGAA < 41bp 1 0.0782561600208282 Functional Loss -0.921743839979172 LOC105374988 ENSG00000182952;ENSG00000146109 intergenic Human other chr6:26569153 chr6:26569135 . . 0 3 hm5C_associated_SNPs_5110 0 28604730 Lung cancer in ever smokers 6e-07 GWAS_Catalog TagSNP rs36162392 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
29 chr6 27655994 27655994 1 + T G rs1555021 27655999 + 27655979 27656019 41 CAGTTGGTTAGAGCGTGGTGCTAATAACGCCAAGGTCGCGG CAGTTGGTTAGAGCGGGGTGCTAATAACGCCAAGGTCGCGG < 41bp 1 0.0841743648052216 Functional Loss -0.915825635194778 ZNF184;LINC01012 ENSG00000216676;ENSG00000216915 intergenic Human other chr6:27655999 chr6:27655994 . . 0 16 hm5C_associated_SNPs_5396 0 30038396 Highest math class taken (MTAG) 9e-10 GWAS_Catalog TagSNP rs1555021 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
30 chr6 27655994 27655994 1 + T G rs1555021 27656009 + 27655989 27656029 41 GAGCGTGGTGCTAATAACGCCAAGGTCGCGGGTTCGATCCC GAGCGGGGTGCTAATAACGCCAAGGTCGCGGGTTCGATCCC < 41bp 1 0.468200117349625 Functional Loss -0.531799882650375 ZNF184;LINC01012 ENSG00000216676;ENSG00000216915 intergenic Human other chr6:27656009 chr6:27655994 . . 0 6 hm5C_associated_SNPs_5397 0 30038396 Highest math class taken (MTAG) 9e-10 GWAS_Catalog TagSNP rs1555021 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
31 chr6 28912399 28912399 1 + C T rs140736187 28912379 + 28912359 28912399 41 TAGCGCAGTAGGCAGCGCGTCAGTCTCATAATCTGAAGGTC TAGCGCAGTAGGCAGCGCGTCAGTCTCATAATCTGAAGGTT < 41bp 1 0.401129573583603 Functional Loss -0.598870426416397 LINC01556 ENSG00000204709 downstream Human lincRNA chr6:28912379 chr6:28912399 . . 0 41 hm5C_associated_SNPs_5619 0 28928442 Tonsillectomy 2e-07 GWAS_Catalog TagSNP rs140736187 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
32 chr6 28912399 28912399 1 + C T rs140736187 28912383 + 28912363 28912403 41 GCAGTAGGCAGCGCGTCAGTCTCATAATCTGAAGGTCCTGA GCAGTAGGCAGCGCGTCAGTCTCATAATCTGAAGGTTCTGA < 41bp 1 0.0637030303478241 Functional Loss -0.936296969652176 LINC01556 ENSG00000204709 downstream Human lincRNA chr6:28912383 chr6:28912399 . . 0 37 hm5C_associated_SNPs_5620 0 28928442 Tonsillectomy 2e-07 GWAS_Catalog TagSNP rs140736187 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
33 chr6 28912399 28912399 1 + C T rs140736187 28912391 + 28912371 28912411 41 CAGCGCGTCAGTCTCATAATCTGAAGGTCCTGAGTTCGAAC CAGCGCGTCAGTCTCATAATCTGAAGGTTCTGAGTTCGAAC < 41bp 1 0.362270057201385 Functional Loss -0.637729942798615 LINC01556 ENSG00000204709 downstream Human lincRNA chr6:28912391 chr6:28912399 . . 0 29 hm5C_associated_SNPs_5621 0 28928442 Tonsillectomy 2e-07 GWAS_Catalog TagSNP rs140736187 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
34 chr6 28912399 28912399 1 + C T rs140736187 28912400 + 28912380 28912420 41 AGTCTCATAATCTGAAGGTCCTGAGTTCGAACCTCAGAGGG AGTCTCATAATCTGAAGGTTCTGAGTTCGAACCTCAGAGGG < 41bp 1 0.483280003070831 Functional Loss -0.516719996929169 LINC01556 ENSG00000204709 downstream Human lincRNA chr6:28912400 chr6:28912399 . . 0 20 hm5C_associated_SNPs_5622 0 28928442 Tonsillectomy 2e-07 GWAS_Catalog TagSNP rs140736187 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
35 chr6 28912399 28912399 1 + C T rs140736187 28912407 + 28912387 28912427 41 TAATCTGAAGGTCCTGAGTTCGAACCTCAGAGGGGGCAAGG TAATCTGAAGGTTCTGAGTTCGAACCTCAGAGGGGGCAAGG < 41bp 1 0.0853418409824371 Functional Loss -0.914658159017563 LINC01556 ENSG00000204709 downstream Human lincRNA chr6:28912407 chr6:28912399 . . 0 13 hm5C_associated_SNPs_5623 0 28928442 Tonsillectomy 2e-07 GWAS_Catalog TagSNP rs140736187 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
36 chr6 28912399 28912399 1 + C T rs140736187 28912411 + 28912391 28912431 41 CTGAAGGTCCTGAGTTCGAACCTCAGAGGGGGCAAGGCGTC CTGAAGGTTCTGAGTTCGAACCTCAGAGGGGGCAAGGCGTC < 41bp 1 0.0828206241130829 Functional Loss -0.917179375886917 LINC01556 ENSG00000204709 downstream Human lincRNA chr6:28912411 chr6:28912399 . . 0 9 hm5C_associated_SNPs_5624 0 28928442 Tonsillectomy 2e-07 GWAS_Catalog TagSNP rs140736187 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
37 chr6 28912399 28912399 1 + C T rs140736187 28912412 + 28912392 28912432 41 TGAAGGTCCTGAGTTCGAACCTCAGAGGGGGCAAGGCGTCT TGAAGGTTCTGAGTTCGAACCTCAGAGGGGGCAAGGCGTCT < 41bp 1 0.176625341176987 Functional Loss -0.823374658823013 LINC01556 ENSG00000204709 downstream Human lincRNA chr6:28912412 chr6:28912399 . . 0 8 hm5C_associated_SNPs_5625 0 28928442 Tonsillectomy 2e-07 GWAS_Catalog TagSNP rs140736187 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
38 chr6 31590898 31590898 1 + C T rs2736172 31590883 + 31590863 31590903 41 ACAAAGGCGTGTCTGTGGTTCCCTGTCTTTGGACACGTAAG ACAAAGGCGTGTCTGTGGTTCCCTGTCTTTGGACATGTAAG < 41bp 1 0.0320070385932922 Functional Loss -0.967992961406708 SNORA38 ENSG00000200816 ncRNA_exonic Human snoRNA chr6:31590883 chr6:31590898 . . 0 36 hm5C_associated_SNPs_5739 0 24132900 Psychosis (atypical) 4e-06 GWAS_Catalog TagSNP rs2736172 GCST002211 Genome-wide association study of atypical psychosis.
39 chr6 31590898 31590898 1 + C T rs2736172 31590889 + 31590869 31590909 41 GCGTGTCTGTGGTTCCCTGTCTTTGGACACGTAAGAATTGG GCGTGTCTGTGGTTCCCTGTCTTTGGACATGTAAGAATTGG < 41bp 1 0.174413025379181 Functional Loss -0.825586974620819 SNORA38 ENSG00000200816 ncRNA_exonic Human snoRNA chr6:31590889 chr6:31590898 . . 0 30 hm5C_associated_SNPs_5740 0 24132900 Psychosis (atypical) 4e-06 GWAS_Catalog TagSNP rs2736172 GCST002211 Genome-wide association study of atypical psychosis.
40 chr6 31929808 31929808 1 + C T rs35664695 31929807 + 31929787 31929827 41 TGTGGCTGAATATGCCATTGCCCTGGCCCAGAAACACATGA TGTGGCTGAATATGCCATTGCTCTGGCCCAGAAACACATGA < 41bp 1 0.217230796813965 Functional Loss -0.782769203186035 SKIV2L ENSG00000204351 CDS Human protein_coding chr6:31929807 chr6:31929808 synonymous SNV . 0 22 hm5C_associated_SNPs_5780 1 28928442 Tonsillectomy 6e-17 GWAS_Catalog TagSNP rs35664695 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
41 chr6 118030238 118030238 1 + G T rs2498589 118030220 + 118030200 118030240 41 CTTGAAGTTCTAGGAAGAGGCAAACTACAAACTACTAGGAT CTTGAAGTTCTAGGAAGAGGCAAACTACAAACTACTAGTAT < 41bp 1 0.245862603187561 Functional Loss -0.754137396812439 NUS1 ENSG00000153989 UTR3 Human protein_coding chr6:118030220 chr6:118030238 . . 0 39 hm5C_associated_SNPs_5874 0 29875488 Blood protein levels 2e-16 GWAS_Catalog TagSNP rs2498589 GCST005806 Genomic atlas of the human plasma proteome.
42 chr7 12269417 12269417 1 + C A rs3173615 12269401 + 12269381 12269421 41 AAACAGTTATTGGAAAGGCACGCTTAAACAACATAACCATT AAACAGTTATTGGAAAGGCACGCTTAAACAACATAAACATT < 41bp 1 0.0455610752105713 Functional Loss -0.954438924789429 TMEM106B ENSG00000106460 CDS Human protein_coding chr7:12269401 chr7:12269417 nonsynonymous SNV 0.988 2 37 hm5C_associated_SNPs_6066 0 30275531 Triglycerides 7e-09 GWAS_Catalog TagSNP rs3173615 GCST006613 Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program.
43 chr7 134215403 134215403 1 + T A rs1722883 134215396 + 134215376 134215416 41 CTTTTCTTTTGCCTTTCAGTCTCCTCTTGGCAAAGTGAAAG CTTTTCTTTTGCCTTTCAGTCTCCTCTAGGCAAAGTGAAAG < 41bp 1 0.425022095441818 Functional Loss -0.574977904558182 AKR1B10 ENSG00000198074 CDS Human protein_coding chr7:134215396 chr7:134215403 synonymous SNV . 0 28 hm5C_associated_SNPs_6363 0 31015401 Medication use (agents acting on the renin-angiotensin system) 4e-10 GWAS_Catalog TagSNP rs1722883 GCST007930 Genome-wide association study of medication-use and associated disease in the UK Biobank.
44 chr8 42226805 42226805 1 + C G rs3136797 42226797 + 42226777 42226817 41 TGTTCATTTTAGGGTGTTTGCCAGCTTCCCAGTAAAAATGA TGTTCATTTTAGGGTGTTTGCCAGCTTCGCAGTAAAAATGA < 41bp 1 0.412336885929108 Functional Loss -0.587663114070892 POLB ENSG00000070501 CDS Human protein_coding chr8:42226797 chr8:42226805 nonsynonymous SNV 0.978 1 29 hm5C_associated_SNPs_6641 0 30134803 Plasma parathyroid hormone levels 3e-06 GWAS_Catalog TagSNP rs3136797 GCST006431 Genome-wide meta-analysis identifies novel loci associated with parathyroid hormone level.
45 chr9 7174673 7174673 1 + G A rs913588 7174666 + 7174646 7174686 41 TTTAAGAATGAATATGTGGCCGACCCTGTATACCGCACTTT TTTAAGAATGAATATGTGGCCGACCCTATATACCGCACTTT < 41bp 1 0.0699661076068878 Functional Loss -0.930033892393112 KDM4C ENSG00000107077 CDS Human protein_coding chr9:7174666 chr9:7174673 nonsynonymous SNV 0.990 0 28 hm5C_associated_SNPs_6789 0 25231870 Menarche (age at onset) 6e-11 GWAS_Catalog TagSNP rs913588 GCST002541 Parent-of-origin-specific allelic associations among 106 genomic loci for age at menarche.
46 chr11 309127 309127 1 + A C rs1059091 309126 + 309106 309146 41 ATCTTCATGACCATTCTGCTCATCATCATCCCAGTGTTGGT ATCTTCATGACCATTCTGCTCCTCATCATCCCAGTGTTGGT < 41bp 1 0.0205833613872528 Functional Loss -0.979416638612747 IFITM2 ENSG00000185201 CDS Human protein_coding chr11:309126 chr11:309127 nonsynonymous SNV 0.001 1 22 hm5C_associated_SNPs_7354 0 30595370 Eosinophil counts 3e-52 GWAS_Catalog TagSNP rs1059091 GCST007065 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
47 chr11 8941215 8941215 1 + A G rs4910157 8941225 + 8941205 8941245 41 AGACAGTCTCACTCTGTTGCCCAGGCTGGAGTGCAGTGGCG AGACAGTCTCGCTCTGTTGCCCAGGCTGGAGTGCAGTGGCG < 41bp 1 0.30461174249649 Functional Loss -0.69538825750351 AKIP1 ENSG00000166452 UTR3 Human protein_coding chr11:8941225 chr11:8941215 . . 0 11 hm5C_associated_SNPs_7426 0 28928442 Tonsillectomy 8e-08 GWAS_Catalog TagSNP rs4910157 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
48 chr11 61722645 61722645 1 + C A rs1109748 61722649 + 61722629 61722669 41 ATTGCGACAGCTACATCCAGCTCATCCCCATTTCCTTCGTG ATTGCGACAGCTACATACAGCTCATCCCCATTTCCTTCGTG < 41bp 1 0.0716200470924377 Functional Loss -0.928379952907562 BEST1 ENSG00000167995 CDS Human protein_coding chr11:61722649 chr11:61722645 synonymous SNV . 0 17 hm5C_associated_SNPs_7598 5 21829377 Plasma omega-3 polyunsaturated fatty acid level (eicosapentaenoic acid) 5e-09 GWAS_Catalog TagSNP rs1109748 GCST001178 Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium.
49 chr11 67024534 67024534 1 + C T rs7952436 67024537 + 67024517 67024557 41 GCCTTTTTCTTTGGTTGCTCCTGTGGAAAATACTGAAAAGA GCCTTTTTCTTTGGTTGTTCCTGTGGAAAATACTGAAAAGA < 41bp 1 0.386892288923264 Functional Loss -0.613107711076736 KDM2A ENSG00000173120 UTR3 Human protein_coding chr11:67024537 chr11:67024534 . . 0 18 hm5C_associated_SNPs_7773 0 28270201 Height 2e-12 GWAS_Catalog TagSNP rs7952436 GCST004212 Exploration of haplotype research consortium imputation for genome-wide association studies in 20,032 Generation Scotland participants.
50 chr11 118355642 118355642 1 + A C rs9332801 118355660 + 118355640 118355680 41 ATAACACCCAGGGTGGTTTGCTTTCTCTGTGCCAGTAGTGG ATCACACCCAGGGTGGTTTGCTTTCTCTGTGCCAGTAGTGG < 41bp 1 0.0388703346252441 Functional Loss -0.961129665374756 KMT2A ENSG00000118058 CDS Human protein_coding chr11:118355660 chr11:118355642 synonymous SNV . 0 3 hm5C_associated_SNPs_7920 1 30643256 Depressive symptoms 2e-08 GWAS_Catalog TagSNP rs9332801 GCST007340 Multivariate genome-wide analyses of the well-being spectrum.
51 chr11 120099679 120099679 1 + G A rs2508490 120099678 + 120099658 120099698 41 ACGGGAAGCCCTGCGTCTGCCGCTATGGCCTGAGCCTGGCC ACGGGAAGCCCTGCGTCTGCCACTATGGCCTGAGCCTGGCC < 41bp 1 0.223723977804184 Functional Loss -0.776276022195816 OAF ENSG00000184232 CDS Human protein_coding chr11:120099678 chr11:120099679 nonsynonymous SNV 0.517 0 22 hm5C_associated_SNPs_7943 0 29875488 Blood protein levels 6e-194 GWAS_Catalog TagSNP rs2508490 GCST005806 Genomic atlas of the human plasma proteome.
52 chr11 120099679 120099679 1 + G A rs2508490 120099680 + 120099660 120099700 41 GGGAAGCCCTGCGTCTGCCGCTATGGCCTGAGCCTGGCCTG GGGAAGCCCTGCGTCTGCCACTATGGCCTGAGCCTGGCCTG < 41bp 1 0.311993420124054 Functional Loss -0.688006579875946 OAF ENSG00000184232 CDS Human protein_coding chr11:120099680 chr11:120099679 nonsynonymous SNV 0.517 0 20 hm5C_associated_SNPs_7944 0 29875488 Blood protein levels 6e-194 GWAS_Catalog TagSNP rs2508490 GCST005806 Genomic atlas of the human plasma proteome.
53 chr12 112460749 112460749 1 + A G rs7114 112460730 + 112460710 112460750 41 AGAGAGGAGAGAGGAGTGTACTGCCCAGGTCTTTGACAGAT AGAGAGGAGAGAGGAGTGTACTGCCCAGGTCTTTGACAGGT < 41bp 1 0.112075328826904 Functional Loss -0.887924671173096 ERP29 ENSG00000089248 UTR3 Human protein_coding chr12:112460730 chr12:112460749 . . 0 40 hm5C_associated_SNPs_8263 0 17554300 Multiple complex diseases 0.000145673 Johnson and O'Donnell TagSNP rs7114 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
54 chr12 124144395 124144395 1 + A C rs1051793 124144415 + 124144395 124144435 41 AGTTCATGTTGACTACAGGGCTGCTTGCTTCTGTCATCGAA CGTTCATGTTGACTACAGGGCTGCTTGCTTCTGTCATCGAA < 41bp 1 0.0457051396369934 Functional Loss -0.954294860363007 GTF2H3 ENSG00000111358 CDS Human protein_coding chr12:124144415 chr12:124144395 nonsynonymous SNV . 0 1 hm5C_associated_SNPs_8342 0 16252231 Parkinson's disease 0.03189 Johnson and O'Donnell TagSNP rs1051793 . High-resolution whole-genome association study of Parkinson disease.
55 chr15 22969232 22969232 1 + G A rs7170637 22969231 + 22969211 22969251 41 AGCCGGTACCTGACGCTGGACGGCTTCGACGCCATGTTCCG AGCCGGTACCTGACGCTGGACAGCTTCGACGCCATGTTCCG < 41bp 1 0.126876264810562 Functional Loss -0.873123735189438 CYFIP1 ENSG00000068793 CDS Human other chr15:22969231 chr15:22969232 nonsynonymous SNV . 0 22 hm5C_associated_SNPs_8795 0 30598549 Heel bone mineral density 1e-12 GWAS_Catalog TagSNP rs7170637 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
56 chr15 63433766 63433766 1 + G A rs2729835 63433784 + 63433764 63433804 41 AAGGAAACAAACGTATGGTTCGTGTAGAAAGCAACGGCATT AAAGAAACAAACGTATGGTTCGTGTAGAAAGCAACGGCATT < 41bp 1 0.0828350186347961 Functional Loss -0.917164981365204 LACTB ENSG00000103642 CDS Human protein_coding chr15:63433784 chr15:63433766 nonsynonymous SNV 0.998 0 3 hm5C_associated_SNPs_8924 0 27618447 Systolic blood pressure 2e-06 GWAS_Catalog TagSNP rs2729835 GCST006021 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
57 chr15 91045408 91045408 1 + G A rs3540 91045405 + 91045385 91045425 41 CCTCCCAAGAGTTTGGACTGCCCGTCAGATTGTTGCTGCAC CCTCCCAAGAGTTTGGACTGCCCATCAGATTGTTGCTGCAC < 41bp 1 0.0897901058197021 Functional Loss -0.910209894180298 IQGAP1 ENSG00000140575 UTR3 Human protein_coding chr15:91045405 chr15:91045408 . . 0 24 hm5C_associated_SNPs_9042 0 27863252 Lymphocyte counts 1e-22 GWAS_Catalog TagSNP rs3540 GCST004627 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
58 chr15 91045408 91045408 1 + G A rs3540 91045406 + 91045386 91045426 41 CTCCCAAGAGTTTGGACTGCCCGTCAGATTGTTGCTGCACA CTCCCAAGAGTTTGGACTGCCCATCAGATTGTTGCTGCACA < 41bp 1 0.0908144116401672 Functional Loss -0.909185588359833 IQGAP1 ENSG00000140575 UTR3 Human protein_coding chr15:91045406 chr15:91045408 . . 0 23 hm5C_associated_SNPs_9043 0 27863252 Lymphocyte counts 1e-22 GWAS_Catalog TagSNP rs3540 GCST004627 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
59 chr15 91045408 91045408 1 + G A rs3540 91045407 + 91045387 91045427 41 TCCCAAGAGTTTGGACTGCCCGTCAGATTGTTGCTGCACAT TCCCAAGAGTTTGGACTGCCCATCAGATTGTTGCTGCACAT < 41bp 1 0.130007594823837 Functional Loss -0.869992405176163 IQGAP1 ENSG00000140575 UTR3 Human protein_coding chr15:91045407 chr15:91045408 . . 0 22 hm5C_associated_SNPs_9044 0 27863252 Lymphocyte counts 1e-22 GWAS_Catalog TagSNP rs3540 GCST004627 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
60 chr16 4431767 4431767 1 + C T rs148092711 4431752 + 4431732 4431772 41 GCCTCTTCCCCCGCCTGCGGCTGCTGGCAGCTGCCCGCAAC GCCTCTTCCCCCGCCTGCGGCTGCTGGCAGCTGCCTGCAAC < 41bp 1 0.0682945251464844 Functional Loss -0.931705474853516 VASN ENSG00000168140 CDS Human protein_coding chr16:4431752 chr16:4431767 nonsynonymous SNV 0.995 2 36 hm5C_associated_SNPs_9344 0 30598549 Heel bone mineral density 4e-14 GWAS_Catalog TagSNP rs148092711 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
61 chr16 29994922 29994922 1 + C T rs3814883 29994940 + 29994920 29994960 41 TCCGCCCGCCGCCGGGCCTACTGCCGTAACCGAGACCACTT TCTGCCCGCCGCCGGGCCTACTGCCGTAACCGAGACCACTT < 41bp 1 0.0797471702098846 Functional Loss -0.920252829790115 TAOK2 ENSG00000149930 CDS Human protein_coding chr16:29994940 chr16:29994922 synonymous SNV . 0 3 hm5C_associated_SNPs_9453 0 30595370 Body mass index 7e-35 GWAS_Catalog TagSNP rs3814883 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
62 chr16 69497203 69497203 1 + G A rs12149862 69497187 + 69497167 69497207 41 CCAGCCCCTGAGCCCAGCCCCTTCCCAAGTGGTGCCGGACA CCAGCCCCTGAGCCCAGCCCCTTCCCAAGTGGTGCCAGACA < 41bp 1 0.136798053979874 Functional Loss -0.863201946020126 CYB5B ENSG00000103018 UTR3 Human protein_coding chr16:69497187 chr16:69497203 . . 0 37 hm5C_associated_SNPs_9582 0 25189868 Blood pressure (smoking interaction) 4e-09 GWAS_Catalog TagSNP rs12149862 GCST002587 Gene-smoking interactions identify several novel blood pressure loci in the Framingham Heart Study.
63 chr17 4856376 4856376 1 + A G rs238238 4856386 + 4856366 4856406 41 AACATCAACAATACTCTGGGCCCTGCTCTGCTGCAAAAGGC AACATCAACAGTACTCTGGGCCCTGCTCTGCTGCAAAAGGC < 41bp 1 0.122461467981339 Functional Loss -0.877538532018661 ENO3 ENSG00000108515 CDS Human protein_coding chr17:4856386 chr17:4856376 nonsynonymous SNV 0.997 0 11 hm5C_associated_SNPs_9790 2 17463246 Multiple continuous traits in DGI samples 0.0001711 Johnson and O'Donnell TagSNP rs238238 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
64 chr17 30692396 30692396 1 + G T rs3795244 30692381 + 30692361 30692401 41 CTGTTCCACGTCCTGGAATTCCTCCAATGACTCAAGCACAG CTGTTCCACGTCCTGGAATTCCTCCAATGACTCAATCACAG < 41bp 1 0.261854857206345 Functional Loss -0.738145142793655 ZNF207 ENSG00000010244 CDS Human protein_coding chr17:30692381 chr17:30692396 nonsynonymous SNV 0.998 1 36 hm5C_associated_SNPs_10004 0 28470677 Survival in pancreatic cancer 3e-06 GWAS_Catalog TagSNP rs3795244 GCST004485 Genetic polymorphisms associated with pancreatic cancer survival: a genome-wide association study.
65 chr17 37814080 37814080 1 + G A rs1877031 37814079 + 37814059 37814099 41 TCCTAGGCTATGCCGTGCTGCGGCTCCGGCACTGGTGGGTG TCCTAGGCTATGCCGTGCTGCAGCTCCGGCACTGGTGGGTG < 41bp 1 0.170491755008698 Functional Loss -0.829508244991302 STARD3 ENSG00000131748 CDS Human protein_coding chr17:37814079 chr17:37814080 nonsynonymous SNV 0.635 2 22 hm5C_associated_SNPs_10046 0 28334899 HDL cholesterol levels 1e-21 GWAS_Catalog TagSNP rs1877031 GCST004232 Association analyses of East Asian individuals and trans-ancestry analyses with European individuals reveal new loci associated with cholesterol and triglyceride levels.
66 chr19 13010520 13010520 1 + A G rs8012 13010519 + 13010499 13010539 41 ATTTCCCTTCTGAAGTCGTTCAGATGTGTTCCTTAAAAAGA ATTTCCCTTCTGAAGTCGTTCGGATGTGTTCCTTAAAAAGA < 41bp 1 0.405917853116989 Functional Loss -0.594082146883011 GCDH ENSG00000105607 CDS Human protein_coding chr19:13010519 chr19:13010520 nonsynonymous SNV . 0 22 hm5C_associated_SNPs_10729 2 24816252 Blood metabolite levels 6e-45 GWAS_Catalog TagSNP rs8012 GCST002443 An atlas of genetic influences on human blood metabolites.
67 chr19 17392894 17392894 1 + G A rs8100241 17392879 + 17392859 17392899 41 TTTGCAGGGCAGTAGAGGAGCTGCTGCGCTGCGGCGCGGAC TTTGCAGGGCAGTAGAGGAGCTGCTGCGCTGCGGCACGGAC < 41bp 1 0.240589946508408 Functional Loss -0.759410053491592 ANKLE1 ENSG00000160117 CDS Human protein_coding chr19:17392879 chr19:17392894 nonsynonymous SNV 0.145 3 36 hm5C_associated_SNPs_10784 0 22976474 Breast cancer 4e-08 GWAS_Catalog TagSNP rs8100241 GCST001683 A meta-analysis of genome-wide association studies of breast cancer identifies two novel susceptibility loci at 6q14 and 20q11.
68 chr19 45389224 45389224 1 + A G rs283814 45389205 + 45389185 45389225 41 ACCCCACAGCCTGGAGGGACCTCCCTCCTACAAGCCACCAA ACCCCACAGCCTGGAGGGACCTCCCTCCTACAAGCCACCGA < 41bp 1 0.0942977070808411 Functional Loss -0.905702292919159 NECTIN2 ENSG00000130202 CDS Human protein_coding chr19:45389205 chr19:45389224 synonymous SNV . 0 40 hm5C_associated_SNPs_11035 0 29777097 Alzheimer's disease or family history of Alzheimer's disease 5e-08 GWAS_Catalog TagSNP rs283814 GCST005922 GWAS on family history of Alzheimer's disease.
69 chr20 43356156 43356156 1 + C T rs1061098 43356149 + 43356129 43356169 41 GTATGGCAGAGGTGCAAGACCTAGTCCCCTTTCCTCTAACT GTATGGCAGAGGTGCAAGACCTAGTCCTCTTTCCTCTAACT < 41bp 1 0.0471051931381226 Functional Loss -0.952894806861877 KCNK15-AS1 ENSG00000244558 ncRNA_intronic Human antisense chr20:43356149 chr20:43356156 . . 0 28 hm5C_associated_SNPs_11384 0 30072576 Blood protein levels 5e-21 GWAS_Catalog TagSNP rs1061098 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
70 chr21 45181446 45181446 1 + G A rs762407 45181445 + 45181425 45181465 41 TCGCCTCGCCCACCGGCCTGCGAAGCCAGCATCTCCGTGAA TCGCCTCGCCCACCGGCCTGCAAAGCCAGCATCTCCGTGAA < 41bp 1 0.367080837488174 Functional Loss -0.632919162511826 PDXK ENSG00000160209 UTR3 Human protein_coding chr21:45181445 chr21:45181446 . . 0 22 hm5C_associated_SNPs_11529 0 27980656 Systolic blood pressure change trajectories 7e-07 GWAS_Catalog TagSNP rs762407 GCST003825 Genome-wide association of trajectories of systolic blood pressure change.
71 chr21 46931109 46931109 1 + G A rs12483377 46931104 + 46931084 46931124 41 GCCCGGGGCACGCATCTTCTCCTTTGACGGCAAGGACGTCC GCCCGGGGCACGCATCTTCTCCTTTAACGGCAAGGACGTCC < 41bp 1 0.346382081508636 Functional Loss -0.653617918491364 COL18A1 ENSG00000182871 CDS Human protein_coding chr21:46931104 chr21:46931109 nonsynonymous SNV 0.595 3 26 hm5C_associated_SNPs_11566 2 29875488 Blood protein levels 0 GWAS_Catalog TagSNP rs12483377 GCST005806 Genomic atlas of the human plasma proteome.
72 chr21 46931109 46931109 1 + G A rs12483377 46931105 + 46931085 46931125 41 CCCGGGGCACGCATCTTCTCCTTTGACGGCAAGGACGTCCT CCCGGGGCACGCATCTTCTCCTTTAACGGCAAGGACGTCCT < 41bp 1 0.190991878509521 Functional Loss -0.809008121490479 COL18A1 ENSG00000182871 CDS Human protein_coding chr21:46931105 chr21:46931109 nonsynonymous SNV 0.595 3 25 hm5C_associated_SNPs_11567 2 29875488 Blood protein levels 0 GWAS_Catalog TagSNP rs12483377 GCST005806 Genomic atlas of the human plasma proteome.
73 chr22 31998612 31998612 1 + G A rs2006771 31998614 + 31998594 31998634 41 CCATCCTTCACGCAGAGCGACAGCTTCTGTATAGGTCTTGG CCATCCTTCACGCAGAGCAACAGCTTCTGTATAGGTCTTGG < 41bp 1 0.184147715568542 Functional Loss -0.815852284431458 SFI1 ENSG00000198089 CDS Human protein_coding chr22:31998614 chr22:31998612 nonsynonymous SNV 0.313 0 19 hm5C_associated_SNPs_11679 0 28232668 Nonsyndromic cleft lip with cleft palate 3e-08 GWAS_Catalog TagSNP rs2006771 GCST004166 Genome-wide analyses of non-syndromic cleft lip with palate identify 14 novel loci and genetic heterogeneity.
74 chr1 11839998 11839998 1 + T C rs4846044 11839998 + 11839978 11840018 41 TGCAGTCACGGCTGGTGGAGTGGTGGGCCCAGGAGCGGGGC TGCAGTCACGGCTGGTGGAGCGGTGGGCCCAGGAGCGGGGC Direct Gain 0 0.75904369354248 Functional Gain 0.75904369354248 C1orf167 ENSG00000215910 CDS Human protein_coding chr1:11839998 chr1:11839998 nonsynonymous SNV 0.000 0 21 hm5C_associated_SNPs_37343 0 29912962 Diastolic blood pressure x alcohol consumption interaction (2df test) 7e-17 GWAS_Catalog TagSNP rs4846044 GCST006166 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
75 chr1 17287414 17287414 1 + T C rs2273113 17287414 + 17287394 17287434 41 GAGGCGGCGCGGGCCGAGGCTGCAGAGCTGGGCCTGCGGCT GAGGCGGCGCGGGCCGAGGCCGCAGAGCTGGGCCTGCGGCT Direct Gain 0 0.736339092254639 Functional Gain 0.736339092254639 CROCC ENSG00000058453 CDS Human protein_coding chr1:17287414 chr1:17287414 synonymous SNV . 0 21 hm5C_associated_SNPs_37444 0 30595370 Red blood cell count 6e-10 GWAS_Catalog TagSNP rs2273113 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
76 chr1 19638883 19638883 1 + T C rs2473808 19638883 + 19638863 19638903 41 CCGGGGGCAGGTGGCAAACTTCACGGCTGGGGGTCGGGGCT CCGGGGGCAGGTGGCAAACTCCACGGCTGGGGGTCGGGGCT Direct Gain 0 0.795445382595062 Functional Gain 0.795445382595062 PQLC2 ENSG00000040487 UTR5 Human protein_coding chr1:19638883 chr1:19638883 . . 0 21 hm5C_associated_SNPs_37480 0 31015401 Medication use (thyroid preparations) 9e-09 GWAS_Catalog TagSNP rs2473808 GCST007932 Genome-wide association study of medication-use and associated disease in the UK Biobank.
77 chr1 20915701 20915701 1 + A C rs2072671 20915701 + 20915681 20915721 41 TTTGCTCCCAGGAGGCCAAGAAGTCAGCCTACTGCCCCTAC TTTGCTCCCAGGAGGCCAAGCAGTCAGCCTACTGCCCCTAC Direct Gain 0 0.706375300884247 Functional Gain 0.706375300884247 CDA ENSG00000158825 CDS Human protein_coding chr1:20915701 chr1:20915701 nonsynonymous SNV 1.000 0 21 hm5C_associated_SNPs_37502 0 30595370 Red blood cell count 2e-11 GWAS_Catalog TagSNP rs2072671 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
78 chr1 21904374 21904374 1 + A C rs1772719 21904374 + 21904354 21904394 41 TCCCCGCTGCCCTTTGGCCAACAGGGTAGATTTCTCTTGGG TCCCCGCTGCCCTTTGGCCACCAGGGTAGATTTCTCTTGGG Direct Gain 0 0.721971333026886 Functional Gain 0.721971333026886 ALPL ENSG00000162551 UTR3 Human protein_coding chr1:21904374 chr1:21904374 . . 0 21 hm5C_associated_SNPs_37518 1 25972531 Pyridoxal 5'-phosphate levels 2e-16 GWAS_Catalog TagSNP rs1772719 GCST006799 Common Variants at Putative Regulatory Sites of the Tissue Nonspecific Alkaline Phosphatase Gene Influence Circulating Pyridoxal 5'-Phosphate Concentration in Healthy Adults.
79 chr1 28213157 28213157 1 + T C rs6565 28213157 + 28213137 28213177 41 ATTATTTCATTTTAAAACCATAGAATAAAAATGACACCTGA ATTATTTCATTTTAAAACCACAGAATAAAAATGACACCTGA Direct Gain 0 0.568055748939514 Functional Gain 0.568055748939514 THEMIS2 ENSG00000130775 UTR3 Human protein_coding chr1:28213157 chr1:28213157 . . 0 21 hm5C_associated_SNPs_37597 0 30595370 Red cell distribution width 2e-10 GWAS_Catalog TagSNP rs6565 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
80 chr1 29445227 29445227 1 + T C rs12120422 29445227 + 29445207 29445247 41 AGGGAGGGAAAGAGCCCAGGTGGGACGTGGGACAGGCTTAG AGGGAGGGAAAGAGCCCAGGCGGGACGTGGGACAGGCTTAG Direct Gain 0 0.807091474533081 Functional Gain 0.807091474533081 EPB41 ENSG00000159023 UTR3 Human protein_coding chr1:29445227 chr1:29445227 . . 0 21 hm5C_associated_SNPs_37614 0 29739929 Non-melanoma skin cancer 2e-06 GWAS_Catalog TagSNP rs12120422 GCST005896 Genome-wide association study in 176,678 Europeans reveals genetic loci for tanning response to sun exposure.
81 chr1 44447413 44447413 1 + G C rs1859728 44447413 + 44447393 44447433 41 ATGCCCCTGGAGCGGGTGCAGAGGGAGAACCCAGGCGTGCT ATGCCCCTGGAGCGGGTGCACAGGGAGAACCCAGGCGTGCT Direct Gain 0 0.831942677497864 Functional Gain 0.831942677497864 B4GALT2 ENSG00000117411 CDS Human protein_coding chr1:44447413 chr1:44447413 nonsynonymous SNV 1.000 3 21 hm5C_associated_SNPs_37776 0 30072576 Blood protein levels 7e-09 GWAS_Catalog TagSNP rs1859728 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
82 chr1 53581670 53581670 1 + A C rs3820201 53581670 + 53581650 53581690 41 TTGTGCTTTGCTTTGTTGACAAAAGGATTTTTCCCCAAAGC TTGTGCTTTGCTTTGTTGACCAAAGGATTTTTCCCCAAAGC Direct Gain 0 0.663512706756592 Functional Gain 0.663512706756592 SLC1A7 ENSG00000235563 ncRNA_exonic Human antisense chr1:53581670 chr1:53581670 . . 0 21 hm5C_associated_SNPs_37852 0 22745009 Hippocampal atrophy 1e-06 GWAS_Catalog TagSNP rs3820201 GCST001530 Multiple loci influencing hippocampal degeneration identified by genome scan.
83 chr1 151554503 151554503 1 + T C rs1891592 151554503 + 151554483 151554523 41 TGTAGACTGGACTCTGGCTGTGCCATAAGCCAGGCCTTCAT TGTAGACTGGACTCTGGCTGCGCCATAAGCCAGGCCTTCAT Direct Gain 0 0.768131732940674 Functional Gain 0.768131732940674 TUFT1 ENSG00000143367 UTR3 Human protein_coding chr1:151554503 chr1:151554503 . . 0 21 hm5C_associated_SNPs_38244 0 17671248 Sporadic Amyotrophic Lateral Sclerosis (ALS) 0.02 Johnson and O'Donnell TagSNP rs1891592 . Whole-genome analysis of sporadic amyotrophic lateral sclerosis.
84 chr1 167096931 167096931 1 + A C rs267746 167096931 + 167096911 167096951 41 GGGAGAAGATGTCTGAGTACAAAATGGAAAAGCTGGCCTCA GGGAGAAGATGTCTGAGTACCAAATGGAAAAGCTGGCCTCA Direct Gain 0 0.884734392166138 Functional Gain 0.884734392166138 DUSP27 ENSG00000198842 CDS Human protein_coding chr1:167096931 chr1:167096931 nonsynonymous SNV 0.464 0 21 hm5C_associated_SNPs_38442 0 17463246 Multiple continuous traits in DGI samples 0.0004614 Johnson and O'Donnell TagSNP rs267746 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
85 chr1 196654324 196654324 1 + A C rs1061147 196654324 + 196654304 196654344 41 GCAACCCGGGGAAATACAGCAAAATGCACAAGTACTGGCTG GCAACCCGGGGAAATACAGCCAAATGCACAAGTACTGGCTG Direct Gain 0 0.847591042518616 Functional Gain 0.847591042518616 CFH ENSG00000000971 CDS Human protein_coding chr1:196654324 chr1:196654324 synonymous SNV . 0 21 hm5C_associated_SNPs_38608 4 23326517 Age-related macular degeneration 7e-32 GWAS_Catalog TagSNP rs1061147 GCST001814 Insights into the genetic architecture of early stage age-related macular degeneration: a genome-wide association study meta-analysis.
86 chr1 207262791 207262791 1 + A C rs79737422 207262791 + 207262771 207262811 41 GAGGTGGTTAGGTTGGTCTTAAGCAGTGTTAGAAGATCTAT GAGGTGGTTAGGTTGGTCTTCAGCAGTGTTAGAAGATCTAT Direct Gain 0 0.519170880317688 Functional Gain 0.519170880317688 C4BPB ENSG00000123843 UTR5 Human protein_coding chr1:207262791 chr1:207262791 . . 0 21 hm5C_associated_SNPs_38758 0 28552196 Hip circumference 4e-06 GWAS_Catalog TagSNP rs79737422 GCST008162 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
87 chr2 6122449 6122449 1 + T C rs6432462 6122449 + 6122429 6122469 41 GGCTCAGTTGGATCTCCAAGTGGCGGTACCGTTCTCTCCAC GGCTCAGTTGGATCTCCAAGCGGCGGTACCGTTCTCTCCAC Direct Gain 0 0.900700032711029 Functional Gain 0.900700032711029 LOC400940 ENSG00000232044 ncRNA_exonic Human processed_transcript chr2:6122449 chr2:6122449 . . 0 21 hm5C_associated_SNPs_39022 0 17554300 Multiple complex diseases 1.82456e-05 Johnson and O'Donnell TagSNP rs6432462 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
88 chr2 26915624 26915624 1 + G C rs12476527 26915624 + 26915604 26915644 41 CGGGCGCTGAGCGGGTGCCCGGCGCGGAGAGCGGCGAGCGC CGGGCGCTGAGCGGGTGCCCCGCGCGGAGAGCGGCGAGCGC Direct Gain 0 0.736410975456238 Functional Gain 0.736410975456238 KCNK3 ENSG00000171303 UTR5 Human protein_coding chr2:26915624 chr2:26915624 . . 0 21 hm5C_associated_SNPs_39100 0 29531354 Stroke 6e-08 GWAS_Catalog TagSNP rs12476527 GCST005838 Multiancestry genome-wide association study of 520,000 subjects identifies 32 loci associated with stroke and stroke subtypes.
89 chr2 27730940 27730940 1 + T C rs1260326 27730940 + 27730920 27730960 41 CACCGTGGGTCAGACCTTGCTGGTGAGAGTCCAGCCGTGAC CACCGTGGGTCAGACCTTGCCGGTGAGAGTCCAGCCGTGAC Direct Gain 0 0.675070524215698 Functional Gain 0.675070524215698 GCKR ENSG00000084734 CDS Human protein_coding chr2:27730940 chr2:27730940 nonsynonymous SNV 0.412 0 21 hm5C_associated_SNPs_39121 1 21943158 Cardiovascular disease risk factors 2e-08 GWAS_Catalog TagSNP rs1260326 GCST001247 Genetic variants in LPL, OASL and TOMM40/APOE-C1-C2-C4 genes are associated with multiple cardiovascular-related traits.
90 chr2 44502788 44502788 1 + A C rs3738985 44502788 + 44502768 44502808 41 GAGCAGACCCCGGATCCAGGAAGCTCAACAGACAACCTGAA GAGCAGACCCCGGATCCAGGCAGCTCAACAGACAACCTGAA Direct Gain 0 0.709270238876343 Functional Gain 0.709270238876343 SLC3A1 ENSG00000138079 CDS Human protein_coding chr2:44502788 chr2:44502788 synonymous SNV . 0 21 hm5C_associated_SNPs_39207 1 17998437 Alzheimer's disease 0.000369 Johnson and O'Donnell TagSNP rs3738985 . Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.
91 chr2 96937296 96937296 1 + G C rs1044594 96937296 + 96937276 96937316 41 AGTAAAGAGCTACAGAACATGAGTACATTGTTATACCACAG AGTAAAGAGCTACAGAACATCAGTACATTGTTATACCACAG Direct Gain 0 0.528035759925842 Functional Gain 0.528035759925842 CIAO1 ENSG00000144021 UTR3 Human protein_coding chr2:96937296 chr2:96937296 . . 0 21 hm5C_associated_SNPs_39436 0 17554300 Multiple complex diseases 0.000961416 Johnson and O'Donnell TagSNP rs1044594 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
92 chr2 99778985 99778985 1 + T C rs2632277 99778985 + 99778965 99779005 41 GTAGTACTGATGGGACGTTCTTGTCTTCTTTGCTAAAGAGC GTAGTACTGATGGGACGTTCCTGTCTTCTTTGCTAAAGAGC Direct Gain 0 0.53227573633194 Functional Gain 0.53227573633194 LIPT1 ENSG00000144182 CDS Human protein_coding chr2:99778985 chr2:99778985 synonymous SNV . 0 21 hm5C_associated_SNPs_39462 1 17554300 Multiple complex diseases 0.000252077 Johnson and O'Donnell TagSNP rs2632277 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
93 chr2 102968285 102968285 1 + T C rs4988958 102968285 + 102968265 102968305 41 AATAAAAGGTCCCTGAATTCTAAATTCTGGAAGCACGTGAG AATAAAAGGTCCCTGAATTCCAAATTCTGGAAGCACGTGAG Direct Gain 0 0.741871118545532 Functional Gain 0.741871118545532 IL1RL1 ENSG00000115602 CDS Human protein_coding chr2:102968285 chr2:102968285 synonymous SNV . 0 21 hm5C_associated_SNPs_39485 0 29273806 Asthma (childhood onset) 5e-13 GWAS_Catalog TagSNP rs4988958 GCST005213 Multiancestry association study identifies new asthma risk loci that colocalize with immune-cell enhancer marks.
94 chr2 120443665 120443665 1 + T C rs7571822 120443665 + 120443645 120443685 41 GAGCAGAGTGGGCAGCCAGCTGTGGGTTCAAATCCTGGCCT GAGCAGAGTGGGCAGCCAGCCGTGGGTTCAAATCCTGGCCT Direct Gain 0 0.58430951833725 Functional Gain 0.58430951833725 TMEM177;PTPN4 ENSG00000144120 UTR3 Human protein_coding chr2:120443665 chr2:120443665 . . 0 21 hm5C_associated_SNPs_39588 0 30038396 Self-reported math ability 2e-13 GWAS_Catalog TagSNP rs7571822 GCST006573 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
95 chr2 177053426 177053426 1 + A C rs150457564 177053426 + 177053406 177053446 41 GGAGAGGGCAGCTCGGGTAGAGAGGGCTGGCGGAGCGGCGC GGAGAGGGCAGCTCGGGTAGCGAGGGCTGGCGGAGCGGCGC Direct Gain 0 0.874129295349121 Functional Gain 0.874129295349121 HAGLR ENSG00000224189 ncRNA_intronic Human antisense chr2:177053426 chr2:177053426 . . 0 21 hm5C_associated_SNPs_39795 0 31015462 Estimated glomerular filtration rate 1e-14 GWAS_Catalog TagSNP rs150457564 GCST007876 Sex-specific and pleiotropic effects underlying kidney function identified from GWAS meta-analysis.
96 chr2 204165171 204165171 1 + T C rs11888559 204165171 + 204165151 204165191 41 ACTGATGGCTTATAGAATGATTCTAGCAGGACTCAAGTTAT ACTGATGGCTTATAGAATGACTCTAGCAGGACTCAAGTTAT Direct Gain 0 0.642964959144592 Functional Gain 0.642964959144592 CYP20A1 ENSG00000119004;ENSG00000238285 intergenic Human other chr2:204165171 chr2:204165171 . . 0 21 hm5C_associated_SNPs_39916 0 20966902 Height 2e-06 GWAS_Catalog TagSNP rs11888559 GCST000839 Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women.
97 chr2 228211470 228211470 1 + T C rs10177414 228211470 + 228211450 228211490 41 CATTGGCTTTACGAAGTGTTTGAAATGGTGTTTTTATGGAA CATTGGCTTTACGAAGTGTTCGAAATGGTGTTTTTATGGAA Direct Gain 0 0.734251499176025 Functional Gain 0.734251499176025 MFF ENSG00000168958 intronic Human protein_coding chr2:228211470 chr2:228211470 . . 0 21 hm5C_associated_SNPs_40048 0 30306274 Refractive astigmatism 6e-08 GWAS_Catalog TagSNP rs10177414 GCST007160 Genome-wide association studies for corneal and refractive astigmatism in UK Biobank demonstrate a shared role for myopia susceptibility loci.
98 chr3 10885920 10885920 1 + T C rs2304725 10885920 + 10885900 10885940 41 CACCGGGTCCTGGCCATCTCTGACGGGATCGAGCACATCGG CACCGGGTCCTGGCCATCTCCGACGGGATCGAGCACATCGG Direct Gain 0 0.691491007804871 Functional Gain 0.691491007804871 SLC6A11 ENSG00000132164 CDS Human protein_coding chr3:10885920 chr3:10885920 synonymous SNV . 0 21 hm5C_associated_SNPs_40280 0 25221879 Pulmonary function in asthmatics 3e-06 GWAS_Catalog TagSNP rs2304725 GCST002608 Genome-wide interrogation of longitudinal FEV1 in children with asthma.
99 chr3 12848822 12848822 1 + T C rs11718898 12848822 + 12848802 12848842 41 CAGCCTGGGTCCTCTGGTGGTCAAAGTGAAGGAGTACCAGG CAGCCTGGGTCCTCTGGTGGCCAAAGTGAAGGAGTACCAGG Direct Gain 0 0.523539304733276 Functional Gain 0.523539304733276 CAND2 ENSG00000144712 CDS Human protein_coding chr3:12848822 chr3:12848822 nonsynonymous SNV 0.995 0 21 hm5C_associated_SNPs_40292 0 30595370 Waist-hip ratio 2e-15 GWAS_Catalog TagSNP rs11718898 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
100 chr3 42906116 42906116 1 + T C rs2228467 42906116 + 42906096 42906136 41 GCTCTGCAGGAAGGATGCAGTGGTGTCCTTTGGCAAAGTCT GCTCTGCAGGAAGGATGCAGCGGTGTCCTTTGGCAAAGTCT Direct Gain 0 0.509579598903656 Functional Gain 0.509579598903656 ACKR2 ENSG00000144648 CDS Human protein_coding chr3:42906116 chr3:42906116 nonsynonymous SNV 0.047 3 21 hm5C_associated_SNPs_40410 0 23314186 Monocyte count 2e-07 GWAS_Catalog TagSNP rs2228467 GCST001887 Genetic variation associated with circulating monocyte count in the eMERGE Network.
101 chr3 53892830 53892830 1 + T C rs2232346 53892830 + 53892810 53892850 41 GCCCACAAACAGGCGTCCCTTTCCCTCTGGATAACAGTAAG GCCCACAAACAGGCGTCCCTCTCCCTCTGGATAACAGTAAG Direct Gain 0 0.543398439884186 Functional Gain 0.543398439884186 IL17RB ENSG00000056736 CDS Human protein_coding chr3:53892830 chr3:53892830 nonsynonymous SNV 0.000 0 21 hm5C_associated_SNPs_40539 0 29875488 Blood protein levels 4e-77 GWAS_Catalog TagSNP rs2232346 GCST005806 Genomic atlas of the human plasma proteome.
102 chr3 119222456 119222456 1 + G C rs1131265 119222456 + 119222436 119222476 41 TGGAGAACTGCAGTGTTTGTGACTATATTCAAGTAAGTTCA TGGAGAACTGCAGTGTTTGTCACTATATTCAAGTAAGTTCA Direct Gain 0 0.814697980880737 Functional Gain 0.814697980880737 TIMMDC1 ENSG00000113845 CDS Human protein_coding chr3:119222456 chr3:119222456 stoploss . 0 21 hm5C_associated_SNPs_40724 0 24076602 Multiple sclerosis 1e-23 GWAS_Catalog TagSNP rs1131265 GCST005531 Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis.
103 chr3 149374873 149374873 1 + G C rs1055153 149374873 + 149374853 149374893 41 CCCCAGCCAGTCGAGGCCCCGGGTGGCCGCCCGACGAGTCG CCCCAGCCAGTCGAGGCCCCCGGTGGCCGCCCGACGAGTCG Direct Gain 0 0.511575400829315 Functional Gain 0.511575400829315 WWTR1 ENSG00000018408 CDS Human protein_coding chr3:149374873 chr3:149374873 nonsynonymous SNV 1.000 3 21 hm5C_associated_SNPs_40912 0 30120420 Mental composite score 2e-08 GWAS_Catalog TagSNP rs1055153 GCST006441 Identification of novel loci associated with infant cognitive ability.
104 chr4 3495941 3495941 1 + T C rs1054661 3495941 + 3495921 3495961 41 CGGGCCCCTGGTGGGAGCTCTGCTGGCTCCTGTCTGAACCT CGGGCCCCTGGTGGGAGCTCCGCTGGCTCCTGTCTGAACCT Direct Gain 0 0.591356098651886 Functional Gain 0.591356098651886 DOK7 ENSG00000175920 UTR3 Human protein_coding chr4:3495941 chr4:3495941 . . 0 21 hm5C_associated_SNPs_41243 0 30595370 Lung function (FVC) 2e-14 GWAS_Catalog TagSNP rs1054661 GCST007081 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
105 chr4 8602798 8602798 1 + G C rs2241069 8602798 + 8602778 8602818 41 TACGTAAATGTCTGATGCGTGACGGTCAGGGCCACTGCAGG TACGTAAATGTCTGATGCGTCACGGTCAGGGCCACTGCAGG Direct Gain 0 0.783420085906982 Functional Gain 0.783420085906982 CPZ ENSG00000109625;ENSG00000109625 UTR5;UTR3 Human other chr4:8602798 chr4:8602798 . . 0 21 hm5C_associated_SNPs_41318 0 30664634 Body fat distribution (trunk fat ratio) 5e-12 GWAS_Catalog TagSNP rs2241069 GCST007294 Genome-wide association study of body fat distribution identifies adiposity loci and sex-specific genetic effects.
106 chr4 15603069 15603069 1 + G C rs1134634 15603069 + 15603049 15603089 41 TTTTTTTCACTGTACTTTCTGTATCATGTAAAAACTACACT TTTTTTTCACTGTACTTTCTCTATCATGTAAAAACTACACT Direct Gain 0 0.501708328723907 Functional Gain 0.501708328723907 CC2D2A ENSG00000048342 UTR3 Human protein_coding chr4:15603069 chr4:15603069 . . 0 21 hm5C_associated_SNPs_41330 3 27863252 Mean corpuscular volume 8e-20 GWAS_Catalog TagSNP rs1134634 GCST004602 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
107 chr4 145659064 145659064 1 + T C rs11727676 145659064 + 145659044 145659084 41 GGTATTCTTGATCAGATCATTGACATGACATCTTACTTGCT GGTATTCTTGATCAGATCATCGACATGACATCTTACTTGCT Direct Gain 0 0.674333214759827 Functional Gain 0.674333214759827 HHIP ENSG00000164161 CDS Human protein_coding chr4:145659064 chr4:145659064 synonymous SNV . 0 21 hm5C_associated_SNPs_41776 0 25673413 Body mass index 1e-06 GWAS_Catalog TagSNP rs11727676 GCST002783 Genetic studies of body mass index yield new insights for obesity biology.
108 chr4 187122355 187122355 1 + T C rs3736456 187122355 + 187122335 187122375 41 ATGAACGCCAATGAAGACTGTAGAGGTGATGGCAGGGGCTC ATGAACGCCAATGAAGACTGCAGAGGTGATGGCAGGGGCTC Direct Gain 0 0.66870790719986 Functional Gain 0.66870790719986 CYP4V2 ENSG00000145476 CDS Human protein_coding chr4:187122355 chr4:187122355 synonymous SNV . 0 21 hm5C_associated_SNPs_41914 3 17486107 Bipolar disorder 0.0048 Johnson and O'Donnell TagSNP rs3736456 . A genome-wide association study implicates diacylglycerol kinase eta (DGKH) and several other genes in the etiology of bipolar disorder.
109 chr5 59825300 59825300 1 + T C rs26949 59825300 + 59825280 59825320 41 ATTGTTACAGCCCTCTGAGATGGTATAAAAGAATGAAAGAA ATTGTTACAGCCCTCTGAGACGGTATAAAAGAATGAAAGAA Direct Gain 0 0.726449072360992 Functional Gain 0.726449072360992 PART1 ENSG00000152931 ncRNA_exonic Human lincRNA chr5:59825300 chr5:59825300 . . 0 21 hm5C_associated_SNPs_42089 0 29326435 Intelligence (MTAG) 6e-09 GWAS_Catalog TagSNP rs26949 GCST005316 A combined analysis of genetically correlated traits identifies 187 loci and a role for neurogenesis and myelination in intelligence.
110 chr5 96244719 96244719 1 + T C rs17486915 96244719 + 96244699 96244739 41 ATGACTTACTACCTCCAACATGAAACAAGCAGCCCCGCACT ATGACTTACTACCTCCAACACGAAACAAGCAGCCCCGCACT Direct Gain 0 0.702798008918762 Functional Gain 0.702798008918762 ERAP2 ENSG00000164308 CDS Human protein_coding chr5:96244719 chr5:96244719 synonymous SNV . 0 21 hm5C_associated_SNPs_42234 0 17554300 Multiple complex diseases 0.000226228 Johnson and O'Donnell TagSNP rs17486915 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
111 chr5 135517150 135517150 1 + T C rs1057898 135517150 + 135517130 135517170 41 GAAGTGTTTGGTGATTTTTATGGAGAGAGTTTTCCTAAGTG GAAGTGTTTGGTGATTTTTACGGAGAGAGTTTTCCTAAGTG Direct Gain 0 0.774877846240997 Functional Gain 0.774877846240997 SMAD5 ENSG00000113658 UTR3 Human protein_coding chr5:135517150 chr5:135517150 . . 0 21 hm5C_associated_SNPs_42395 0 17052657 Parkinson's disease 0.000184171 Johnson and O'Donnell TagSNP rs1057898 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
112 chr5 173007836 173007836 1 + T C rs12152984 173007836 + 173007816 173007856 41 ACTAACACAACTGCTGGGAATGGGAAAGTTTCAACCTCTTG ACTAACACAACTGCTGGGAACGGGAAAGTTTCAACCTCTTG Direct Gain 0 0.735508441925049 Functional Gain 0.735508441925049 LOC285593 ENSG00000253955 ncRNA_exonic Human antisense chr5:173007836 chr5:173007836 . . 0 21 hm5C_associated_SNPs_42712 0 17463246 Multiple continuous traits in DGI samples 0.0005626 Johnson and O'Donnell TagSNP rs12152984 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
113 chr6 408833 408833 1 + G C rs12211228 408833 + 408813 408853 41 TACGGAACTGCACACTCAGTGGGCTGTTTCTGCTTATTTCA TACGGAACTGCACACTCAGTCGGCTGTTTCTGCTTATTTCA Direct Gain 0 0.620830893516541 Functional Gain 0.620830893516541 IRF4 ENSG00000137265 UTR3 Human protein_coding chr6:408833 chr6:408833 . . 0 21 hm5C_associated_SNPs_42800 0 30531825 Brown vs. black hair color 2e-11 GWAS_Catalog TagSNP rs12211228 GCST006989 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
114 chr6 3077141 3077141 1 + T C rs2272990 3077141 + 3077121 3077161 41 GAACTGGACAGCGGAGGCTTTGGGAAGGTGTCTCTGTGTTT GAACTGGACAGCGGAGGCTTCGGGAAGGTGTCTCTGTGTTT Direct Gain 0 0.787823557853699 Functional Gain 0.787823557853699 RIPK1 ENSG00000137275 CDS Human protein_coding chr6:3077141 chr6:3077141 synonymous SNV . 0 21 hm5C_associated_SNPs_42819 0 24839885 Preschool internalizing problems 5e-07 GWAS_Catalog TagSNP rs2272990 GCST002362 A genome-wide association meta-analysis of preschool internalizing problems.
115 chr6 10415006 10415006 1 + G C rs654351 10415006 + 10414986 10415026 41 AGCATCCACGTCCTCTCTCTGCAGCTTCTCCCCCGCGTTCT AGCATCCACGTCCTCTCTCTCCAGCTTCTCCCCCGCGTTCT Direct Gain 0 0.559929251670837 Functional Gain 0.559929251670837 TFAP2A-AS1 ENSG00000229950 ncRNA_exonic Human antisense chr6:10415006 chr6:10415006 . . 0 21 hm5C_associated_SNPs_42867 0 28604730 Squamous cell lung carcinoma 2e-06 GWAS_Catalog TagSNP rs654351 GCST004750 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
116 chr6 10723449 10723449 1 + A C rs1045911 10723449 + 10723429 10723469 41 TGCGGCTTGCGCGCCCTTGTAGACAGCCGGGGCCTTCGTGA TGCGGCTTGCGCGCCCTTGTCGACAGCCGGGGCCTTCGTGA Direct Gain 0 0.822714805603027 Functional Gain 0.822714805603027 TMEM14C ENSG00000111843 UTR5 Human protein_coding chr6:10723449 chr6:10723449 . . 0 21 hm5C_associated_SNPs_42873 0 30595370 Mean corpuscular hemoglobin 9e-10 GWAS_Catalog TagSNP rs1045911 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
117 chr6 10887253 10887253 1 + G C rs9358956 10887253 + 10887233 10887273 41 TCCGCCACCAGGGCTCTTTCGGCAGCGCCCCCAGCGGGCGG TCCGCCACCAGGGCTCTTTCCGCAGCGCCCCCAGCGGGCGG Direct Gain 0 0.875003337860107 Functional Gain 0.875003337860107 SYCP2L ENSG00000153157 UTR5 Human protein_coding chr6:10887253 chr6:10887253 . . 0 21 hm5C_associated_SNPs_42877 0 30595370 Age at menopause 3e-25 GWAS_Catalog TagSNP rs9358956 GCST007079 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
118 chr6 25452783 25452783 1 + T C rs116272812 25452783 + 25452763 25452803 41 CTAAAATTTGAAATATTTATTAATTAAAAAGTGACACTAAT CTAAAATTTGAAATATTTATCAATTAAAAAGTGACACTAAT Direct Gain 0 0.631174802780151 Functional Gain 0.631174802780151 CARMIL1 ENSG00000079691 intronic Human protein_coding chr6:25452783 chr6:25452783 . . 0 21 hm5C_associated_SNPs_42927 0 30595370 Red cell distribution width 4e-169 GWAS_Catalog TagSNP rs116272812 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
119 chr6 26104280 26104280 1 + T C rs2229768 26104280 + 26104260 26104300 41 GGCATTACAAAACCGGCTATTCGCCGTTTGGCTCGGCGCGG GGCATTACAAAACCGGCTATCCGCCGTTTGGCTCGGCGCGG Direct Gain 0 0.707038402557373 Functional Gain 0.707038402557373 HIST1H4C ENSG00000197061 CDS Human protein_coding chr6:26104280 chr6:26104280 synonymous SNV . 0 21 hm5C_associated_SNPs_42941 0 30598549 Heel bone mineral density 1e-10 GWAS_Catalog TagSNP rs2229768 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
120 chr6 26409890 26409890 1 + G C rs41266839 26409890 + 26409870 26409910 41 GGAAAAAAAGACTCAGTTCAGAAAGAAAAAGAGAGAGCAAG GGAAAAAAAGACTCAGTTCACAAAGAAAAAGAGAGAGCAAG Direct Gain 0 0.644753575325012 Functional Gain 0.644753575325012 BTN3A1 ENSG00000026950 CDS Human protein_coding chr6:26409890 chr6:26409890 nonsynonymous SNV 0.000 0 21 hm5C_associated_SNPs_42954 0 28604730 Lung cancer 4e-09 GWAS_Catalog TagSNP rs41266839 GCST004748 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
121 chr6 29911228 29911228 1 + A C rs9256983 29911228 + 29911208 29911248 41 CAAGTGGGAGGCGGCCCATGAGGCGGAGCAGTTGAGAGCCT CAAGTGGGAGGCGGCCCATGCGGCGGAGCAGTTGAGAGCCT Direct Gain 0 0.906191468238831 Functional Gain 0.906191468238831 HLA-A ENSG00000206503 CDS Human protein_coding chr6:29911228 chr6:29911228 nonsynonymous SNV 0.000 0 21 hm5C_associated_SNPs_43046 0 28928442 Pneumonia 5e-06 GWAS_Catalog TagSNP rs9256983 GCST005009 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
122 chr6 30032522 30032522 1 + A C rs8321 30032522 + 30032502 30032542 41 CTCCCTCCTTTCGGAAGGTGAAGGATACTGGGTTTTTAGAT CTCCCTCCTTTCGGAAGGTGCAGGATACTGGGTTTTTAGAT Direct Gain 0 0.789978384971619 Functional Gain 0.789978384971619 ZNRD1 ENSG00000066379 UTR3 Human protein_coding chr6:30032522 chr6:30032522 . . 0 21 hm5C_associated_SNPs_43056 0 23453885 Autism spectrum disorder, attention deficit-hyperactivity disorder, bipolar disorder, major depressive disorder, and schizophrenia (combined) 8e-09 GWAS_Catalog TagSNP rs8321 GCST001877 Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis.
123 chr6 30131349 30131349 1 + T C rs9261536 30131349 + 30131329 30131369 41 CTTTCTCTCTCTCTGTCTCTTAGCCTTGCAGCCGTTTCCCT CTTTCTCTCTCTCTGTCTCTCAGCCTTGCAGCCGTTTCCCT Direct Gain 0 0.755714535713196 Functional Gain 0.755714535713196 TRIM15 ENSG00000204610 UTR5 Human protein_coding chr6:30131349 chr6:30131349 . . 0 21 hm5C_associated_SNPs_43061 0 17554300 Multiple complex diseases 1.13e-05 Johnson and O'Donnell TagSNP rs9261536 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
124 chr6 30993958 30993958 1 + A C rs2523897 30993958 + 30993938 30993978 41 GACTCCAAGGTGATCACGGCATCCAGCATGAGCTCTGAGAC GACTCCAAGGTGATCACGGCCTCCAGCATGAGCTCTGAGAC Direct Gain 0 0.893078446388245 Functional Gain 0.893078446388245 MUC22 ENSG00000261272 CDS Human protein_coding chr6:30993958 chr6:30993958 synonymous SNV . 0 21 hm5C_associated_SNPs_43096 0 17804836 Rheumatoid Arthritis 6.8e-06 Johnson and O'Donnell TagSNP rs2523897 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
125 chr6 31540141 31540141 1 + A C rs2239704 31540141 + 31540121 31540161 41 CGTGCTTTGGACTACCGCCCAGCAGTGTCCTGCCCTCTGCC CGTGCTTTGGACTACCGCCCCGCAGTGTCCTGCCCTCTGCC Direct Gain 0 0.621819138526917 Functional Gain 0.621819138526917 LTA ENSG00000226979 UTR5 Human protein_coding chr6:31540141 chr6:31540141 . . 0 21 hm5C_associated_SNPs_43121 1 28806749 Cervical cancer 6e-09 GWAS_Catalog TagSNP rs2239704 GCST004833 Defining the genetic susceptibility to cervical neoplasia-A genome-wide association study.
126 chr6 33048460 33048460 1 + T C rs12722013 33048460 + 33048440 33048480 41 TCCCCGCAGAGAATTACCTTTTCCAGGGACGGCAGGAATGC TCCCCGCAGAGAATTACCTTCTCCAGGGACGGCAGGAATGC Direct Gain 0 0.967883706092834 Functional Gain 0.967883706092834 HLA-DPB1 ENSG00000223865 CDS Human protein_coding chr6:33048460 chr6:33048460 nonsynonymous SNV 0.000 0 21 hm5C_associated_SNPs_43211 0 29875488 Blood protein levels 1e-15 GWAS_Catalog TagSNP rs12722013 GCST005806 Genomic atlas of the human plasma proteome.
127 chr6 34825662 34825662 1 + T C rs16894959 34825662 + 34825642 34825682 41 CAAGTCAGAAAGATGAACACTTGGACATCCGACTAGATGCA CAAGTCAGAAAGATGAACACCTGGACATCCGACTAGATGCA Direct Gain 0 0.700039565563202 Functional Gain 0.700039565563202 UHRF1BP1 ENSG00000065060 CDS Human protein_coding chr6:34825662 chr6:34825662 synonymous SNV . 0 21 hm5C_associated_SNPs_43256 0 25673412 Waist circumference 6e-06 GWAS_Catalog TagSNP rs16894959 GCST004065 New genetic loci link adipose and insulin biology to body fat distribution.
128 chr6 36922684 36922684 1 + A C rs1405069 36922684 + 36922664 36922704 41 ACCGGGCCCAGGTATCCCCGACGGCCTCAGACATGCTGCAC ACCGGGCCCAGGTATCCCCGCCGGCCTCAGACATGCTGCAC Direct Gain 0 0.826900243759155 Functional Gain 0.826900243759155 PI16 ENSG00000164530 CDS Human protein_coding chr6:36922684 chr6:36922684 nonsynonymous SNV 0.024 0 21 hm5C_associated_SNPs_43304 0 20237162 Chemerin levels 6e-06 GWAS_Catalog TagSNP rs1405069 GCST000628 Chemerin, a novel adipokine in the regulation of angiogenesis.
129 chr6 50683009 50683009 1 + T C rs78648104 50683009 + 50682989 50683029 41 CCCCGCTCCACCACCAGTCCTTCCATTACGAGTTTCAGCAC CCCCGCTCCACCACCAGTCCCTCCATTACGAGTTTCAGCAC Direct Gain 0 0.951148390769958 Functional Gain 0.951148390769958 TFAP2D ENSG00000008197 CDS Human protein_coding chr6:50683009 chr6:50683009 nonsynonymous SNV 1.000 1 21 hm5C_associated_SNPs_43413 0 28135244 Systolic blood pressure 1e-08 GWAS_Catalog TagSNP rs78648104 GCST004279 Genome-wide association analysis identifies novel blood pressure loci and offers biological insights into cardiovascular risk.
130 chr6 106987370 106987370 1 + A C rs783396 106987370 + 106987350 106987390 41 GTCCTTCTGGGATACAGAAGAAGCGTACATTGGATCCATGC GTCCTTCTGGGATACAGAAGCAGCGTACATTGGATCCATGC Direct Gain 0 0.772050440311432 Functional Gain 0.772050440311432 CRYBG1 ENSG00000112297 CDS Human protein_coding chr6:106987370 chr6:106987370 nonsynonymous SNV 0.899 0 21 hm5C_associated_SNPs_43552 0 17434096 Stroke 9e-06 GWAS_Catalog TagSNP rs783396 GCST000032 A genome-wide genotyping study in patients with ischaemic stroke: initial analysis and data release.
131 chr6 150570867 150570867 1 + A C rs3734729 150570867 + 150570847 150570887 41 TTCTCTCTCCAGGAAAGCAGATCAAAAGAAAGTTAGCAGAT TTCTCTCTCCAGGAAAGCAGCTCAAAAGAAAGTTAGCAGAT Direct Gain 0 0.649299681186676 Functional Gain 0.649299681186676 PPP1R14C ENSG00000198729 UTR3 Human protein_coding chr6:150570867 chr6:150570867 . . 0 21 hm5C_associated_SNPs_43736 0 21946350 Pulmonary function 4e-06 GWAS_Catalog TagSNP rs3734729 GCST001251 Genome-wide association and large-scale follow up identifies 16 new loci influencing lung function.
132 chr6 151670172 151670172 1 + A C rs3734799 151670172 + 151670152 151670192 41 CAGCAGGGGCTGGCGACCACAAGGACCCCAGCCTTGGGGCT CAGCAGGGGCTGGCGACCACCAGGACCCCAGCCTTGGGGCT Direct Gain 0 0.963508665561676 Functional Gain 0.963508665561676 AKAP12 ENSG00000131016 CDS Human protein_coding chr6:151670172 chr6:151670172 nonsynonymous SNV 0.023 0 21 hm5C_associated_SNPs_43751 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0002417 Johnson and O'Donnell TagSNP rs3734799 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
133 chr7 1886333 1886333 1 + A C rs10234557 1886333 + 1886313 1886353 41 TTTGCATTTCTGTTGTTCCCAGAGCGAGGGGATGAGAAGCC TTTGCATTTCTGTTGTTCCCCGAGCGAGGGGATGAGAAGCC Direct Gain 0 0.537730813026428 Functional Gain 0.537730813026428 MAD1L1 ENSG00000002822;ENSG00000176349 intronic Human other chr7:1886333 chr7:1886333 . . 0 21 hm5C_associated_SNPs_43877 0 17554300 Multiple complex diseases 0.000393076 Johnson and O'Donnell TagSNP rs10234557 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
134 chr7 27241473 27241473 1 + T C rs17501292 27241473 + 27241453 27241493 41 CCCCCCACCAAGTGTGCCCTTTCCTTCTTGACTTTTTAGCA CCCCCCACCAAGTGTGCCCTCTCCTTCTTGACTTTTTAGCA Direct Gain 0 0.67985612154007 Functional Gain 0.67985612154007 HOTTIP ENSG00000243766 ncRNA_exonic Human antisense chr7:27241473 chr7:27241473 . . 0 21 hm5C_associated_SNPs_44034 0 30048462 Heel bone mineral density 3e-22 GWAS_Catalog TagSNP rs17501292 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
135 chr7 63726645 63726645 1 + T C rs1830035 63726645 + 63726625 63726665 41 TTCATACTAGGGAGAATTCCTACCAATGTGAAGAATGCGGC TTCATACTAGGGAGAATTCCCACCAATGTGAAGAATGCGGC Direct Gain 0 0.620050609111786 Functional Gain 0.620050609111786 ZNF679 ENSG00000197123 CDS Human protein_coding chr7:63726645 chr7:63726645 nonsynonymous SNV 0.014 1 21 hm5C_associated_SNPs_44223 0 30891314 Rheumatoid arthritis 1e-11 GWAS_Catalog TagSNP rs1830035 GCST007843 Studying the effects of haplotype partitioning methods on the RA-associated genomic results from the North American Rheumatoid Arthritis Consortium (NARAC) dataset.
136 chr7 99971834 99971834 1 + A C rs1859788 99971834 + 99971814 99971854 41 GGAGACGGGGCCACTTCCACAGGCAGTCCTTCTACAGCACA GGAGACGGGGCCACTTCCACCGGCAGTCCTTCTACAGCACA Direct Gain 0 0.801960349082947 Functional Gain 0.801960349082947 PILRA ENSG00000085514 CDS Human protein_coding chr7:99971834 chr7:99971834 synonymous SNV . 0 21 hm5C_associated_SNPs_44429 0 29777097 Family history of Alzheimer's disease 2e-10 GWAS_Catalog TagSNP rs1859788 GCST005921 GWAS on family history of Alzheimer's disease.
137 chr7 128589000 128589000 1 + T C rs2070197 128589000 + 128588980 128589020 41 TGGGTTTCCTGGAAGTGGATTTGGGCCAAGAAGGAGAGGGA TGGGTTTCCTGGAAGTGGATCTGGGCCAAGAAGGAGAGGGA Direct Gain 0 0.825430035591125 Functional Gain 0.825430035591125 IRF5 ENSG00000128604 UTR3 Human protein_coding chr7:128589000 chr7:128589000 . . 0 21 hm5C_associated_SNPs_44615 1 19838195 Systemic lupus erythematosus 6e-24 GWAS_Catalog TagSNP rs2070197 GCST004867 A large-scale replication study identifies TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10 as risk loci for systemic lupus erythematosus.
138 chr7 141491066 141491066 1 + G C rs2234017 141491066 + 141491046 141491086 41 ATGCTGGGGCCCATGATCTGGGAAGAAAAGTGTGGTCAGGA ATGCTGGGGCCCATGATCTGCGAAGAAAAGTGTGGTCAGGA Direct Gain 0 0.541110932826996 Functional Gain 0.541110932826996 TAS2R5 ENSG00000127366 UTR3 Human protein_coding chr7:141491066 chr7:141491066 . . 0 21 hm5C_associated_SNPs_44696 0 27770636 Late-onset Alzheimer's disease 7e-06 GWAS_Catalog TagSNP rs2234017 GCST003815 Two novel loci, COBL and SLC10A2, for Alzheimer's disease in African Americans.
139 chr8 427140 427140 1 + A C rs2100160 427140 + 427120 427160 41 AGTTTCATCCCACTGTGGCCAGAAAAGATATTTTATTTCCT AGTTTCATCCCACTGTGGCCCGAAAAGATATTTTATTTCCT Direct Gain 0 0.532984256744385 Functional Gain 0.532984256744385 FBXO25;TDRP ENSG00000272005 ncRNA_exonic Human other chr8:427140 chr8:427140 . . 0 21 hm5C_associated_SNPs_44873 0 30276832 Initial alcohol sensitivity 5e-06 GWAS_Catalog TagSNP rs2100160 GCST006633 Meta-Analysis of Genetic Influences on Initial Alcohol Sensitivity.
140 chr8 10587008 10587008 1 + G C rs6995692 10587008 + 10586988 10587028 41 ACTCTGGACCTCTTGGACCTGGTGAGTCCGTGTCCCCAGTC ACTCTGGACCTCTTGGACCTCGTGAGTCCGTGTCCCCAGTC Direct Gain 0 0.672369956970215 Functional Gain 0.672369956970215 LOC102723313 ENSG00000248896 ncRNA_exonic Human antisense chr8:10587008 chr8:10587008 . . 0 21 hm5C_associated_SNPs_44941 0 30643258 Number of sexual partners 3e-09 GWAS_Catalog TagSNP rs6995692 GCST007326 Genome-wide association analyses of risk tolerance and risky behaviors in over 1 million individuals identify hundreds of loci and shared genetic influences.
141 chr8 17500223 17500223 1 + T C rs4705 17500223 + 17500203 17500243 41 GTCATTACAGTGGAAGACTTTGAGACGATTGATGCAGGATA GTCATTACAGTGGAAGACTTCGAGACGATTGATGCAGGATA Direct Gain 0 0.720297574996948 Functional Gain 0.720297574996948 PDGFRL ENSG00000104213 CDS Human protein_coding chr8:17500223 chr8:17500223 synonymous SNV . 0 21 hm5C_associated_SNPs_45012 0 26528553 Gut microbiome composition (summer) 4e-06 GWAS_Catalog TagSNP rs4705 GCST003221 Genome-Wide Association Studies of the Human Gut Microbiota.
142 chr8 18067395 18067395 1 + T C rs7845127 18067395 + 18067375 18067415 41 AGCAGGAACCAGGTGAAATATAAGAGCACAGTCCTCCCAGC AGCAGGAACCAGGTGAAATACAAGAGCACAGTCCTCCCAGC Direct Gain 0 0.861998081207275 Functional Gain 0.861998081207275 NAT1 ENSG00000171428 UTR5 Human protein_coding chr8:18067395 chr8:18067395 . . 0 21 hm5C_associated_SNPs_45019 0 27126917 Night sleep phenotypes 3e-06 GWAS_Catalog TagSNP rs7845127 GCST003542 Genome-wide association analysis of actigraphic sleep phenotypes in the LIFE Adult Study.
143 chr8 19824563 19824563 1 + T C rs1059611 19824563 + 19824543 19824583 41 TACATGTGTGGATGTGTAAATGGAGCTTGTACATATTGGAA TACATGTGTGGATGTGTAAACGGAGCTTGTACATATTGGAA Direct Gain 0 0.620838344097137 Functional Gain 0.620838344097137 LPL ENSG00000175445 UTR3 Human protein_coding chr8:19824563 chr8:19824563 . . 0 21 hm5C_associated_SNPs_45031 1 19936222 Lipid metabolism phenotypes 2e-17 GWAS_Catalog TagSNP rs1059611 GCST000533 Forty-three loci associated with plasma lipoprotein size, concentration, and cholesterol content in genome-wide analysis.
144 chr8 22451688 22451688 1 + G C rs3064 22451688 + 22451668 22451708 41 TTTGATCAACCTTTGTGTGCGAGGGTCTAAGTAGGGTCGAA TTTGATCAACCTTTGTGTGCCAGGGTCTAAGTAGGGTCGAA Direct Gain 0 0.522553622722626 Functional Gain 0.522553622722626 PDLIM2 ENSG00000120913 UTR3 Human protein_coding chr8:22451688 chr8:22451688 . . 0 21 hm5C_associated_SNPs_45063 0 18282107 Schizophrenia 0.024244644 Johnson and O'Donnell TagSNP rs3064 . Genome-wide association identifies a common variant in the reelin gene that increases the risk of schizophrenia only in women.
145 chr8 22462852 22462852 1 + T C rs11778693 22462852 + 22462832 22462872 41 GGAATGTCATCGGGGCTCTCTCGAGCCCCTCACCCCGCCAG GGAATGTCATCGGGGCTCTCCCGAGCCCCTCACCCCGCCAG Direct Gain 0 0.785473048686981 Functional Gain 0.785473048686981 CCAR2 ENSG00000158941 UTR5 Human protein_coding chr8:22462852 chr8:22462852 . . 0 21 hm5C_associated_SNPs_45068 0 26242244 Exploratory eye movement dysfunction in schizophrenia (cognitive search score) 4e-06 GWAS_Catalog TagSNP rs11778693 GCST003064 Association of chromosome 5q21.3 polymorphisms with the exploratory eye movement dysfunction in schizophrenia.
146 chr8 67579795 67579795 1 + T C rs7840192 67579795 + 67579775 67579815 41 AGGATGCCGTGCGGTGCGTCTAGCTGCACTTCCTCCTTAGG AGGATGCCGTGCGGTGCGTCCAGCTGCACTTCCTCCTTAGG Direct Gain 0 0.694493234157562 Functional Gain 0.694493234157562 C8orf44;C8orf44-SGK3 ENSG00000175073;ENSG00000213865;ENSG00000270024 upstream Human other chr8:67579795 chr8:67579795 . . 0 21 hm5C_associated_SNPs_45254 0 17463246 Multiple continuous traits in DGI samples 0.00078 Johnson and O'Donnell TagSNP rs7840192 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
147 chr8 144682311 144682311 1 + G C rs3210186 144682311 + 144682291 144682331 41 TTCCTGCTCTGGCCCCCGTGGGGCTGGGCCTCCGCCCCTGC TTCCTGCTCTGGCCCCCGTGCGGCTGGGCCTCCGCCCCTGC Direct Gain 0 0.833164691925049 Functional Gain 0.833164691925049 TIGD5 ENSG00000179886 UTR3 Human protein_coding chr8:144682311 chr8:144682311 . . 0 21 hm5C_associated_SNPs_45454 0 28957414 Red cell distribution width 1e-13 GWAS_Catalog TagSNP rs3210186 GCST006804 Red blood cell distribution width: Genetic evidence for aging pathways in 116,666 volunteers.
148 chr9 1056959 1056959 1 + G C rs17641078 1056959 + 1056939 1056979 41 TCTTAACGAAGATCAGCAAAGAAAACACCAGGCACCCTCTG TCTTAACGAAGATCAGCAAACAAAACACCAGGCACCCTCTG Direct Gain 0 0.711415767669678 Functional Gain 0.711415767669678 DMRT2 ENSG00000173253 CDS Human protein_coding chr9:1056959 chr9:1056959 nonsynonymous SNV 1.000 3 21 hm5C_associated_SNPs_45538 0 18821565 Hyperactive-impulsive symptoms 5e-06 GWAS_Catalog TagSNP rs17641078 GCST000278 Genome-wide association scan of quantitative traits for attention deficit hyperactivity disorder identifies novel associations and confirms candidate gene associations.
149 chr9 6329888 6329888 1 + A C rs898673 6329888 + 6329868 6329908 41 GCTTTGTTTATAATTTCTTTATATATCAAAATGAGTGTTTT GCTTTGTTTATAATTTCTTTCTATATCAAAATGAGTGTTTT Direct Gain 0 0.881150662899017 Functional Gain 0.881150662899017 TPD52L3 ENSG00000170777 UTR3 Human protein_coding chr9:6329888 chr9:6329888 . . 0 21 hm5C_associated_SNPs_45569 0 30595370 Red blood cell count 2e-16 GWAS_Catalog TagSNP rs898673 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
150 chr9 22029547 22029547 1 + T C rs564398 22029547 + 22029527 22029567 41 GGCCCCCATGACTTTCTTTGTGGTAGTTAGGGTGTGGTATG GGCCCCCATGACTTTCTTTGCGGTAGTTAGGGTGTGGTATG Direct Gain 0 0.701374053955078 Functional Gain 0.701374053955078 CDKN2B-AS1 ENSG00000240498 ncRNA_exonic Human antisense chr9:22029547 chr9:22029547 . . 0 21 hm5C_associated_SNPs_45616 0 17463249 Type 2 diabetes 1e-06 GWAS_Catalog TagSNP rs564398 GCST000025 Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes.
151 chr9 109687288 109687288 1 + T C rs1000152 109687288 + 109687268 109687308 41 TTGACAGAGAGATCCCGTTATGGAATGACTGACATGACCAA TTGACAGAGAGATCCCGTTACGGAATGACTGACATGACCAA Direct Gain 0 0.812918365001678 Functional Gain 0.812918365001678 ZNF462 ENSG00000148143 CDS Human protein_coding chr9:109687288 chr9:109687288 synonymous SNV . 0 21 hm5C_associated_SNPs_45921 0 17463246 Multiple continuous traits in DGI samples 0.0002532 Johnson and O'Donnell TagSNP rs1000152 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
152 chr9 139253839 139253839 1 + T C rs1128905 139253839 + 139253819 139253859 41 AGAGGCAGATCTGGGCCTGGTGAGGTGACCTGCTTCTGGAG AGAGGCAGATCTGGGCCTGGCGAGGTGACCTGCTTCTGGAG Direct Gain 0 0.89887261390686 Functional Gain 0.89887261390686 GPSM1 ENSG00000160360 UTR3 Human protein_coding chr9:139253839 chr9:139253839 . . 0 21 hm5C_associated_SNPs_46218 0 23749187 Ankylosing spondylitis 2e-09 GWAS_Catalog TagSNP rs1128905 GCST005529 Identification of multiple risk variants for ankylosing spondylitis through high-density genotyping of immune-related loci.
153 chr10 30728101 30728101 1 + T C rs1042058 30728101 + 30728081 30728121 41 TGGTTGTCATCAGTCAGATATGGAACTGTGGAGGATTTGCT TGGTTGTCATCAGTCAGATACGGAACTGTGGAGGATTTGCT Direct Gain 0 0.506918728351593 Functional Gain 0.506918728351593 MAP3K8 ENSG00000107968 CDS Human protein_coding chr10:30728101 chr10:30728101 synonymous SNV . 0 21 hm5C_associated_SNPs_46437 0 23128233 Inflammatory bowel disease 6e-11 GWAS_Catalog TagSNP rs1042058 GCST001725 Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease.
154 chr10 64564892 64564892 1 + G C rs2236295 64564892 + 64564872 64564912 41 GCCTCACCTTCCGGGGCAGCGGGGGCGGCCGCGGCGCTTCC GCCTCACCTTCCGGGGCAGCCGGGGCGGCCGCGGCGCTTCC Direct Gain 0 0.934071183204651 Functional Gain 0.934071183204651 ADO ENSG00000181915 CDS Human protein_coding chr10:64564892 chr10:64564892 nonsynonymous SNV 0.998 0 21 hm5C_associated_SNPs_46545 0 28437668 Venlafaxine response in generalised anxiety disorder (remitters vs non-remitters after 12 weeks) 5e-06 GWAS_Catalog TagSNP rs2236295 GCST004274 Genome-wide association study of treatment response to venlafaxine XR in generalized anxiety disorder.
155 chr10 71392692 71392692 1 + T C rs1052152 71392692 + 71392672 71392712 41 GGCTTTCCGCAGTGGCATCTTGGCAACCATGCTGTGGAGCC GGCTTTCCGCAGTGGCATCTCGGCAACCATGCTGTGGAGCC Direct Gain 0 0.832156658172607 Functional Gain 0.832156658172607 C10orf35 ENSG00000171224 CDS Human protein_coding chr10:71392692 chr10:71392692 synonymous SNV . 0 21 hm5C_associated_SNPs_46573 0 17554300 Multiple complex diseases 0.000247322 Johnson and O'Donnell TagSNP rs1052152 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
156 chr10 72500763 72500763 1 + T C rs10823607 72500763 + 72500743 72500783 41 CCCAGCCTATGGAGGCCGCCTGTGCTTAGGGCCCATGTTCG CCCAGCCTATGGAGGCCGCCCGTGCTTAGGGCCCATGTTCG Direct Gain 0 0.560553014278412 Functional Gain 0.560553014278412 ADAMTS14 ENSG00000138316 CDS Human protein_coding chr10:72500763 chr10:72500763 nonsynonymous SNV 0.823 0 21 hm5C_associated_SNPs_46584 0 23728906 Sleep duration 5e-06 GWAS_Catalog TagSNP rs10823607 GCST002053 A genome-wide association study of sleep habits and insomnia.
157 chr10 73772336 73772336 1 + T C rs731027 73772336 + 73772316 73772356 41 CCATTCCCAAAGTCAGAAAGTGAAGCCAGATCTCAAGGGCT CCATTCCCAAAGTCAGAAAGCGAAGCCAGATCTCAAGGGCT Direct Gain 0 0.61003190279007 Functional Gain 0.61003190279007 CHST3 ENSG00000122863 UTR3 Human protein_coding chr10:73772336 chr10:73772336 . . 0 21 hm5C_associated_SNPs_46604 4 17554300 Multiple complex diseases 0.000104335 Johnson and O'Donnell TagSNP rs731027 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
158 chr10 99359739 99359739 1 + T C rs2297644 99359739 + 99359719 99359759 41 GAGGGCATCTCTTTGAGCACTGGGCTTTCATTCCACCACAC GAGGGCATCTCTTTGAGCACCGGGCTTTCATTCCACCACAC Direct Gain 0 0.701422870159149 Functional Gain 0.701422870159149 HOGA1 ENSG00000155252;ENSG00000241935;ENSG00000249967 intronic Human other chr10:99359739 chr10:99359739 . . 0 21 hm5C_associated_SNPs_46798 0 22286219 Metabolite levels 1e-12 GWAS_Catalog TagSNP rs2297644 GCST001391 Genome-wide association study identifies multiple loci influencing human serum metabolite levels.
159 chr10 115805056 115805056 1 + G C rs1801253 115805056 + 115805036 115805076 41 ACTTCCGCAAGGCCTTCCAGGGACTGCTCTGCTGCGCGCGC ACTTCCGCAAGGCCTTCCAGCGACTGCTCTGCTGCGCGCGC Direct Gain 0 0.676044106483459 Functional Gain 0.676044106483459 ADRB1 ENSG00000043591 CDS Human protein_coding chr10:115805056 chr10:115805056 nonsynonymous SNV 0.989 0 21 hm5C_associated_SNPs_46924 1 27618447 Systolic blood pressure 1e-10 GWAS_Catalog TagSNP rs1801253 GCST006021 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
160 chr10 121429633 121429633 1 + T C rs2234962 121429633 + 121429613 121429653 41 CCACTCAGCCAGATAAACAGTGTGGACAGGTGGCAGCGGCG CCACTCAGCCAGATAAACAGCGTGGACAGGTGGCAGCGGCG Direct Gain 0 0.608580410480499 Functional Gain 0.608580410480499 BAG3 ENSG00000151929 CDS Human protein_coding chr10:121429633 chr10:121429633 nonsynonymous SNV 1.000 1 21 hm5C_associated_SNPs_46954 4 21459883 Idiopathic dilated cardiomyopathy 4e-12 GWAS_Catalog TagSNP rs2234962 GCST001023 A genome-wide association study identifies two loci associated with heart failure due to dilated cardiomyopathy.
161 chr11 1483177 1483177 1 + T C rs1881505 1483177 + 1483157 1483197 41 GGGGCAGAGGGGCGGTGTCTTGTAGCGGGCGGCAGCGCCAG GGGGCAGAGGGGCGGTGTCTCGTAGCGGGCGGCAGCGCCAG Direct Gain 0 0.678693056106567 Functional Gain 0.678693056106567 BRSK2 ENSG00000174672 UTR3 Human protein_coding chr11:1483177 chr11:1483177 . . 0 21 hm5C_associated_SNPs_47142 0 30595370 Body mass index 8e-09 GWAS_Catalog TagSNP rs1881505 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
162 chr11 2325427 2325427 1 + T C rs61744929 2325427 + 2325407 2325447 41 GAGGGAGGCCCAGGGCCTCATGGCAGGGGTGAGTTCATTGT GAGGGAGGCCCAGGGCCTCACGGCAGGGGTGAGTTCATTGT Direct Gain 0 0.741532802581787 Functional Gain 0.741532802581787 TSPAN32 ENSG00000064201 CDS Human protein_coding chr11:2325427 chr11:2325427 nonsynonymous SNV 0.776 1 21 hm5C_associated_SNPs_47166 0 30595370 Red cell distribution width 5e-14 GWAS_Catalog TagSNP rs61744929 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
163 chr11 17667439 17667439 1 + G C rs11024357 17667439 + 17667419 17667459 41 CTGTGCCACCAATGCCACCTGGGTGCCCTATACAGTGCAGG CTGTGCCACCAATGCCACCTCGGTGCCCTATACAGTGCAGG Direct Gain 0 0.638457715511322 Functional Gain 0.638457715511322 OTOG ENSG00000188162 CDS Human protein_coding chr11:17667439 chr11:17667439 nonsynonymous SNV 0.998 0 21 hm5C_associated_SNPs_47315 1 17434096 Ischemic stroke 2.48e-05 Johnson and O'Donnell TagSNP rs11024357 . A genome-wide genotyping study in patients with ischaemic stroke: initial analysis and data release.
164 chr11 47237680 47237680 1 + T C rs2291120 47237680 + 47237660 47237700 41 TTCACTTCAGACTTACTGTTTGTGGGAGTGTTTTGGGGAAG TTCACTTCAGACTTACTGTTCGTGGGAGTGTTTTGGGGAAG Direct Gain 0 0.504022657871246 Functional Gain 0.504022657871246 DDB2 ENSG00000134574 intronic Human protein_coding chr11:47237680 chr11:47237680 . . 0 21 hm5C_associated_SNPs_47434 0 30595370 Hair color 2e-08 GWAS_Catalog TagSNP rs2291120 GCST007082 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
165 chr11 61278246 61278246 1 + T C rs751984 61278246 + 61278226 61278266 41 CACAGCCAGGGTGGCTGGCATGGGACTGGCACTCTGTACCT CACAGCCAGGGTGGCTGGCACGGGACTGGCACTCTGTACCT Direct Gain 0 0.851509571075439 Functional Gain 0.851509571075439 LRRC10B ENSG00000204950 UTR3 Human protein_coding chr11:61278246 chr11:61278246 . . 0 21 hm5C_associated_SNPs_47544 0 27618452 Systolic blood pressure 4e-09 GWAS_Catalog TagSNP rs751984 GCST006259 The genetics of blood pressure regulation and its target organs from association studies in 342,415 individuals.
166 chr11 61551356 61551356 1 + T C rs174535 61551356 + 61551336 61551376 41 ACCTACCACATCCCTGTCAGTAGTGGCACCCCACTGCACCT ACCTACCACATCCCTGTCAGCAGTGGCACCCCACTGCACCT Direct Gain 0 0.691246151924133 Functional Gain 0.691246151924133 MYRF ENSG00000124920 CDS Human protein_coding chr11:61551356 chr11:61551356 synonymous SNV . 0 21 hm5C_associated_SNPs_47549 0 26974007 Chronic inflammatory diseases (ankylosing spondylitis, Crohn's disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy) 2e-11 GWAS_Catalog TagSNP rs174535 GCST005537 Analysis of five chronic inflammatory diseases identifies 27 new associations and highlights disease-specific patterns at shared loci.
167 chr11 64027666 64027666 1 + A C rs117874826 64027666 + 64027646 64027686 41 TGAGGAGGAAGATGAGGAAGAGGAGGAACAGACAGACCCCA TGAGGAGGAAGATGAGGAAGCGGAGGAACAGACAGACCCCA Direct Gain 0 0.880501568317413 Functional Gain 0.880501568317413 PLCB3 ENSG00000149782 CDS Human protein_coding chr11:64027666 chr11:64027666 nonsynonymous SNV 0.956 1 21 hm5C_associated_SNPs_47600 0 30595370 Systolic blood pressure 9e-10 GWAS_Catalog TagSNP rs117874826 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
168 chr11 65601560 65601560 1 + G C rs17854357 65601560 + 65601540 65601580 41 GAGACGTATGCGGAGGTTGGGAAGGAGGGCAAGGTAGAGAA GAGACGTATGCGGAGGTTGGCAAGGAGGGCAAGGTAGAGAA Direct Gain 0 0.832638263702393 Functional Gain 0.832638263702393 SNX32 ENSG00000172803 CDS Human protein_coding chr11:65601560 chr11:65601560 synonymous SNV . 0 21 hm5C_associated_SNPs_47655 0 30595370 Menarche (age at onset) 2e-08 GWAS_Catalog TagSNP rs17854357 GCST007078 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
169 chr11 66328095 66328095 1 + T C rs1815739 66328095 + 66328075 66328115 41 CAACACTGCCCGAGGCTGACTGAGAGCGAGGTGCCATCATG CAACACTGCCCGAGGCTGACCGAGAGCGAGGTGCCATCATG Direct Gain 0 0.672345697879791 Functional Gain 0.672345697879791 ACTN3 ENSG00000248746 CDS Human protein_coding chr11:66328095 chr11:66328095 unknown . 0 21 hm5C_associated_SNPs_47676 3 29875488 Blood protein levels 8e-12 GWAS_Catalog TagSNP rs1815739 GCST005806 Genomic atlas of the human plasma proteome.
170 chr11 67379016 67379016 1 + T C rs11227859 67379016 + 67378996 67379036 41 CAGACAGGCCTGGGCACAGCTGCGGTGATCGTCATGGACCG CAGACAGGCCTGGGCACAGCCGCGGTGATCGTCATGGACCG Direct Gain 0 0.845378756523132 Functional Gain 0.845378756523132 NDUFV1 ENSG00000167792 CDS Human protein_coding chr11:67379016 chr11:67379016 synonymous SNV . 0 21 hm5C_associated_SNPs_47706 3 29594489 Clostridium difficile infection in multiple myeloma 3e-06 GWAS_Catalog TagSNP rs11227859 GCST005686 Host genetic susceptibility to Clostridium difficile infections in patients undergoing autologous stem cell transplantation: a genome-wide association study.
171 chr11 118355642 118355642 1 + A C rs9332801 118355642 + 118355622 118355662 41 ATCTTGACTTCTGTTCCTATAACACCCAGGGTGGTTTGCTT ATCTTGACTTCTGTTCCTATCACACCCAGGGTGGTTTGCTT Direct Gain 0 0.56793874502182 Functional Gain 0.56793874502182 KMT2A ENSG00000118058 CDS Human protein_coding chr11:118355642 chr11:118355642 synonymous SNV . 0 21 hm5C_associated_SNPs_48025 1 30643256 Depressive symptoms 2e-08 GWAS_Catalog TagSNP rs9332801 GCST007340 Multivariate genome-wide analyses of the well-being spectrum.
172 chr12 3387697 3387697 1 + T C rs16930370 3387697 + 3387677 3387717 41 TCTGCAGCCAACCTGGTCATTGCCATAGGCACCATTGTCAT TCTGCAGCCAACCTGGTCATCGCCATAGGCACCATTGTCAT Direct Gain 0 0.811388850212097 Functional Gain 0.811388850212097 TSPAN9 ENSG00000011105 CDS Human protein_coding chr12:3387697 chr12:3387697 synonymous SNV . 0 21 hm5C_associated_SNPs_48195 0 30595370 Height 3e-17 GWAS_Catalog TagSNP rs16930370 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
173 chr12 10137557 10137557 1 + A C rs479499 10137557 + 10137537 10137577 41 ATTATCACTGCACTTATAAAAAAAGAATGATATGTGAGAAG ATTATCACTGCACTTATAAACAAAGAATGATATGTGAGAAG Direct Gain 0 0.826526045799255 Functional Gain 0.826526045799255 CLEC12A ENSG00000172322 CDS Human protein_coding chr12:10137557 chr12:10137557 nonsynonymous SNV 0.000 0 21 hm5C_associated_SNPs_48310 0 17554300 Multiple complex diseases 0.000504727 Johnson and O'Donnell TagSNP rs479499 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
174 chr12 12870695 12870695 1 + T C rs34330 12870695 + 12870675 12870715 41 CTTCCGAGAGGGGTTCGGGCTGCGTAGGGGCGCTTTGTTTT CTTCCGAGAGGGGTTCGGGCCGCGTAGGGGCGCTTTGTTTT Direct Gain 0 0.755601227283478 Functional Gain 0.755601227283478 CDKN1B ENSG00000111276 UTR5 Human protein_coding chr12:12870695 chr12:12870695 . . 0 21 hm5C_associated_SNPs_48332 1 23273568 Systemic lupus erythematosus 5e-12 GWAS_Catalog TagSNP rs34330 GCST001795 Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians.
175 chr12 26223668 26223668 1 + T C rs2271483 26223668 + 26223648 26223688 41 TTTGTTGTTGTTCAGAGAAATCAAGATCTTATTCACAAAGA TTTGTTGTTGTTCAGAGAAACCAAGATCTTATTCACAAAGA Direct Gain 0 0.509116470813751 Functional Gain 0.509116470813751 RASSF8 ENSG00000123094 UTR3 Human protein_coding chr12:26223668 chr12:26223668 . . 0 21 hm5C_associated_SNPs_48381 0 30598549 Heel bone mineral density 4e-11 GWAS_Catalog TagSNP rs2271483 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
176 chr12 56531154 56531154 1 + T C rs2271192 56531154 + 56531134 56531174 41 CCTGATAGCCAGTTTGGGACTGAGGTGAGTCTATATCTGGA CCTGATAGCCAGTTTGGGACCGAGGTGAGTCTATATCTGGA Direct Gain 0 0.776999175548553 Functional Gain 0.776999175548553 ESYT1 ENSG00000139641 CDS Human protein_coding chr12:56531154 chr12:56531154 synonymous SNV . 0 21 hm5C_associated_SNPs_48621 0 17463246 Multiple continuous traits in DGI samples 0.0008635 Johnson and O'Donnell TagSNP rs2271192 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
177 chr12 108644189 108644189 1 + T C rs9739493 108644189 + 108644169 108644209 41 GCCTTTGTGTTCTCCTGCCTTTCTATGTTTTGAAACTGTAT GCCTTTGTGTTCTCCTGCCTCTCTATGTTTTGAAACTGTAT Direct Gain 0 0.810379505157471 Functional Gain 0.810379505157471 WSCD2 ENSG00000075035 UTR3 Human protein_coding chr12:108644189 chr12:108644189 . . 0 21 hm5C_associated_SNPs_48925 0 18003638 Hypertension 0.008 Johnson and O'Donnell TagSNP rs9739493 . High-density association study and nomination of susceptibility genes for hypertension in the Japanese National Project.
178 chr12 113386950 113386950 1 + T C rs2285932 113386950 + 113386930 113386970 41 GAGCAGGTGAAAAAGGCCATTGACATCATCTTGCGCTGCCT GAGCAGGTGAAAAAGGCCATCGACATCATCTTGCGCTGCCT Direct Gain 0 0.80195951461792 Functional Gain 0.80195951461792 OAS3 ENSG00000111331 CDS Human protein_coding chr12:113386950 chr12:113386950 synonymous SNV . 0 21 hm5C_associated_SNPs_48966 0 17554300 Multiple complex diseases 0.000699843 Johnson and O'Donnell TagSNP rs2285932 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
179 chr12 119419603 119419603 1 + G C rs1568923 119419603 + 119419583 119419623 41 GGTTTCACCCGGACAGAGCCGGGAGCTGGGTGTCGCCCCCG GGTTTCACCCGGACAGAGCCCGGAGCTGGGTGTCGCCCCCG Direct Gain 0 0.831795811653137 Functional Gain 0.831795811653137 SRRM4 ENSG00000139767 UTR5 Human protein_coding chr12:119419603 chr12:119419603 . . 0 21 hm5C_associated_SNPs_48985 0 27182965 Photic sneeze reflex 3e-12 GWAS_Catalog TagSNP rs1568923 GCST003992 Detection and interpretation of shared genetic influences on 42 human traits.
180 chr12 121160615 121160615 1 + A C rs2066938 121160615 + 121160595 121160635 41 AAAAGGACATAACAAGTGAAAGAAGTTTTGGGCTAAAGTAG AAAAGGACATAACAAGTGAACGAAGTTTTGGGCTAAAGTAG Direct Gain 0 0.600664019584656 Functional Gain 0.600664019584656 UNC119B ENSG00000256569 ncRNA_intronic Human antisense chr12:121160615 chr12:121160615 . . 0 21 hm5C_associated_SNPs_49009 0 21886157 Metabolic traits 4e-305 GWAS_Catalog TagSNP rs2066938 GCST001217 Human metabolic individuality in biomedical and pharmaceutical research.
181 chr12 121177272 121177272 1 + G C rs3916 121177272 + 121177252 121177292 41 GCCCGCGGCGGACTGCCCCAGGACTGCGGGAAGGCGCGGGA GCCCGCGGCGGACTGCCCCACGACTGCGGGAAGGCGCGGGA Direct Gain 0 0.669425785541534 Functional Gain 0.669425785541534 ACADS ENSG00000122971 UTR3 Human protein_coding chr12:121177272 chr12:121177272 . . 0 21 hm5C_associated_SNPs_49012 2 24586186 Urinary metabolites (H-NMR features) 2e-22 GWAS_Catalog TagSNP rs3916 GCST002364 Genome-wide association study of metabolic traits reveals novel gene-metabolite-disease links.
182 chr12 121416650 121416650 1 + A C rs1169288 121416650 + 121416630 121416670 41 GGCTGAGCAAAGAGGCACTGATCCAGGCACTGGGTGAGCCG GGCTGAGCAAAGAGGCACTGCTCCAGGCACTGGGTGAGCCG Direct Gain 0 0.847435474395752 Functional Gain 0.847435474395752 HNF1A ENSG00000135100 CDS Human protein_coding chr12:121416650 chr12:121416650 nonsynonymous SNV 0.999 2 21 hm5C_associated_SNPs_49013 4 22010049 Gamma glutamyl transferase levels 2e-18 GWAS_Catalog TagSNP rs1169288 GCST001307 Loci affecting gamma-glutamyl transferase in adults and adolescents show age × SNP interaction and cardiometabolic disease associations.
183 chr12 122219787 122219787 1 + T C rs9165 122219787 + 122219767 122219807 41 GATTCACAGAGCACACTCCCTGGGGGGATACTTTAATCCGG GATTCACAGAGCACACTCCCCGGGGGGATACTTTAATCCGG Direct Gain 0 0.840621411800385 Functional Gain 0.840621411800385 TMEM120B ENSG00000188735 UTR3 Human protein_coding chr12:122219787 chr12:122219787 . . 0 21 hm5C_associated_SNPs_49032 0 27863252 Plateletcrit 2e-26 GWAS_Catalog TagSNP rs9165 GCST004607 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
184 chr13 51856010 51856010 1 + A C rs17837210 51856010 + 51855990 51856030 41 ACACCTGCAAATCTGGATTTATACAAAAGTTGCTAATGTGT ACACCTGCAAATCTGGATTTCTACAAAAGTTGCTAATGTGT Direct Gain 0 0.810960531234741 Functional Gain 0.810960531234741 FAM124A ENSG00000150510 UTR3 Human protein_coding chr13:51856010 chr13:51856010 . . 0 21 hm5C_associated_SNPs_49303 0 29884306 Placental abruption 9e-06 GWAS_Catalog TagSNP rs17837210 GCST005844 Genetic variations and risk of placental abruption: A genome-wide association study and meta-analysis of genome-wide association studies.
185 chr13 110959643 110959643 1 + A C rs7989823 110959643 + 110959623 110959663 41 CGGCCCGGGAGTGTGGCTGCAGTGCGCCGGGACACCAGGGC CGGCCCGGGAGTGTGGCTGCCGTGCGCCGGGACACCAGGGC Direct Gain 0 0.617268562316895 Functional Gain 0.617268562316895 COL4A2 ENSG00000134871 UTR5 Human protein_coding chr13:110959643 chr13:110959643 . . 0 21 hm5C_associated_SNPs_49400 3 28135244 Diastolic blood pressure 3e-07 GWAS_Catalog TagSNP rs7989823 GCST004280 Genome-wide association analysis identifies novel blood pressure loci and offers biological insights into cardiovascular risk.
186 chr14 21570273 21570273 1 + T C rs745696 21570273 + 21570253 21570293 41 CTTCGCAGAGCACCCCGCCTTTGGAAGGTGAGAGGGAAGAA CTTCGCAGAGCACCCCGCCTCTGGAAGGTGAGAGGGAAGAA Direct Gain 0 0.791580080986023 Functional Gain 0.791580080986023 TMEM253 ENSG00000232070 CDS Human protein_coding chr14:21570273 chr14:21570273 synonymous SNV . 0 21 hm5C_associated_SNPs_49486 0 17554300 Multiple complex diseases 0.000906435 Johnson and O'Donnell TagSNP rs745696 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
187 chr14 61924241 61924241 1 + A C rs2230501 61924241 + 61924221 61924261 41 TAGGTGATGCTTGCAAGAGTAAAAGAAACAGGAGACCTCTA TAGGTGATGCTTGCAAGAGTCAAAGAAACAGGAGACCTCTA Direct Gain 0 0.911801993846893 Functional Gain 0.911801993846893 PRKCH ENSG00000027075 CDS Human protein_coding chr14:61924241 chr14:61924241 synonymous SNV . 0 21 hm5C_associated_SNPs_49705 0 17206144 Stroke 9.84e-06 Johnson and O'Donnell TagSNP rs2230501 . A nonsynonymous SNP in PRKCH (protein kinase C eta) increases the risk of cerebral infarction.
188 chr14 64937033 64937033 1 + G C rs3742608 64937033 + 64937013 64937053 41 ATAAGCGCTATTTGGCCAGGGGCAGTGGCTCACGCCTATAA ATAAGCGCTATTTGGCCAGGCGCAGTGGCTCACGCCTATAA Direct Gain 0 0.588933050632477 Functional Gain 0.588933050632477 AKAP5 ENSG00000179841 UTR3 Human protein_coding chr14:64937033 chr14:64937033 . . 0 21 hm5C_associated_SNPs_49740 0 30038396 Educational attainment (MTAG) 9e-12 GWAS_Catalog TagSNP rs3742608 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
189 chr14 70178337 70178337 1 + T C rs945310 70178337 + 70178317 70178357 41 TGGTGGCATATTTCCTTGGCTGAGGATGGAAGATTTGGAGA TGGTGGCATATTTCCTTGGCCGAGGATGGAAGATTTGGAGA Direct Gain 0 0.686581313610077 Functional Gain 0.686581313610077 SUSD6 ENSG00000100647 UTR3 Human protein_coding chr14:70178337 chr14:70178337 . . 0 21 hm5C_associated_SNPs_49784 0 30573740 Male-pattern baldness 1e-15 GWAS_Catalog TagSNP rs945310 GCST007020 Dissection of genetic variation and evidence for pleiotropy in male pattern baldness.
190 chr14 94563193 94563193 1 + T C rs7157940 94563193 + 94563173 94563213 41 CTTTATTAATGCAGCTTTATTCAAACCAGATCCTGAATAAA CTTTATTAATGCAGCTTTATCCAAACCAGATCCTGAATAAA Direct Gain 0 0.632476806640625 Functional Gain 0.632476806640625 IFI27L1 ENSG00000165948 UTR5 Human protein_coding chr14:94563193 chr14:94563193 . . 0 21 hm5C_associated_SNPs_49925 0 19260139 Anthropometric traits 3e-06 GWAS_Catalog TagSNP rs7157940 GCST000327 Genome-wide association study of anthropometric traits in Korcula Island, Croatia.
191 chr14 100141689 100141689 1 + T C rs7158073 100141689 + 100141669 100141709 41 CGGGCGCGTGGAGGTGTTCGTGGGCGGACGCTGGGGCACCG CGGGCGCGTGGAGGTGTTCGCGGGCGGACGCTGGGGCACCG Direct Gain 0 0.972844421863556 Functional Gain 0.972844421863556 HHIPL1 ENSG00000182218 CDS Human protein_coding chr14:100141689 chr14:100141689 nonsynonymous SNV 0.983 0 21 hm5C_associated_SNPs_49967 0 30578418 Pulse pressure 2e-14 GWAS_Catalog TagSNP rs7158073 GCST007269 Trans-ethnic association study of blood pressure determinants in over 750,000 individuals.
192 chr15 57924714 57924714 1 + A C rs147301839 57924714 + 57924694 57924734 41 CCAGTATGAGGAGAAGCTGCAGGAAGAACAGAGGAAGCACA CCAGTATGAGGAGAAGCTGCCGGAAGAACAGAGGAAGCACA Direct Gain 0 0.893728792667389 Functional Gain 0.893728792667389 GCOM1;MYZAP ENSG00000137878;ENSG00000263155 CDS Human other chr15:57924714 chr15:57924714 nonsynonymous SNV 0.995 1 21 hm5C_associated_SNPs_50357 0 30061737 Atrial fibrillation 2e-10 GWAS_Catalog TagSNP rs147301839 GCST006414 Biobank-driven genomic discovery yields new insight into atrial fibrillation biology.
193 chr15 74328116 74328116 1 + A C rs743580 74328116 + 74328096 74328136 41 CCGTGGTGGGGGCAGGGGAAAGCAGAGCCCAGACTCTTGGA CCGTGGTGGGGGCAGGGGAACGCAGAGCCCAGACTCTTGGA Direct Gain 0 0.516085505485535 Functional Gain 0.516085505485535 PML ENSG00000140464 CDS Human protein_coding chr15:74328116 chr15:74328116 nonsynonymous SNV 0.000 1 21 hm5C_associated_SNPs_50487 0 29899525 Accelerometer-based physical activity measurement (fraction of time with accelerations >425 milli-gravities) 1e-09 GWAS_Catalog TagSNP rs743580 GCST006079 Genome-wide association study of habitual physical activity in over 377,000 UK Biobank participants identifies multiple variants including CADM2 and APOE.
194 chr15 78832832 78832832 1 + T C rs3813570 78832832 + 78832812 78832852 41 GGTGGTGGTTTATTCTTCCGTGGAGTTAAGGGCTCCGTGGA GGTGGTGGTTTATTCTTCCGCGGAGTTAAGGGCTCCGTGGA Direct Gain 0 0.93199348449707 Functional Gain 0.93199348449707 PSMA4 ENSG00000041357 UTR5 Human protein_coding chr15:78832832 chr15:78832832 . . 0 21 hm5C_associated_SNPs_50525 0 26634245 Post bronchodilator FEV1/FVC ratio 2e-06 GWAS_Catalog TagSNP rs3813570 GCST003264 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
195 chr15 78833453 78833453 1 + T C rs59683676 78833453 + 78833433 78833473 41 CTGTGGGCCTTGGGAATCATTCAGAGGAGCCCCATTGGCTG CTGTGGGCCTTGGGAATCATCCAGAGGAGCCCCATTGGCTG Direct Gain 0 0.840497493743896 Functional Gain 0.840497493743896 PSMA4 ENSG00000041357 intronic Human protein_coding chr15:78833453 chr15:78833453 . . 0 21 hm5C_associated_SNPs_50528 0 26634245 Post bronchodilator FEV1/FVC ratio 5e-07 GWAS_Catalog TagSNP rs59683676 GCST003264 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
196 chr15 85187245 85187245 1 + T C rs34069323 85187245 + 85187225 85187265 41 GTAGCATCTGCCCTCAGTGTTGGCAGCTGATGACTCCGTGG GTAGCATCTGCCCTCAGTGTCGGCAGCTGATGACTCCGTGG Direct Gain 0 0.892658531665802 Functional Gain 0.892658531665802 WDR73 ENSG00000177082 intronic Human protein_coding chr15:85187245 chr15:85187245 . . 0 21 hm5C_associated_SNPs_50582 0 24024966 Periodontitis (CDC/AAP) 2e-06 GWAS_Catalog TagSNP rs34069323 GCST002126 Genome-wide association study of chronic periodontitis in a general German population.
197 chr15 85415386 85415386 1 + T C rs12900463 85415386 + 85415366 85415406 41 GCTAGGCGGTCAGATAACACTACGAGGGGCAGCATGGCCAC GCTAGGCGGTCAGATAACACCACGAGGGGCAGCATGGCCAC Direct Gain 0 0.813815116882324 Functional Gain 0.813815116882324 ALPK3 ENSG00000136383 UTR3 Human protein_coding chr15:85415386 chr15:85415386 . . 0 21 hm5C_associated_SNPs_50589 0 23648065 Adverse response to chemotherapy (neutropenia/leucopenia) (gemcitabine) 4e-06 GWAS_Catalog TagSNP rs12900463 GCST002003 Genome-wide association study of chemotherapeutic agent-induced severe neutropenia/leucopenia for patients in Biobank Japan.
198 chr15 93564972 93564972 1 + T C rs7179432 93564972 + 93564952 93564992 41 TATGTTCTGTGTCTAACCTTTTAAAACCTGGAACACAGATA TATGTTCTGTGTCTAACCTTCTAAAACCTGGAACACAGATA Direct Gain 0 0.781640946865082 Functional Gain 0.781640946865082 CHD2 ENSG00000173575 UTR3 Human protein_coding chr15:93564972 chr15:93564972 . . 0 21 hm5C_associated_SNPs_50707 0 23382691 IgG glycosylation 4e-06 GWAS_Catalog TagSNP rs7179432 GCST001848 Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers.
199 chr16 4476089 4476089 1 + T C rs1139652 4476089 + 4476069 4476109 41 TTGAGACCTGGTGTCAGCCTTACAGGTGAGGGCAGGTTCCA TTGAGACCTGGTGTCAGCCTCACAGGTGAGGGCAGGTTCCA Direct Gain 0 0.757093548774719 Functional Gain 0.757093548774719 DNAJA3 ENSG00000103423 CDS Human protein_coding chr16:4476089 chr16:4476089 nonsynonymous SNV 0.896 1 21 hm5C_associated_SNPs_50986 0 30595370 White blood cell count 2e-09 GWAS_Catalog TagSNP rs1139652 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
200 chr16 15818141 15818141 1 + A C rs2075511 15818141 + 15818121 15818161 41 GTCTTTTCCAGTTTATCATAAGCGGCCGCCTTCTCCTCGTA GTCTTTTCCAGTTTATCATACGCGGCCGCCTTCTCCTCGTA Direct Gain 0 0.509604811668396 Functional Gain 0.509604811668396 MYH11 ENSG00000133392 CDS Human protein_coding chr16:15818141 chr16:15818141 synonymous SNV . 0 21 hm5C_associated_SNPs_51069 3 17554300 Multiple complex diseases 2.08982e-05 Johnson and O'Donnell TagSNP rs2075511 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
201 chr16 31091209 31091209 1 + T C rs3751855 31091209 + 31091189 31091229 41 ATAGAGCCCAGGCTGGAGACTGCCGAGAAGGGCTGCCAGAC ATAGAGCCCAGGCTGGAGACCGCCGAGAAGGGCTGCCAGAC Direct Gain 0 0.536234557628632 Functional Gain 0.536234557628632 ZNF646 ENSG00000167395 CDS Human protein_coding chr16:31091209 chr16:31091209 synonymous SNV . 0 21 hm5C_associated_SNPs_51235 0 29500382 Feeling tense 2e-08 GWAS_Catalog TagSNP rs3751855 GCST006952 Item-level analyses reveal genetic heterogeneity in neuroticism.
202 chr16 31203529 31203529 1 + G C rs4889537 31203529 + 31203509 31203549 41 TGCCTGTACTCAGAGGGCTTGAGGTCATTGACATTATGAGA TGCCTGTACTCAGAGGGCTTCAGGTCATTGACATTATGAGA Direct Gain 0 0.774523138999939 Functional Gain 0.774523138999939 FUS ENSG00000089280 downstream Human protein_coding chr16:31203529 chr16:31203529 . . 0 21 hm5C_associated_SNPs_51243 1 17463246 Multiple continuous traits in DGI samples 0.0003652 Johnson and O'Donnell TagSNP rs4889537 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
203 chr16 67233266 67233266 1 + A C rs12923138 67233266 + 67233246 67233286 41 ACGTGGTGAAGATTGCCATCAAGATGCGTGACGCCATCCCG ACGTGGTGAAGATTGCCATCCAGATGCGTGACGCCATCCCG Direct Gain 0 0.844441533088684 Functional Gain 0.844441533088684 ELMO3 ENSG00000102890 CDS Human protein_coding chr16:67233266 chr16:67233266 nonsynonymous SNV 0.964 0 21 hm5C_associated_SNPs_51384 0 29785010 Intraocular pressure 1e-07 GWAS_Catalog TagSNP rs12923138 GCST006412 Genome-wide analyses identify 68 new loci associated with intraocular pressure and improve risk prediction for primary open-angle glaucoma.
204 chr16 67911517 67911517 1 + T C rs8060686 67911517 + 67911497 67911537 41 GAGGAGAGCGAAGACTGCTGTGAGGAGAGCAGCCCAACAGT GAGGAGAGCGAAGACTGCTGCGAGGAGAGCAGCCCAACAGT Direct Gain 0 0.74704110622406 Functional Gain 0.74704110622406 EDC4 ENSG00000038358 CDS Human protein_coding chr16:67911517 chr16:67911517 synonymous SNV . 0 21 hm5C_associated_SNPs_51392 0 22399527 Metabolic syndrome 2e-10 GWAS_Catalog TagSNP rs8060686 GCST001436 Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits.
205 chr16 76501304 76501304 1 + G C rs6564343 76501304 + 76501284 76501324 41 AGTCCACTTGGTGGATTTCAGGGATGTATGAGGCTCATTTC AGTCCACTTGGTGGATTTCACGGATGTATGAGGCTCATTTC Direct Gain 0 0.800185084342957 Functional Gain 0.800185084342957 CNTNAP4 ENSG00000152910 CDS Human protein_coding chr16:76501304 chr16:76501304 nonsynonymous SNV 1.000 2 21 hm5C_associated_SNPs_51479 0 17554300 Multiple complex diseases 0.000384326 Johnson and O'Donnell TagSNP rs6564343 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
206 chr16 87678144 87678144 1 + T C rs918368 87678144 + 87678124 87678164 41 TTTCGGCGCTCGCTGCTGAGTGGGCTGAAGCTGCGCAAGTC TTTCGGCGCTCGCTGCTGAGCGGGCTGAAGCTGCGCAAGTC Direct Gain 0 0.737470388412476 Functional Gain 0.737470388412476 JPH3 ENSG00000154118 CDS Human protein_coding chr16:87678144 chr16:87678144 synonymous SNV . 0 21 hm5C_associated_SNPs_51587 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.000686 Johnson and O'Donnell TagSNP rs918368 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
207 chr16 90066936 90066936 1 + A C rs4785763 90066936 + 90066916 90066956 41 GGGCCCCCGGCCCTTCTCGGAGAAGTCTACCTATGAGGAGT GGGCCCCCGGCCCTTCTCGGCGAAGTCTACCTATGAGGAGT Direct Gain 0 0.607725501060486 Functional Gain 0.607725501060486 AFG3L1P ENSG00000223959 ncRNA_exonic Human transcribed_unitary_pseudogene chr16:90066936 chr16:90066936 . . 0 21 hm5C_associated_SNPs_51680 0 19578364 Melanoma 6e-22 GWAS_Catalog TagSNP rs4785763 GCST000437 Genome-wide association study identifies three loci associated with melanoma risk.
208 chr17 1630395 1630395 1 + T C rs59643265 1630395 + 1630375 1630415 41 GGGGCAGACCCTGGGGAGGGTGAGGAGGGGAGGATTCTTCT GGGGCAGACCCTGGGGAGGGCGAGGAGGGGAGGATTCTTCT Direct Gain 0 0.843564689159393 Functional Gain 0.843564689159393 WDR81 ENSG00000167716 CDS Human protein_coding chr17:1630395 chr17:1630395 synonymous SNV . 0 21 hm5C_associated_SNPs_51705 1 30595370 Height 1e-24 GWAS_Catalog TagSNP rs59643265 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
209 chr17 5280440 5280440 1 + T C rs3026101 5280440 + 5280420 5280460 41 GAGTTGGTATTAAAATACCGTGAGGACATCATTAATGTGCG GAGTTGGTATTAAAATACCGCGAGGACATCATTAATGTGCG Direct Gain 0 0.508753657341003 Functional Gain 0.508753657341003 RABEP1 ENSG00000029725 CDS Human protein_coding chr17:5280440 chr17:5280440 synonymous SNV . 0 21 hm5C_associated_SNPs_51788 0 28892062 Body mass index 9e-09 GWAS_Catalog TagSNP rs3026101 GCST004904 Genome-wide association study identifies 112 new loci for body mass index in the Japanese population.
210 chr17 17707105 17707105 1 + T C rs3818717 17707105 + 17707085 17707125 41 CAAGAAGCCGGGGCCACCATTGGGTGCTGCCACAAAGGATG CAAGAAGCCGGGGCCACCATCGGGTGCTGCCACAAAGGATG Direct Gain 0 0.91571307182312 Functional Gain 0.91571307182312 RAI1 ENSG00000108557 CDS Human protein_coding chr17:17707105 chr17:17707105 synonymous SNV . 0 21 hm5C_associated_SNPs_51936 1 27863252 Lymphocyte counts 1e-12 GWAS_Catalog TagSNP rs3818717 GCST004627 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
211 chr17 19912710 19912710 1 + T C rs8067545 19912710 + 19912690 19912730 41 GGAGCCGTGGCCGCTGGGGGTTGCGGCGGCGCTGAGCCAGC GGAGCCGTGGCCGCTGGGGGCTGCGGCGGCGCTGAGCCAGC Direct Gain 0 0.560233592987061 Functional Gain 0.560233592987061 SPECC1 ENSG00000128487 UTR5 Human protein_coding chr17:19912710 chr17:19912710 . . 0 21 hm5C_associated_SNPs_51982 0 26198764 Schizophrenia 1e-06 GWAS_Catalog TagSNP rs8067545 GCST003048 Genome-wide association study of schizophrenia in Ashkenazi Jews.
212 chr17 29704002 29704002 1 + T C rs1048317 29704002 + 29703982 29704022 41 CTTCTATCCTGTGTCCTAGTTGGGGAGACAGAGTGCCAGCC CTTCTATCCTGTGTCCTAGTCGGGGAGACAGAGTGCCAGCC Direct Gain 0 0.961705207824707 Functional Gain 0.961705207824707 NF1 ENSG00000196712 UTR3 Human protein_coding chr17:29704002 chr17:29704002 . . 0 21 hm5C_associated_SNPs_52083 4 17052657 Parkinson's disease 0.000298283 Johnson and O'Donnell TagSNP rs1048317 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
213 chr17 34900836 34900836 1 + G C rs3736166 34900836 + 34900816 34900856 41 CGGAGCTGCGCTCCCGCCCAGGCCGGCCCTGACGCGGGCCT CGGAGCTGCGCTCCCGCCCACGCCGGCCCTGACGCGGGCCT Direct Gain 0 0.56735372543335 Functional Gain 0.56735372543335 GGNBP2 ENSG00000005955 UTR5 Human other chr17:34900836 chr17:34900836 . . 0 21 hm5C_associated_SNPs_52131 0 30038396 Highest math class taken 1e-08 GWAS_Catalog TagSNP rs3736166 GCST006574 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
214 chr17 35306312 35306312 1 + G C rs2306658 35306312 + 35306292 35306332 41 GCCTCCGCGCGGTCTCTGGCGGAGTCGGGGAATCGGATCAA GCCTCCGCGCGGTCTCTGGCCGAGTCGGGGAATCGGATCAA Direct Gain 0 0.568504214286804 Functional Gain 0.568504214286804 AATF ENSG00000108270 UTR5 Human other chr17:35306312 chr17:35306312 . . 0 21 hm5C_associated_SNPs_52138 0 23251661 Obesity-related traits 2e-06 GWAS_Catalog TagSNP rs2306658 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
215 chr17 66364804 66364804 1 + T C rs1558878 66364804 + 66364784 66364824 41 GCCTGTATGGTGCAGGGCTCTGGGAGATGGACAGTCTGGTG GCCTGTATGGTGCAGGGCTCCGGGAGATGGACAGTCTGGTG Direct Gain 0 0.866368651390076 Functional Gain 0.866368651390076 ARSG ENSG00000141337 CDS Human protein_coding chr17:66364804 chr17:66364804 nonsynonymous SNV 0.006 1 21 hm5C_associated_SNPs_52510 0 18057069 Amyotrophic Lateral Sclerosis (ALS) 3.5e-05 Johnson and O'Donnell TagSNP rs1558878 . A genome-wide association study of sporadic ALS in a homogenous Irish population.
216 chr18 48514395 48514395 1 + T C rs8088712 48514395 + 48514375 48514415 41 ATTCAAAAGAAATGAGCCATTAAGTGAAGCTTATGAACCTG ATTCAAAAGAAATGAGCCATCAAGTGAAGCTTATGAACCTG Direct Gain 0 0.781752169132233 Functional Gain 0.781752169132233 ELAC1 ENSG00000141642 UTR3 Human protein_coding chr18:48514395 chr18:48514395 . . 0 21 hm5C_associated_SNPs_52948 0 30595370 Eosinophil counts 6e-10 GWAS_Catalog TagSNP rs8088712 GCST007065 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
217 chr18 51057298 51057298 1 + A C rs2270954 51057298 + 51057278 51057318 41 TTTAAGCTGCTAGAATAGTCATGGGCCTTTGTCACTGCAGT TTTAAGCTGCTAGAATAGTCCTGGGCCTTTGTCACTGCAGT Direct Gain 0 0.755648195743561 Functional Gain 0.755648195743561 DCC ENSG00000264263 ncRNA_intronic Human antisense chr18:51057298 chr18:51057298 . . 0 21 hm5C_associated_SNPs_52953 0 17554300 Multiple complex diseases 0.000366914 Johnson and O'Donnell TagSNP rs2270954 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
218 chr18 54696407 54696407 1 + T C rs1657396 54696407 + 54696387 54696427 41 TCAGGAAAGAGGTGTGAGAGTGGTAGGCAGCCTGCCGCAAA TCAGGAAAGAGGTGTGAGAGCGGTAGGCAGCCTGCCGCAAA Direct Gain 0 0.606361031532288 Functional Gain 0.606361031532288 WDR7 ENSG00000267225 ncRNA_intronic Human sense_overlapping chr18:54696407 chr18:54696407 . . 0 21 hm5C_associated_SNPs_52963 0 17554300 Multiple complex diseases 0.000954354 Johnson and O'Donnell TagSNP rs1657396 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
219 chr18 77156103 77156103 1 + G C rs71359461 77156103 + 77156083 77156123 41 CCCTCGATGACTTTCCTCCGGGGCGCGCGGCGCTGAGCCCG CCCTCGATGACTTTCCTCCGCGGCGCGCGGCGCTGAGCCCG Direct Gain 0 0.772092700004578 Functional Gain 0.772092700004578 NFATC1 ENSG00000131196 UTR5 Human protein_coding chr18:77156103 chr18:77156103 . . 0 21 hm5C_associated_SNPs_53062 0 28452372 Glomerular filtration rate (creatinine) 4e-10 GWAS_Catalog TagSNP rs71359461 GCST004292 1000 Genomes-based meta-analysis identifies 10 novel loci for kidney function.
220 chr19 1056492 1056492 1 + G C rs3752246 1056492 + 1056472 1056512 41 CAAGGAGCAGCTGTCTGAGGGTGCACTGTGAGTCCCTCCAC CAAGGAGCAGCTGTCTGAGGCTGCACTGTGAGTCCCTCCAC Direct Gain 0 0.700020968914032 Functional Gain 0.700020968914032 ABCA7 ENSG00000064687 CDS Human protein_coding chr19:1056492 chr19:1056492 nonsynonymous SNV 0.014 1 21 hm5C_associated_SNPs_53113 0 21460841 Alzheimer's disease (late onset) 6e-07 GWAS_Catalog TagSNP rs3752246 GCST001026 Common variants at MS4A4/MS4A6E, CD2AP, CD33 and EPHA1 are associated with late-onset Alzheimer's disease.
221 chr19 1086043 1086043 1 + T C rs3761026 1086043 + 1086023 1086063 41 ACCACAGGTGGCTTCTCTCTTGCCTGCTCCTGTCCCTCCAG ACCACAGGTGGCTTCTCTCTCGCCTGCTCCTGTCCCTCCAG Direct Gain 0 0.90347158908844 Functional Gain 0.90347158908844 ARHGAP45 ENSG00000180448 UTR3 Human protein_coding chr19:1086043 chr19:1086043 . . 0 21 hm5C_associated_SNPs_53119 0 28441456 Facial morphology (factor 14, intercanthal width) 1e-06 GWAS_Catalog TagSNP rs3761026 GCST004318 Genome-wide association study of facial morphology reveals novel associations with FREM1 and PARK2.
222 chr19 2226772 2226772 1 + G C rs2302061 2226772 + 2226752 2226792 41 CCAAGGCCCGGGACCGCGAGGTCGACCTCAAGAATGGCCAC CCAAGGCCCGGGACCGCGAGCTCGACCTCAAGAATGGCCAC Direct Gain 0 0.561359345912933 Functional Gain 0.561359345912933 DOT1L ENSG00000104885 CDS Human protein_coding chr19:2226772 chr19:2226772 nonsynonymous SNV 0.004 0 21 hm5C_associated_SNPs_53161 0 27618448 Systolic blood pressure 6e-08 GWAS_Catalog TagSNP rs2302061 GCST006228 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
223 chr19 7083629 7083629 1 + A C rs966591 7083629 + 7083609 7083649 41 AAATCCTTTAATGTTCTCTCATCCGTTAAGAAACACATGAG AAATCCTTTAATGTTCTCTCCTCCGTTAAGAAACACATGAG Direct Gain 0 0.750001728534698 Functional Gain 0.750001728534698 ZNF557 ENSG00000130544 CDS Human protein_coding chr19:7083629 chr19:7083629 synonymous SNV . 0 21 hm5C_associated_SNPs_53268 0 17554300 Multiple complex diseases 0.000678787 Johnson and O'Donnell TagSNP rs966591 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
224 chr19 7084307 7084307 1 + T C rs6510944 7084307 + 7084287 7084327 41 AGGTATGAACAGTAGACATTTGGAACCATCTGGAAAACTTG AGGTATGAACAGTAGACATTCGGAACCATCTGGAAAACTTG Direct Gain 0 0.688005566596985 Functional Gain 0.688005566596985 ZNF557 ENSG00000130544 UTR3 Human protein_coding chr19:7084307 chr19:7084307 . . 0 21 hm5C_associated_SNPs_53270 0 17554300 Multiple complex diseases 0.000728267 Johnson and O'Donnell TagSNP rs6510944 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
225 chr19 10802792 10802792 1 + A C rs13465 10802792 + 10802772 10802812 41 GTGTTGCCCTCTGTCCTGGCAGGGAAACATACACCCCTTGT GTGTTGCCCTCTGTCCTGGCCGGGAAACATACACCCCTTGT Direct Gain 0 0.741057872772217 Functional Gain 0.741057872772217 ILF3 ENSG00000129351 UTR3 Human protein_coding chr19:10802792 chr19:10802792 . . 0 21 hm5C_associated_SNPs_53328 0 17463246 Multiple continuous traits in DGI samples 0.0006368 Johnson and O'Donnell TagSNP rs13465 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
226 chr19 11242307 11242307 1 + G C rs2738464 11242307 + 11242287 11242327 41 AAACATGGAAGATGAAAGGGGAGGGGATGTCAGGCCCAGAG AAACATGGAAGATGAAAGGGCAGGGGATGTCAGGCCCAGAG Direct Gain 0 0.78915810585022 Functional Gain 0.78915810585022 LDLR ENSG00000130164 UTR3 Human protein_coding chr19:11242307 chr19:11242307 . . 0 21 hm5C_associated_SNPs_53341 1 28334899 LDL cholesterol levels 3e-15 GWAS_Catalog TagSNP rs2738464 GCST004233 Association analyses of East Asian individuals and trans-ancestry analyses with European individuals reveal new loci associated with cholesterol and triglyceride levels.
227 chr19 13207284 13207284 1 + G C rs11555274 13207284 + 13207264 13207304 41 CACAAGGTGGCTGGCTCCAGGGGCGGCTTTTGTTGGAAGTT CACAAGGTGGCTGGCTCCAGCGGCGGCTTTTGTTGGAAGTT Direct Gain 0 0.794636905193329 Functional Gain 0.794636905193329 NFIX ENSG00000008441 UTR3 Human protein_coding chr19:13207284 chr19:13207284 . . 0 21 hm5C_associated_SNPs_53389 0 29326435 Intelligence (MTAG) 2e-08 GWAS_Catalog TagSNP rs11555274 GCST005316 A combined analysis of genetically correlated traits identifies 187 loci and a role for neurogenesis and myelination in intelligence.
228 chr19 19467937 19467937 1 + T C rs2285627 19467937 + 19467917 19467957 41 GATTGCTCAGGTCAGCTGCTTGGGGCTCCCAGGCTGGGTGT GATTGCTCAGGTCAGCTGCTCGGGGCTCCCAGGCTGGGTGT Direct Gain 0 0.766443252563477 Functional Gain 0.766443252563477 MAU2 ENSG00000129933 UTR3 Human protein_coding chr19:19467937 chr19:19467937 . . 0 21 hm5C_associated_SNPs_53538 0 27863252 White blood cell count (basophil) 1e-09 GWAS_Catalog TagSNP rs2285627 GCST004618 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
229 chr19 19654117 19654117 1 + G C rs7252453 19654117 + 19654097 19654137 41 TACGGGGCCCACCTGGAGCTGCGGGGACTGCGCCCAGACCA TACGGGGCCCACCTGGAGCTCCGGGGACTGCGCCCAGACCA Direct Gain 0 0.88130509853363 Functional Gain 0.88130509853363 CILP2 ENSG00000160161 CDS Human protein_coding chr19:19654117 chr19:19654117 synonymous SNV . 0 21 hm5C_associated_SNPs_53540 0 30038396 Self-reported math ability 4e-14 GWAS_Catalog TagSNP rs7252453 GCST006573 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
230 chr19 45395714 45395714 1 + T C rs157581 45395714 + 45395694 45395734 41 AAAGGGTTGAGTAACCATTTTCAGGTGAGCCTTCCTGGTGT AAAGGGTTGAGTAACCATTTCCAGGTGAGCCTTCCTGGTGT Direct Gain 0 0.623375177383423 Functional Gain 0.623375177383423 TOMM40 ENSG00000130204 CDS Human protein_coding chr19:45395714 chr19:45395714 synonymous SNV . 0 21 hm5C_associated_SNPs_53848 0 30361487 Cerebral amyloid deposition (PET imaging) 9e-12 GWAS_Catalog TagSNP rs157581 GCST006904 Genome-wide association study of brain amyloid deposition as measured by Pittsburgh Compound-B (PiB)-PET imaging.
231 chr19 46181392 46181392 1 + G C rs1800437 46181392 + 46181372 46181412 41 TGCCCCTGCTGGGTGTCCACGAGGTGGTGTTTGCTCCCGTG TGCCCCTGCTGGGTGTCCACCAGGTGGTGTTTGCTCCCGTG Direct Gain 0 0.778656005859375 Functional Gain 0.778656005859375 GIPR ENSG00000010310 CDS Human protein_coding chr19:46181392 chr19:46181392 nonsynonymous SNV 1.000 4 21 hm5C_associated_SNPs_53880 0 29093273 GIP levels in response to oral glucose tolerance test (fasting) 4e-15 GWAS_Catalog TagSNP rs1800437 GCST005167 Genetic determinants of circulating GIP and GLP-1 concentrations.
232 chr19 48205725 48205725 1 + T C rs3745760 48205725 + 48205705 48205745 41 TCCCGAAGACGCCGGGACAGTCGGGTGTCCGCCCTCAGCCT TCCCGAAGACGCCGGGACAGCCGGGTGTCCGCCCTCAGCCT Direct Gain 0 0.725878715515137 Functional Gain 0.725878715515137 BICRA ENSG00000268746 ncRNA_intronic Human lincRNA chr19:48205725 chr19:48205725 . . 0 21 hm5C_associated_SNPs_53906 0 22174851 HIV-1 susceptibility 8e-07 GWAS_Catalog TagSNP rs3745760 GCST001353 Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure.
233 chr19 50957600 50957600 1 + T C rs150466277 50957600 + 50957580 50957620 41 CCTTGTCTGGGAGCCACCAATGTACGATGGGGGGAAGCCAG CCTTGTCTGGGAGCCACCAACGTACGATGGGGGGAAGCCAG Direct Gain 0 0.560358703136444 Functional Gain 0.560358703136444 MYBPC2 ENSG00000086967 CDS Human protein_coding chr19:50957600 chr19:50957600 nonsynonymous SNV 0.619 0 21 hm5C_associated_SNPs_54011 0 29907492 Cognitive function 1e-07 GWAS_Catalog TagSNP rs150466277 GCST006933 Polygenic risk score, genome-wide association, and gene set analyses of cognitive domain deficits in schizophrenia.
234 chr19 52197457 52197457 1 + T C rs35018336 52197457 + 52197437 52197477 41 GAGACTCAGAGGGTGGAAGATGGAGACTCAAAGAGGATGGA GAGACTCAGAGGGTGGAAGACGGAGACTCAAAGAGGATGGA Direct Gain 0 0.645525753498077 Functional Gain 0.645525753498077 SPACA6 ENSG00000182310;ENSG00000273318 ncRNA_exonic Human other chr19:52197457 chr19:52197457 . . 0 21 hm5C_associated_SNPs_54026 0 28927378 Caudate activity during reward 7e-06 GWAS_Catalog TagSNP rs35018336 GCST004970 Genome-wide imaging association study implicates functional activity and glial homeostasis of the caudate in smoking addiction.
235 chr19 55144711 55144711 1 + G C rs61739176 55144711 + 55144691 55144731 41 TACAGGTGCTACGGCTCACAGAGCTCCAAACCCTACCTGCT TACAGGTGCTACGGCTCACACAGCTCCAAACCCTACCTGCT Direct Gain 0 0.836640000343323 Functional Gain 0.836640000343323 LILRB1 ENSG00000104972 CDS Human protein_coding chr19:55144711 chr19:55144711 nonsynonymous SNV 0.000 0 21 hm5C_associated_SNPs_54136 0 29875488 Blood protein levels 2e-284 GWAS_Catalog TagSNP rs61739176 GCST005806 Genomic atlas of the human plasma proteome.
236 chr20 76962 76962 1 + T C rs6111385 76962 + 76942 76982 41 GAGACTACTATGCCACCATCTGAGGCCACTACTCCCGAGAC GAGACTACTATGCCACCATCCGAGGCCACTACTCCCGAGAC Direct Gain 0 0.938553035259247 Functional Gain 0.938553035259247 DEFB125 ENSG00000178591 CDS Human protein_coding chr20:76962 chr20:76962 synonymous SNV . 0 21 hm5C_associated_SNPs_54291 0 17052657 Parkinson's disease 0.000209133 Johnson and O'Donnell TagSNP rs6111385 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
237 chr20 31437619 31437619 1 + G C rs140911738 31437619 + 31437599 31437639 41 GCCAGGCTGGGGTGTTTTCGGTATCTGCTGTTCACAGCTCT GCCAGGCTGGGGTGTTTTCGCTATCTGCTGTTCACAGCTCT Direct Gain 0 0.632149219512939 Functional Gain 0.632149219512939 MAPRE1 ENSG00000260536 ncRNA_intronic Human antisense chr20:31437619 chr20:31437619 . . 0 21 hm5C_associated_SNPs_54469 0 28334935 Iron status biomarkers (transferrin saturation) 4e-07 GWAS_Catalog TagSNP rs140911738 GCST004572 Genome-wide association study of iron traits and relation to diabetes in the Hispanic Community Health Study/Study of Latinos (HCHS/SOL): potential genomic intersection of iron and glucose regulation?
238 chr20 43538733 43538733 1 + T C rs2072727 43538733 + 43538713 43538753 41 CGCCCGGGTGAGCGCGGGGCTGCTGGGTGACCCGGCTCCTG CGCCCGGGTGAGCGCGGGGCCGCTGGGTGACCCGGCTCCTG Direct Gain 0 0.7107013463974 Functional Gain 0.7107013463974 PABPC1L ENSG00000101104 UTR5 Human protein_coding chr20:43538733 chr20:43538733 . . 0 21 hm5C_associated_SNPs_54579 0 30595370 Morning person 4e-09 GWAS_Catalog TagSNP rs2072727 GCST007083 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
239 chr20 57597970 57597970 1 + A C rs463312 57597970 + 57597950 57597990 41 CCGCGGGGCCTCGGCCTTGCAGCTGGAGAGAATCAGCGTGT CCGCGGGGCCTCGGCCTTGCCGCTGGAGAGAATCAGCGTGT Direct Gain 0 0.652959764003754 Functional Gain 0.652959764003754 TUBB1 ENSG00000101162 CDS Human protein_coding chr20:57597970 chr20:57597970 nonsynonymous SNV 0.895 4 21 hm5C_associated_SNPs_54695 0 30595370 Red blood cell count 2e-18 GWAS_Catalog TagSNP rs463312 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
240 chr20 62731992 62731992 1 + T C rs6089789 62731992 + 62731972 62732012 41 CTCACTGGCTGGGTATTCTTTGTAACCAGTGTTTCTGGCTC CTCACTGGCTGGGTATTCTTCGTAACCAGTGTTTCTGGCTC Direct Gain 0 0.749908089637756 Functional Gain 0.749908089637756 OPRL1 ENSG00000125510 UTR3 Human protein_coding chr20:62731992 chr20:62731992 . . 0 21 hm5C_associated_SNPs_54785 0 17554300 Multiple complex diseases 0.000912889 Johnson and O'Donnell TagSNP rs6089789 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
241 chr20 62839710 62839710 1 + G C rs61746505 62839710 + 62839690 62839730 41 CTGGAGCAGGCCATCGCCCTGAAGGCTGAACAGGTGCGCAC CTGGAGCAGGCCATCGCCCTCAAGGCTGAACAGGTGCGCAC Direct Gain 0 0.889137387275696 Functional Gain 0.889137387275696 MYT1 ENSG00000196132 CDS Human protein_coding chr20:62839710 chr20:62839710 synonymous SNV . 0 21 hm5C_associated_SNPs_54787 0 30038396 Educational attainment (MTAG) 6e-09 GWAS_Catalog TagSNP rs61746505 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
242 chrX 152226542 152226542 1 + T C rs6526155 152226542 + 152226522 152226562 41 CTCTGGCAACAGTTTTGATGTGAGGCCTTCCCAGGGCTACC CTCTGGCAACAGTTTTGATGCGAGGCCTTCCCAGGGCTACC Direct Gain 0 0.76857852935791 Functional Gain 0.76857852935791 PNMA3 ENSG00000183837 CDS Human protein_coding chrX:152226542 chrX:152226542 nonsynonymous SNV . 0 21 hm5C_associated_SNPs_55967 0 17463246 Multiple continuous traits in DGI samples 0.0005573 Johnson and O'Donnell TagSNP rs6526155 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
243 chr1 9674172 9674172 1 + C G rs11121452 9674172 - 9674152 9674192 41 CAGGCCCAGGGTGGGACAGCGGAGGGGCTCTGATAGCCACG CAGGCCCAGGGTGGGACAGCCGAGGGGCTCTGATAGCCACG Direct Gain 0 0.78810977935791 Functional Gain 0.78810977935791 TMEM201 ENSG00000188807 UTR3 Human protein_coding chr1:9674172 chr1:9674172 . . 0 21 hm5C_associated_SNPs_90816 0 25839716 Polychlorinated biphenyl levels 7e-08 GWAS_Catalog TagSNP rs11121452 GCST002839 Genome-wide association study of plasma levels of polychlorinated biphenyls disclose an association with the CYP2B6 gene in a population-based sample.
244 chr1 16259813 16259813 1 + A G rs848210 16259813 - 16259793 16259833 41 ACTCTCACCTTGAGCTTGGTTGGATTCAGGGACATGGCTCT ACTCTCACCTTGAGCTTGGTCGGATTCAGGGACATGGCTCT Direct Gain 0 0.755075573921204 Functional Gain 0.755075573921204 SPEN ENSG00000065526 CDS Human protein_coding chr1:16259813 chr1:16259813 nonsynonymous SNV 0.006 0 21 hm5C_associated_SNPs_90951 0 17463246 Multiple continuous traits in DGI samples 4.41e-05 Johnson and O'Donnell TagSNP rs848210 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
245 chr1 28793149 28793149 1 + C G rs61748637 28793149 - 28793129 28793169 41 GGAGCAGCAGGCAGAGTCCTGGGTGCTGGGGAAGGGGTGAC GGAGCAGCAGGCAGAGTCCTCGGTGCTGGGGAAGGGGTGAC Direct Gain 0 0.875140905380249 Functional Gain 0.875140905380249 PHACTR4 ENSG00000204138 CDS Human protein_coding chr1:28793149 chr1:28793149 synonymous SNV . 0 21 hm5C_associated_SNPs_91163 0 30578418 Pulse pressure 2e-11 GWAS_Catalog TagSNP rs61748637 GCST007269 Trans-ethnic association study of blood pressure determinants in over 750,000 individuals.
246 chr1 32092525 32092525 1 + A G rs2271933 32092525 - 32092505 32092545 41 ATGCTCAGAGATTTTGGAGATGGAGCATCGGCTCTGCAAGG ATGCTCAGAGATTTTGGAGACGGAGCATCGGCTCTGCAAGG Direct Gain 0 0.77361387014389 Functional Gain 0.77361387014389 HCRTR1 ENSG00000121764 CDS Human protein_coding chr1:32092525 chr1:32092525 nonsynonymous SNV 0.984 0 21 hm5C_associated_SNPs_91197 0 17463246 Multiple continuous traits in DGI samples 0.0008291 Johnson and O'Donnell TagSNP rs2271933 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
247 chr1 34663411 34663411 1 + C G rs1414474 34663411 - 34663391 34663431 41 GCAGGGAGCTCAGGGAGCTTGTCAGGACGTGCAGGAGGAGG GCAGGGAGCTCAGGGAGCTTCTCAGGACGTGCAGGAGGAGG Direct Gain 0 0.582533895969391 Functional Gain 0.582533895969391 C1orf94 ENSG00000142698 CDS Human protein_coding chr1:34663411 chr1:34663411 nonsynonymous SNV 0.419 0 21 hm5C_associated_SNPs_91247 0 30487263 Proliferative diabetic retinopathy (vs NPDR and no DR) 1e-07 GWAS_Catalog TagSNP rs1414474 GCST007289 Multiethnic Genome-wide Association Study of Diabetic Retinopathy using Liability Threshold Modeling of Duration of Diabetes and Glycemic Control.
248 chr1 100335977 100335977 1 + A G rs17121403 100335977 - 100335957 100335997 41 AGGCACATTCTGGATGTTCCTGGATCCATTTACTATTAGCA AGGCACATTCTGGATGTTCCCGGATCCATTTACTATTAGCA Direct Gain 0 0.5578533411026 Functional Gain 0.5578533411026 AGL ENSG00000162688 CDS Human protein_coding chr1:100335977 chr1:100335977 nonsynonymous SNV 0.997 1 21 hm5C_associated_SNPs_91686 2 22424883 Pulmonary function decline 7e-06 GWAS_Catalog TagSNP rs17121403 GCST001444 Genome-wide association study of lung function decline in adults with and without asthma.
249 chr1 109817192 109817192 1 + A G rs7528419 109817192 - 109817172 109817212 41 AGGCCTGCCCGGGTGCAGCCTGAAGGGTGTGAAGCCCTGGC AGGCCTGCCCGGGTGCAGCCCGAAGGGTGTGAAGCCCTGGC Direct Gain 0 0.743420898914337 Functional Gain 0.743420898914337 CELSR2 ENSG00000143126 UTR3 Human protein_coding chr1:109817192 chr1:109817192 . . 0 21 hm5C_associated_SNPs_91741 0 22003152 Lipoprotein-associated phospholipase A2 activity and mass 1e-17 GWAS_Catalog TagSNP rs7528419 GCST001273 Eight genetic loci associated with variation in lipoprotein-associated phospholipase A2 mass and activity and coronary heart disease: meta-analysis of genome-wide association studies from five community-based studies.
250 chr1 114228200 114228200 1 + A G rs13524 114228200 - 114228180 114228220 41 GCCTCCTAATTTTGCTCTATTTGAATAGTTACAATAGGTGG GCCTCCTAATTTTGCTCTATCTGAATAGTTACAATAGGTGG Direct Gain 0 0.763493537902832 Functional Gain 0.763493537902832 MAGI3 ENSG00000081026 UTR3 Human protein_coding chr1:114228200 chr1:114228200 . . 0 21 hm5C_associated_SNPs_91833 0 17159887 Rheumatoid Arthritis 0.01 Johnson and O'Donnell TagSNP rs13524 . Genomic DNA pooling for whole-genome association scans in complex disease: empirical demonstration of efficacy in rheumatoid arthritis.
251 chr1 114519351 114519351 1 + T G rs10732635 114519351 - 114519331 114519371 41 CCTCCCTTCCTGTCAGGGCCAACAGGGCTAACCCCAGGGAC CCTCCCTTCCTGTCAGGGCCCACAGGGCTAACCCCAGGGAC Direct Gain 0 0.514910399913788 Functional Gain 0.514910399913788 HIPK1 ENSG00000163349 UTR3 Human protein_coding chr1:114519351 chr1:114519351 . . 0 21 hm5C_associated_SNPs_91838 0 30598549 Heel bone mineral density 2e-09 GWAS_Catalog TagSNP rs10732635 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
252 chr1 154990297 154990297 1 + C G rs2242194 154990297 - 154990277 154990317 41 AGGGGATCACTTTCCCACAGGTCCGCAGCCCCTTCCCCTGC AGGGGATCACTTTCCCACAGCTCCGCAGCCCCTTCCCCTGC Direct Gain 0 0.802675783634186 Functional Gain 0.802675783634186 ZBTB7B ENSG00000160685 UTR3 Human protein_coding chr1:154990297 chr1:154990297 . . 0 21 hm5C_associated_SNPs_92056 0 26198764 Schizophrenia 2e-06 GWAS_Catalog TagSNP rs2242194 GCST003048 Genome-wide association study of schizophrenia in Ashkenazi Jews.
253 chr1 156883546 156883546 1 + A G rs12137505 156883546 - 156883526 156883566 41 CCCTGTGCCCATACCTTTATTGTAGAATGGGCCTGGGCCAT CCCTGTGCCCATACCTTTATCGTAGAATGGGCCTGGGCCAT Direct Gain 0 0.747195482254028 Functional Gain 0.747195482254028 PEAR1 ENSG00000187800 CDS Human protein_coding chr1:156883546 chr1:156883546 nonsynonymous SNV 0.002 1 21 hm5C_associated_SNPs_92103 0 29875488 Blood protein levels 8e-19 GWAS_Catalog TagSNP rs12137505 GCST005806 Genomic atlas of the human plasma proteome.
254 chr1 158324425 158324425 1 + A G rs1065457 158324425 - 158324405 158324445 41 CAGCAGAAGCTTGCACTATCTGGATAAAACTATGGAAGTAT CAGCAGAAGCTTGCACTATCCGGATAAAACTATGGAAGTAT Direct Gain 0 0.730099081993103 Functional Gain 0.730099081993103 CD1E ENSG00000158488 CDS Human protein_coding chr1:158324425 chr1:158324425 nonsynonymous SNV 0.000 0 21 hm5C_associated_SNPs_92115 0 17052657 Parkinson's disease 0.000193915 Johnson and O'Donnell TagSNP rs1065457 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
255 chr1 159173887 159173887 1 + A G rs3027009 159173887 - 159173867 159173907 41 CATGGTCTGACAAGTTAAAGTAGGCTCTAGGGGACAATGGG CATGGTCTGACAAGTTAAAGCAGGCTCTAGGGGACAATGGG Direct Gain 0 0.799812197685242 Functional Gain 0.799812197685242 ACKR1 ENSG00000225670 ncRNA_intronic Human antisense chr1:159173887 chr1:159173887 . . 0 21 hm5C_associated_SNPs_92125 0 22744181 Lean body mass and age at menarche (combined) 7e-07 GWAS_Catalog TagSNP rs3027009 GCST001584 Bivariate genome-wide association study suggests that the DARC gene influences lean body mass and age at menarche.
256 chr1 171557600 171557600 1 + A G rs2421847 171557600 - 171557580 171557620 41 TGGTTGTGTCATTCTCACAGTGGCAGGGGCTGACTGGAACT TGGTTGTGTCATTCTCACAGCGGCAGGGGCTGACTGGAACT Direct Gain 0 0.634653747081757 Functional Gain 0.634653747081757 PRRC2C ENSG00000117523 CDS Human protein_coding chr1:171557600 chr1:171557600 nonsynonymous SNV 0.998 0 21 hm5C_associated_SNPs_92273 0 23535033 Alzheimer's disease (cognitive decline) 9e-07 GWAS_Catalog TagSNP rs2421847 GCST001915 Genome-wide association study of the rate of cognitive decline in Alzheimer's disease.
257 chr1 203652444 203652444 1 + A G rs1419114 203652444 - 203652424 203652464 41 ATCTGGGTCAGTGCATCCCTTGAACGCAGCTCCATGAGCTT ATCTGGGTCAGTGCATCCCTCGAACGCAGCTCCATGAGCTT Direct Gain 0 0.667488217353821 Functional Gain 0.667488217353821 ATP2B4 ENSG00000058668 CDS Human protein_coding chr1:203652444 chr1:203652444 synonymous SNV . 0 21 hm5C_associated_SNPs_92545 0 30595370 Red cell distribution width 2e-84 GWAS_Catalog TagSNP rs1419114 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
258 chr1 204948659 204948659 1 + A G rs6667532 204948659 - 204948639 204948679 41 CTGGTTCGGTAGCGCTCGGATGGGAGGCTGGGGTGGCTGCT CTGGTTCGGTAGCGCTCGGACGGGAGGCTGGGGTGGCTGCT Direct Gain 0 0.965875506401062 Functional Gain 0.965875506401062 NFASC ENSG00000163531 CDS Human protein_coding chr1:204948659 chr1:204948659 synonymous SNV . 0 21 hm5C_associated_SNPs_92576 0 29875488 Blood protein levels 4e-100 GWAS_Catalog TagSNP rs6667532 GCST005806 Genomic atlas of the human plasma proteome.
259 chr1 214830617 214830617 1 + A G rs438034 214830617 - 214830597 214830637 41 GGTAGCAGGTGTTGGTCCTCTACCATTCTCCCATATTCCAC GGTAGCAGGTGTTGGTCCTCCACCATTCTCCCATATTCCAC Direct Gain 0 0.714401483535767 Functional Gain 0.714401483535767 CENPF ENSG00000117724 CDS Human protein_coding chr1:214830617 chr1:214830617 nonsynonymous SNV 0.004 0 21 hm5C_associated_SNPs_92686 0 21659360 Response to antineoplastic agents 5e-06 GWAS_Catalog TagSNP rs438034 GCST001095 Association between single nucleotide polymorphism-genotype and outcome of patients with chronic lymphocytic leukemia in a randomized chemotherapy trial.
260 chr1 220970028 220970028 1 + A G rs2642438 220970028 - 220970008 220970048 41 GCTGGTTATCCACTGGGCGGTGGCCTCGCCACAGTCCCTGC GCTGGTTATCCACTGGGCGGCGGCCTCGCCACAGTCCCTGC Direct Gain 0 0.701677560806274 Functional Gain 0.701677560806274 MARC1 ENSG00000186205 CDS Human protein_coding chr1:220970028 chr1:220970028 nonsynonymous SNV 0.005 0 21 hm5C_associated_SNPs_92711 0 28334899 Total cholesterol levels 1e-22 GWAS_Catalog TagSNP rs2642438 GCST004235 Association analyses of East Asian individuals and trans-ancestry analyses with European individuals reveal new loci associated with cholesterol and triglyceride levels.
261 chr1 226376731 226376731 1 + A G rs16860148 226376731 - 226376711 226376751 41 CTATAAGACCCGAAGTCTTATGAGATTGTCCAAAACACAAA CTATAAGACCCGAAGTCTTACGAGATTGTCCAAAACACAAA Direct Gain 0 0.739662528038025 Functional Gain 0.739662528038025 ACBD3;MIXL1 ENSG00000223570 ncRNA_exonic Human processed_pseudogene chr1:226376731 chr1:226376731 . . 0 21 hm5C_associated_SNPs_92745 0 17554300 Multiple complex diseases 0.000108747 Johnson and O'Donnell TagSNP rs16860148 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
262 chr1 234866776 234866776 1 + A G rs570530 234866776 - 234866756 234866796 41 CCCCAGGGTCTGTGCATCTGTAGGAGAAGTGAATCTGTGGC CCCCAGGGTCTGTGCATCTGCAGGAGAAGTGAATCTGTGGC Direct Gain 0 0.868842124938965 Functional Gain 0.868842124938965 LINC01132 ENSG00000227630 ncRNA_exonic Human lincRNA chr1:234866776 chr1:234866776 . . 0 21 hm5C_associated_SNPs_92851 0 31015401 Medication use (HMG CoA reductase inhibitors) 7e-09 GWAS_Catalog TagSNP rs570530 GCST007931 Genome-wide association study of medication-use and associated disease in the UK Biobank.
263 chr1 248039713 248039713 1 + A G rs3811445 248039713 - 248039693 248039733 41 TTTCCTGACCCTGCTATTGTTGTGGGTGGCAAGATAAGAGG TTTCCTGACCCTGCTATTGTCGTGGGTGGCAAGATAAGAGG Direct Gain 0 0.809730291366577 Functional Gain 0.809730291366577 TRIM58 ENSG00000162722 CDS Human protein_coding chr1:248039713 chr1:248039713 synonymous SNV . 0 21 hm5C_associated_SNPs_92925 0 27863252 Immature fraction of reticulocytes 6e-65 GWAS_Catalog TagSNP rs3811445 GCST004628 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
264 chr2 25259953 25259953 1 + A G rs2196792 25259953 - 25259933 25259973 41 CCCATTTTACATCTGGGAAATTGAGGCCCAGAGAGGTTCGA CCCATTTTACATCTGGGAAACTGAGGCCCAGAGAGGTTCGA Direct Gain 0 0.547040581703186 Functional Gain 0.547040581703186 DNAJC27-AS1 ENSG00000224165 ncRNA_exonic Human antisense chr2:25259953 chr2:25259953 . . 0 21 hm5C_associated_SNPs_93065 0 28552196 Height 1e-08 GWAS_Catalog TagSNP rs2196792 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
265 chr2 26667130 26667130 1 + A G rs3795958 26667130 - 26667110 26667150 41 CTGAAACTGCTTTATTTGCTTGGCATATTTTGATCTCAGAT CTGAAACTGCTTTATTTGCTCGGCATATTTTGATCTCAGAT Direct Gain 0 0.640235006809235 Functional Gain 0.640235006809235 DRC1 ENSG00000157856 CDS Human protein_coding chr2:26667130 chr2:26667130 nonsynonymous SNV 0.998 1 21 hm5C_associated_SNPs_93088 1 23319000 Metabolite levels (HVA) 2e-06 GWAS_Catalog TagSNP rs3795958 GCST001824 Genome-wide association study of monoamine metabolite levels in human cerebrospinal fluid.
266 chr2 28636740 28636740 1 + A G rs2279990 28636740 - 28636720 28636760 41 GCAAAACATCCTATCTCCAATTCCAGCAGCCAGAAAGATTC GCAAAACATCCTATCTCCAACTCCAGCAGCCAGAAAGATTC Direct Gain 0 0.834238827228546 Functional Gain 0.834238827228546 FOSL2 ENSG00000075426 UTR3 Human protein_coding chr2:28636740 chr2:28636740 . . 0 21 hm5C_associated_SNPs_93134 0 26192919 Inflammatory bowel disease 3e-15 GWAS_Catalog TagSNP rs2279990 GCST003043 Association analyses identify 38 susceptibility loci for inflammatory bowel disease and highlight shared genetic risk across populations.
267 chr2 37000956 37000956 1 + C G rs140104536 37000956 - 37000936 37000976 41 GGCCTGTTTTGGCTGCTTGTGTAGGTGGCAGTGGACCAGAG GGCCTGTTTTGGCTGCTTGTCTAGGTGGCAGTGGACCAGAG Direct Gain 0 0.881555736064911 Functional Gain 0.881555736064911 VIT ENSG00000205221 CDS Human protein_coding chr2:37000956 chr2:37000956 stopgain 0.029 0 21 hm5C_associated_SNPs_93194 0 29875488 Blood protein levels 1e-31 GWAS_Catalog TagSNP rs140104536 GCST005806 Genomic atlas of the human plasma proteome.
268 chr2 73679280 73679280 1 + A G rs6546838 73679280 - 73679260 73679300 41 AGCAGGCCCAGGAACCCCTATTGCTTTCAAAGTTACTTCAG AGCAGGCCCAGGAACCCCTACTGCTTTCAAAGTTACTTCAG Direct Gain 0 0.516462206840515 Functional Gain 0.516462206840515 ALMS1 ENSG00000116127 CDS Human protein_coding chr2:73679280 chr2:73679280 nonsynonymous SNV 0.000 0 21 hm5C_associated_SNPs_93457 1 26831199 Glomerular filtration rate (creatinine) 8e-20 GWAS_Catalog TagSNP rs6546838 GCST003372 Genetic associations at 53 loci highlight cell types and biological pathways relevant for kidney function.
269 chr2 171822466 171822466 1 + C G rs4668356 171822466 - 171822446 171822486 41 GCAGTAGTTGTGGCAGGGTCGGAGGGTGCGTTGCTGGTGGG GCAGTAGTTGTGGCAGGGTCCGAGGGTGCGTTGCTGGTGGG Direct Gain 0 0.878757178783417 Functional Gain 0.878757178783417 GORASP2 ENSG00000115806 CDS Human protein_coding chr2:171822466 chr2:171822466 synonymous SNV . 0 21 hm5C_associated_SNPs_93954 0 19734545 Cognitive performance 1e-06 GWAS_Catalog TagSNP rs4668356 GCST000477 A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB.
270 chr2 174233041 174233041 1 + A G rs1047885 174233041 - 174233021 174233061 41 ACCAACCTTTGAATTATGATTGTGTAAGCTGGACGCACCAC ACCAACCTTTGAATTATGATCGTGTAAGCTGGACGCACCAC Direct Gain 0 0.555515706539154 Functional Gain 0.555515706539154 CDCA7 ENSG00000144354 UTR3 Human protein_coding chr2:174233041 chr2:174233041 . . 0 21 hm5C_associated_SNPs_93976 0 17554300 Multiple complex diseases 0.000306094 Johnson and O'Donnell TagSNP rs1047885 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
271 chr2 206305262 206305262 1 + A G rs61741390 206305262 - 206305242 206305282 41 GCTCGAGGGGGAGATGGAGATCTAAAGACATTTGCTGATGT GCTCGAGGGGGAGATGGAGACCTAAAGACATTTGCTGATGT Direct Gain 0 0.525291979312897 Functional Gain 0.525291979312897 PARD3B ENSG00000116117 CDS Human protein_coding chr2:206305262 chr2:206305262 synonymous SNV . 0 21 hm5C_associated_SNPs_94138 0 25918132 Diisocyanate-induced asthma 1e-06 GWAS_Catalog TagSNP rs61741390 GCST002875 Genome-Wide Association Study Identifies Novel Loci Associated With Diisocyanate-Induced Occupational Asthma.
272 chr3 12624321 12624321 1 + A G rs5746255 12624321 - 12624301 12624341 41 TTGGGACACTTGAGAGAACTTGAAAAAAATGACCACCCTTA TTGGGACACTTGAGAGAACTCGAAAAAAATGACCACCCTTA Direct Gain 0 0.707575678825378 Functional Gain 0.707575678825378 MKRN2 ENSG00000075975 UTR3 Human protein_coding chr3:12624321 chr3:12624321 . . 0 21 hm5C_associated_SNPs_94579 0 17554300 Multiple complex diseases 5.85e-05 Johnson and O'Donnell TagSNP rs5746255 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
273 chr3 38158347 38158347 1 + C G rs75614900 38158347 - 38158327 38158367 41 CTGATACAGTACAGGTGGCCGGAGGGCACCCCCTCATGTGC CTGATACAGTACAGGTGGCCCGAGGGCACCCCCTCATGTGC Direct Gain 0 0.800550401210785 Functional Gain 0.800550401210785 DLEC1 ENSG00000008226 CDS Human protein_coding chr3:38158347 chr3:38158347 synonymous SNV . 0 21 hm5C_associated_SNPs_94697 0 29206233 Common carotid intima-media thickness in HIV negative individuals 6e-06 GWAS_Catalog TagSNP rs75614900 GCST005182 Genome-wide admixture and association study of subclinical atherosclerosis in the Women's Interagency HIV Study (WIHS).
274 chr3 49213637 49213637 1 + C G rs9586 49213637 - 49213617 49213657 41 CTCTCAACTCTCCTGGGTCTGCAGGGACCCTAAAGGCAGCC CTCTCAACTCTCCTGGGTCTCCAGGGACCCTAAAGGCAGCC Direct Gain 0 0.823474526405334 Functional Gain 0.823474526405334 KLHDC8B ENSG00000185909 UTR3 Human protein_coding chr3:49213637 chr3:49213637 . . 0 21 hm5C_associated_SNPs_94863 0 29500382 Feeling miserable 2e-08 GWAS_Catalog TagSNP rs9586 GCST006943 Item-level analyses reveal genetic heterogeneity in neuroticism.
275 chr3 49572140 49572140 1 + A G rs4625 49572140 - 49572120 49572160 41 GAGTGGGCGCCCCTGAGTCATGGGACAGAGATGCAGATGGA GAGTGGGCGCCCCTGAGTCACGGGACAGAGATGCAGATGGA Direct Gain 0 0.814841389656067 Functional Gain 0.814841389656067 DAG1 ENSG00000173402 UTR3 Human protein_coding chr3:49572140 chr3:49572140 . . 0 21 hm5C_associated_SNPs_94869 1 29500382 Feeling fed-up 1e-10 GWAS_Catalog TagSNP rs4625 GCST006947 Item-level analyses reveal genetic heterogeneity in neuroticism.
276 chr3 52821011 52821011 1 + A G rs1042779 52821011 - 52820991 52821031 41 ACCCATAGTCCAGCGACATCTGCAGGGCCTGGGATGACAGG ACCCATAGTCCAGCGACATCCGCAGGGCCTGGGATGACAGG Direct Gain 0 0.772160708904266 Functional Gain 0.772160708904266 ITIH1 ENSG00000055957 CDS Human protein_coding chr3:52821011 chr3:52821011 nonsynonymous SNV 0.162 0 21 hm5C_associated_SNPs_94933 0 19416921 Bipolar disorder 2e-07 GWAS_Catalog TagSNP rs1042779 GCST000387 Genome-wide association and meta-analysis of bipolar disorder in individuals of European ancestry.
277 chr3 59004271 59004271 1 + A G rs1491631 59004271 - 59004251 59004291 41 TTCATGTTATGCATCTTTGGTGAAATGTACTATAAAGTGAT TTCATGTTATGCATCTTTGGCGAAATGTACTATAAAGTGAT Direct Gain 0 0.601180970668793 Functional Gain 0.601180970668793 C3orf67-AS1 ENSG00000242428 ncRNA_exonic Human antisense chr3:59004271 chr3:59004271 . . 0 21 hm5C_associated_SNPs_94971 0 30019117 Adolescent idiopathic scoliosis 7e-06 GWAS_Catalog TagSNP rs1491631 GCST006287 The coexistence of copy number variations (CNVs) and single nucleotide polymorphisms (SNPs) at a locus can result in distorted calculations of the significance in associating SNPs to disease.
278 chr3 63967900 63967900 1 + A G rs1053338 63967900 - 63967880 63967920 41 TCAGTAGTGTGCCATCCATTTTCGGATGAATCTTTTCCACT TCAGTAGTGTGCCATCCATTCTCGGATGAATCTTTTCCACT Direct Gain 0 0.670793652534485 Functional Gain 0.670793652534485 ATXN7 ENSG00000163635 CDS Human protein_coding chr3:63967900 chr3:63967900 nonsynonymous SNV 0.989 3 21 hm5C_associated_SNPs_94982 1 25751625 Breast cancer 9e-09 GWAS_Catalog TagSNP rs1053338 GCST004950 Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer.
279 chr3 113673125 113673125 1 + A G rs11921691 113673125 - 113673105 113673145 41 TGGGGCTTCCAGCTGGCATCTTGGAAGAGCCCTTGGGGTCA TGGGGCTTCCAGCTGGCATCCTGGAAGAGCCCTTGGGGTCA Direct Gain 0 0.871124804019928 Functional Gain 0.871124804019928 ZDHHC23 ENSG00000184307 CDS Human protein_coding chr3:113673125 chr3:113673125 nonsynonymous SNV 0.003 0 21 hm5C_associated_SNPs_95152 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0002378 Johnson and O'Donnell TagSNP rs11921691 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
280 chr3 186386776 186386776 1 + C G rs4516605 186386776 - 186386756 186386796 41 AGTATTTCCTGGATAGGACCGAACAGTCCGATTCTTGCACA AGTATTTCCTGGATAGGACCCAACAGTCCGATTCTTGCACA Direct Gain 0 0.551153540611267 Functional Gain 0.551153540611267 HRG ENSG00000113905 CDS Human protein_coding chr3:186386776 chr3:186386776 nonsynonymous SNV 0.195 1 21 hm5C_associated_SNPs_95607 0 29875488 Blood protein levels 9e-12 GWAS_Catalog TagSNP rs4516605 GCST005806 Genomic atlas of the human plasma proteome.
281 chr3 186573705 186573705 1 + A G rs6773957 186573705 - 186573685 186573725 41 GAGTTAATTCTGGGTAGATATGGGATTCAAGAGATTGGTCT GAGTTAATTCTGGGTAGATACGGGATTCAAGAGATTGGTCT Direct Gain 0 0.897179007530212 Functional Gain 0.897179007530212 ADIPOQ-AS1 ENSG00000226482 ncRNA_exonic Human antisense chr3:186573705 chr3:186573705 . . 0 21 hm5C_associated_SNPs_95611 0 19165155 Adiponectin levels 5e-08 GWAS_Catalog TagSNP rs6773957 GCST000319 Genome-wide linkage and association analyses to identify genes influencing adiponectin levels: the GEMS Study.
282 chr4 1244267 1244267 1 + A G rs2291199 1244267 - 1244247 1244287 41 GAGGTTGCTGCTCATTTTTCTGGAATTTTTTCTTAGATCTC GAGGTTGCTGCTCATTTTTCCGGAATTTTTTCTTAGATCTC Direct Gain 0 0.678558468818665 Functional Gain 0.678558468818665 CTBP1-AS2 ENSG00000196810 ncRNA_exonic Human antisense chr4:1244267 chr4:1244267 . . 0 21 hm5C_associated_SNPs_95760 0 17554300 Multiple complex diseases 0.000709583 Johnson and O'Donnell TagSNP rs2291199 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
283 chr4 4388874 4388874 1 + C G rs10015223 4388874 - 4388854 4388894 41 CCGGCTCCGGCAGGTCAGCTGAGCGCTCCGAGCTCCGCGTC CCGGCTCCGGCAGGTCAGCTCAGCGCTCCGAGCTCCGCGTC Direct Gain 0 0.862623870372772 Functional Gain 0.862623870372772 NSG1 ENSG00000168824 UTR5 Human protein_coding chr4:4388874 chr4:4388874 . . 0 21 hm5C_associated_SNPs_95877 0 30595370 Hair color 3e-15 GWAS_Catalog TagSNP rs10015223 GCST007082 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
284 chr4 7743135 7743135 1 + A G rs17382228 7743135 - 7743115 7743155 41 TACACTAACATCCCTGATTCTAGGAAACCGTAAGGGTGTGG TACACTAACATCCCTGATTCCAGGAAACCGTAAGGGTGTGG Direct Gain 0 0.50077497959137 Functional Gain 0.50077497959137 SORCS2 ENSG00000184985 UTR3 Human protein_coding chr4:7743135 chr4:7743135 . . 0 21 hm5C_associated_SNPs_95945 0 29160301 Response to antidepressants (symptom improvement) 2e-06 GWAS_Catalog TagSNP rs17382228 GCST007059 New insights into the pharmacogenomics of antidepressant response from the GENDEP and STAR*D studies: rare variant analysis and high-density imputation.
285 chr4 40158488 40158488 1 + C G rs139756456 40158488 - 40158468 40158508 41 GGGTTTGGGGGGATATTTTAGAACATGTGCATTATATTTAC GGGTTTGGGGGGATATTTTACAACATGTGCATTATATTTAC Direct Gain 0 0.595768570899963 Functional Gain 0.595768570899963 N4BP2 ENSG00000078177 UTR3 Human protein_coding chr4:40158488 chr4:40158488 . . 0 21 hm5C_associated_SNPs_96061 0 28928442 Plantar warts 9e-06 GWAS_Catalog TagSNP rs139756456 GCST005005 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
286 chr4 71201648 71201648 1 + T G rs2291182 71201648 - 71201628 71201668 41 TGCAGTATCTCTCTCCATCCAAATACTGGCTCCCTCGGTAG TGCAGTATCTCTCTCCATCCCAATACTGGCTCCCTCGGTAG Direct Gain 0 0.59245091676712 Functional Gain 0.59245091676712 CABS1 ENSG00000145309 CDS Human protein_coding chr4:71201648 chr4:71201648 nonsynonymous SNV 0.055 3 21 hm5C_associated_SNPs_96161 0 17486107 Bipolar disorder 0.011 Johnson and O'Donnell TagSNP rs2291182 . A genome-wide association study implicates diacylglycerol kinase eta (DGKH) and several other genes in the etiology of bipolar disorder.
287 chr4 165878335 165878335 1 + A G rs3733418 165878335 - 165878315 165878355 41 TGAGCAAAGAGACACTGCCATGGCGGCCGCCGGTCAGCGTA TGAGCAAAGAGACACTGCCACGGCGGCCGCCGGTCAGCGTA Direct Gain 0 0.557026028633118 Functional Gain 0.557026028633118 FAM218A ENSG00000250486 CDS Human protein_coding chr4:165878335 chr4:165878335 nonsynonymous SNV 0.001 0 21 hm5C_associated_SNPs_96580 0 23251661 Obesity-related traits 9e-06 GWAS_Catalog TagSNP rs3733418 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
288 chr5 43124688 43124688 1 + A G rs782971 43124688 - 43124668 43124708 41 CAGTTAGATTCTCACTTTATTAAGTTTTGTGGATTTTCATA CAGTTAGATTCTCACTTTATCAAGTTTTGTGGATTTTCATA Direct Gain 0 0.781588912010193 Functional Gain 0.781588912010193 ZNF131 ENSG00000172262 intronic Human protein_coding chr5:43124688 chr5:43124688 . . 0 21 hm5C_associated_SNPs_96906 0 25673413 Body mass index 9e-06 GWAS_Catalog TagSNP rs782971 GCST002783 Genetic studies of body mass index yield new insights for obesity biology.
289 chr5 56178111 56178111 1 + A G rs3822625 56178111 - 56178091 56178131 41 TCAGGACAGTTTCTGTGGAATTGTAGAGAAAACTTGCGCTG TCAGGACAGTTTCTGTGGAACTGTAGAGAAAACTTGCGCTG Direct Gain 0 0.652648866176605 Functional Gain 0.652648866176605 MAP3K1 ENSG00000095015 CDS Human protein_coding chr5:56178111 chr5:56178111 synonymous SNV . 0 21 hm5C_associated_SNPs_96933 0 24493630 Breast cancer (early onset) 5e-12 GWAS_Catalog TagSNP rs3822625 GCST002346 A genome-wide association study of early-onset breast cancer identifies PFKM as a novel breast cancer gene and supports a common genetic spectrum for breast cancer at any age.
290 chr5 89943433 89943433 1 + A G rs950692 89943433 - 89943413 89943453 41 GGAATGAAATCTCTCTCTCTTGCAGTAGCCTTCCCATCCTT GGAATGAAATCTCTCTCTCTCGCAGTAGCCTTCCCATCCTT Direct Gain 0 0.676277339458466 Functional Gain 0.676277339458466 ADGRV1 ENSG00000164199 CDS Human protein_coding chr5:89943433 chr5:89943433 synonymous SNV . 0 21 hm5C_associated_SNPs_97100 1 17463246 Multiple continuous traits in DGI samples 6.72e-06 Johnson and O'Donnell TagSNP rs950692 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
291 chr5 102338739 102338739 1 + C G rs78408340 102338739 - 102338719 102338759 41 AAACAAACTTGCTGTCAAACGAGCTAAACAAAAAGCATTAA AAACAAACTTGCTGTCAAACCAGCTAAACAAAAAGCATTAA Direct Gain 0 0.804821014404297 Functional Gain 0.804821014404297 PAM ENSG00000145730 CDS Human protein_coding chr5:102338739 chr5:102338739 nonsynonymous SNV 0.995 4 21 hm5C_associated_SNPs_97143 0 29875488 Blood protein levels 6e-22 GWAS_Catalog TagSNP rs78408340 GCST005806 Genomic atlas of the human plasma proteome.
292 chr5 131705458 131705458 1 + C G rs2631367 131705458 - 131705438 131705478 41 GCGCACGACCAGGGAAGGTTGCGGGCCTGGGCCGCAAGGCG GCGCACGACCAGGGAAGGTTCCGGGCCTGGGCCGCAAGGCG Direct Gain 0 0.711721122264862 Functional Gain 0.711721122264862 MIR3936HG ENSG00000233006 ncRNA_intronic Human processed_transcript chr5:131705458 chr5:131705458 . . 0 21 hm5C_associated_SNPs_97259 2 30595370 White blood cell count 2e-56 GWAS_Catalog TagSNP rs2631367 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
293 chr5 131996445 131996445 1 + A G rs1295685 131996445 - 131996425 131996465 41 GAACCCTTGGCTCCAAGTGCTAGCAGCCACAGTCTTCCCCA GAACCCTTGGCTCCAAGTGCCAGCAGCCACAGTCTTCCCCA Direct Gain 0 0.88097620010376 Functional Gain 0.88097620010376 IL13 ENSG00000223442 ncRNA_intronic Human antisense chr5:131996445 chr5:131996445 . . 0 21 hm5C_associated_SNPs_97268 0 26626624 Psoriasis vulgaris 3e-14 GWAS_Catalog TagSNP rs1295685 GCST003268 Genome-wide Association Analysis of Psoriatic Arthritis and Cutaneous Psoriasis Reveals Differences in Their Genetic Architecture.
294 chr5 135515708 135515708 1 + A G rs6865297 135515708 - 135515688 135515728 41 AGCTTTAGTACTGTCATTCATGAGACACAACTCCTAAGAGA AGCTTTAGTACTGTCATTCACGAGACACAACTCCTAAGAGA Direct Gain 0 0.884119391441345 Functional Gain 0.884119391441345 SMAD5 ENSG00000113658 UTR3 Human protein_coding chr5:135515708 chr5:135515708 . . 0 21 hm5C_associated_SNPs_97313 0 17052657 Parkinson's disease 0.000184171 Johnson and O'Donnell TagSNP rs6865297 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
295 chr5 138618797 138618797 1 + T G rs877826 138618797 - 138618777 138618817 41 GGGCTGAAAGTCAGCCATGTAAGGACTACAGCATCCACTCT GGGCTGAAAGTCAGCCATGTCAGGACTACAGCATCCACTCT Direct Gain 0 0.9120112657547 Functional Gain 0.9120112657547 SNHG4 ENSG00000015479 intronic Human protein_coding chr5:138618797 chr5:138618797 . . 0 21 hm5C_associated_SNPs_97328 0 17052657 Parkinson's disease 0.000899049 Johnson and O'Donnell TagSNP rs877826 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
296 chr5 150036119 150036119 1 + A G rs41364946 150036119 - 150036099 150036139 41 CTCGCTCCACGAGGGAGACATGGGCGGTGGCGGCGGCAGCG CTCGCTCCACGAGGGAGACACGGGCGGTGGCGGCGGCAGCG Direct Gain 0 0.874650359153748 Functional Gain 0.874650359153748 SYNPO ENSG00000171992 CDS Human protein_coding chr5:150036119 chr5:150036119 nonsynonymous SNV 0.892 1 21 hm5C_associated_SNPs_97578 0 30595370 Red blood cell count 2e-09 GWAS_Catalog TagSNP rs41364946 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
297 chr5 158759900 158759900 1 + A G rs2546890 158759900 - 158759880 158759920 41 ATAGACAAGTGATTTCACTGTGGGAAGACAATTCAGAGCCC ATAGACAAGTGATTTCACTGCGGGAAGACAATTCAGAGCCC Direct Gain 0 0.926887392997742 Functional Gain 0.926887392997742 LOC285626 ENSG00000249738 ncRNA_exonic Human antisense chr5:158759900 chr5:158759900 . . 0 21 hm5C_associated_SNPs_97646 0 22190364 Multiple sclerosis 8e-08 GWAS_Catalog TagSNP rs2546890 GCST001341 Genome-wide meta-analysis identifies novel multiple sclerosis susceptibility loci.
298 chr5 173315866 173315866 1 + C G rs359466 173315866 - 173315846 173315886 41 AGGGATTAGCGAGACTCGACGAGGGTGAGCGGGCGGCCTGG AGGGATTAGCGAGACTCGACCAGGGTGAGCGGGCGGCCTGG Direct Gain 0 0.962276697158813 Functional Gain 0.962276697158813 CPEB4 ENSG00000113742 UTR5 Human protein_coding chr5:173315866 chr5:173315866 . . 0 21 hm5C_associated_SNPs_97709 0 27659466 QRS complex (Sokolow-Lyon) 3e-08 GWAS_Catalog TagSNP rs359466 GCST003870 52 Genetic Loci Influencing Myocardial Mass.
299 chr6 409119 409119 1 + A G rs9391997 409119 - 409099 409139 41 AATGAATTTAAAATATCCATTAGAAAAGCAGGAACACACAT AATGAATTTAAAATATCCATCAGAAAAGCAGGAACACACAT Direct Gain 0 0.694138407707214 Functional Gain 0.694138407707214 IRF4 ENSG00000137265 UTR3 Human protein_coding chr6:409119 chr6:409119 . . 0 21 hm5C_associated_SNPs_97835 0 26956414 Chronic lymphocytic leukemia 9e-22 GWAS_Catalog TagSNP rs9391997 GCST003468 Meta-analysis of genome-wide association studies discovers multiple loci for chronic lymphocytic leukemia.
300 chr6 26199903 26199903 1 + C G rs34961555 26199903 - 26199883 26199923 41 AGCACCTTGTACACGTACACGGAATAGCTCTCCTTGCGGCT AGCACCTTGTACACGTACACCGAATAGCTCTCCTTGCGGCT Direct Gain 0 0.616906762123108 Functional Gain 0.616906762123108 HIST1H2BF ENSG00000197846 CDS Human other chr6:26199903 chr6:26199903 synonymous SNV . 0 21 hm5C_associated_SNPs_98019 0 29326435 Intelligence (MTAG) 4e-10 GWAS_Catalog TagSNP rs34961555 GCST005316 A combined analysis of genetically correlated traits identifies 187 loci and a role for neurogenesis and myelination in intelligence.
301 chr6 26573631 26573631 1 + C G rs13214027 26573631 - 26573611 26573651 41 TTAACTCTCTTGTCTAAAATGGTGGGGGCAGGAAATTGGGA TTAACTCTCTTGTCTAAAATCGTGGGGGCAGGAAATTGGGA Direct Gain 0 0.73439884185791 Functional Gain 0.73439884185791 LOC105374988 ENSG00000182952;ENSG00000146109 intergenic Human other chr6:26573631 chr6:26573631 . . 0 21 hm5C_associated_SNPs_98034 0 29326435 Intelligence (MTAG) 4e-12 GWAS_Catalog TagSNP rs13214027 GCST005316 A combined analysis of genetically correlated traits identifies 187 loci and a role for neurogenesis and myelination in intelligence.
302 chr6 26599509 26599509 1 + A G rs45527431 26599509 - 26599489 26599529 41 GATATTAGACAAAAATTAAATAGAAAAAAAAATCCAGGTTA GATATTAGACAAAAATTAAACAGAAAAAAAAATCCAGGTTA Direct Gain 0 0.748561143875122 Functional Gain 0.748561143875122 ABT1 ENSG00000146109 UTR3 Human protein_coding chr6:26599509 chr6:26599509 . . 0 21 hm5C_associated_SNPs_98038 0 29662059 Depression (broad) 2e-09 GWAS_Catalog TagSNP rs45527431 GCST005902 Genome-wide association study of depression phenotypes in UK Biobank identifies variants in excitatory synaptic pathways.
303 chr6 29634012 29634012 1 + A G rs3130253 29634012 - 29633992 29634032 41 GTACTGCAGGCAGAGGAAGATGAGGCCAACAGTGATCTGCA GTACTGCAGGCAGAGGAAGACGAGGCCAACAGTGATCTGCA Direct Gain 0 0.89626145362854 Functional Gain 0.89626145362854 MOG ENSG00000204655 CDS Human protein_coding chr6:29634012 chr6:29634012 nonsynonymous SNV 0.014 0 21 hm5C_associated_SNPs_98107 0 17804836 Rheumatoid Arthritis 6.84e-05 Johnson and O'Donnell TagSNP rs3130253 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
304 chr6 30116078 30116078 1 + A G rs3132676 30116078 - 30116058 30116098 41 ATTCCAAGAGGTGAGGATCATGAAGGGAGGCTGTCTTTGAG ATTCCAAGAGGTGAGGATCACGAAGGGAGGCTGTCTTTGAG Direct Gain 0 0.827758312225342 Functional Gain 0.827758312225342 TRIM40 ENSG00000204614 UTR3 Human protein_coding chr6:30116078 chr6:30116078 . . 0 21 hm5C_associated_SNPs_98156 0 17554300 Multiple complex diseases 9.39e-07 Johnson and O'Donnell TagSNP rs3132676 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
305 chr6 30596135 30596135 1 + A G rs6904236 30596135 - 30596115 30596155 41 TTCTGTGAGGGTCGGTCAATTGCCAGTTGGTGCGGTTCCAC TTCTGTGAGGGTCGGTCAATCGCCAGTTGGTGCGGTTCCAC Direct Gain 0 0.833509206771851 Functional Gain 0.833509206771851 ATAT1 ENSG00000137343 CDS Human protein_coding chr6:30596135 chr6:30596135 synonymous SNV . 0 21 hm5C_associated_SNPs_98178 0 17554300 Multiple complex diseases 0.000967559 Johnson and O'Donnell TagSNP rs6904236 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
306 chr6 30882513 30882513 1 + A G rs1264303 30882513 - 30882493 30882533 41 TCCCCTTGTTCCATCTTTCCTGTCTCTAATTAGCACAGGTC TCCCCTTGTTCCATCTTTCCCGTCTCTAATTAGCACAGGTC Direct Gain 0 0.58657693862915 Functional Gain 0.58657693862915 VARS2 ENSG00000137411 UTR5 Human protein_coding chr6:30882513 chr6:30882513 . . 0 21 hm5C_associated_SNPs_98186 0 17554300 Multiple complex diseases 1.74e-09 Johnson and O'Donnell TagSNP rs1264303 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
307 chr6 31729359 31729359 1 + A G rs707938 31729359 - 31729339 31729379 41 AGGGGCCCTTGTGGCAGCAGTTGTAGCTGAACAAGGCTCAG AGGGGCCCTTGTGGCAGCAGCTGTAGCTGAACAAGGCTCAG Direct Gain 0 0.685832798480988 Functional Gain 0.685832798480988 MSH5 ENSG00000204410;ENSG00000255152 CDS Human other chr6:31729359 chr6:31729359 synonymous SNV . 0 21 hm5C_associated_SNPs_98258 1 30038396 Cognitive performance 4e-09 GWAS_Catalog TagSNP rs707938 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
308 chr6 31930351 31930351 1 + A G rs2734331 31930351 - 31930331 31930371 41 ATCTCTCACCGAAGGATCTCTGTGGTCATGATGAGGCAGGA ATCTCTCACCGAAGGATCTCCGTGGTCATGATGAGGCAGGA Direct Gain 0 0.740343391895294 Functional Gain 0.740343391895294 SKIV2L ENSG00000204351 CDS Human protein_coding chr6:31930351 chr6:31930351 synonymous SNV . 0 21 hm5C_associated_SNPs_98269 1 24816252 Blood metabolite levels 7e-13 GWAS_Catalog TagSNP rs2734331 GCST002443 An atlas of genetic influences on human blood metabolites.
309 chr6 32607019 32607019 1 + C G rs28802989 32607019 - 32606999 32607039 41 TTATTTTTCTAATTTTAAAAGGAGTTAAAACCTTCTCATGT TTATTTTTCTAATTTTAAAACGAGTTAAAACCTTCTCATGT Direct Gain 0 0.732458114624023 Functional Gain 0.732458114624023 HLA-DQA1 ENSG00000196735 UTR3 Human protein_coding chr6:32607019 chr6:32607019 . . 0 21 hm5C_associated_SNPs_98290 0 29036319 Tuberculosis 2e-06 GWAS_Catalog TagSNP rs28802989 GCST004922 Discovery of susceptibility loci associated with tuberculosis in Han Chinese.
310 chr6 33054861 33054861 1 + A G rs9277535 33054861 - 33054841 33054881 41 GAATTAGTGCTGTGGGAATATGGGTCCTATCAGGCAGATTT GAATTAGTGCTGTGGGAATACGGGTCCTATCAGGCAGATTT Direct Gain 0 0.678155541419983 Functional Gain 0.678155541419983 HLA-DPB1 ENSG00000223865 UTR3 Human protein_coding chr6:33054861 chr6:33054861 . . 0 21 hm5C_associated_SNPs_98352 0 22737229 Hepatitis B (viral clearance) 2e-21 GWAS_Catalog TagSNP rs9277535 GCST001582 Genome-wide association study confirming association of HLA-DP with protection against chronic hepatitis B and viral clearance in Japanese and Korean.
311 chr6 33055419 33055419 1 + A G rs9277549 33055419 - 33055399 33055439 41 GGGAATTGACCAGGGACAGGTGCCCAGGGACACACAAGGCC GGGAATTGACCAGGGACAGGCGCCCAGGGACACACAAGGCC Direct Gain 0 0.578998684883118 Functional Gain 0.578998684883118 HLA-DPB1 ENSG00000223865 downstream Human protein_coding chr6:33055419 chr6:33055419 . . 0 21 hm5C_associated_SNPs_98357 0 29534301 Response to hepatitis B vaccine 6e-11 GWAS_Catalog TagSNP rs9277549 GCST005606 Key HLA-DRB1-DQB1 haplotypes and role of the BTNL2 gene for response to a hepatitis B vaccine.
312 chr6 34824636 34824636 1 + A G rs11755393 34824636 - 34824616 34824656 41 AGCGGTTCCATGCTGGAGGCTGAAAGGCAGGCTGTCTGCCC AGCGGTTCCATGCTGGAGGCCGAAAGGCAGGCTGTCTGCCC Direct Gain 0 0.738659560680389 Functional Gain 0.738659560680389 UHRF1BP1 ENSG00000065060 CDS Human protein_coding chr6:34824636 chr6:34824636 nonsynonymous SNV 0.697 0 21 hm5C_associated_SNPs_98397 0 19838195 Systemic lupus erythematosus 2e-08 GWAS_Catalog TagSNP rs11755393 GCST004867 A large-scale replication study identifies TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10 as risk loci for systemic lupus erythematosus.
313 chr6 34827085 34827085 1 + A G rs9469913 34827085 - 34827065 34827105 41 GCAGCTGGTGAGCTGGAGGCTTGGGTTCTGCTCAGTTTCTT GCAGCTGGTGAGCTGGAGGCCTGGGTTCTGCTCAGTTTCTT Direct Gain 0 0.539228081703186 Functional Gain 0.539228081703186 UHRF1BP1 ENSG00000065060 CDS Human protein_coding chr6:34827085 chr6:34827085 synonymous SNV . 0 21 hm5C_associated_SNPs_98398 0 28448500 Body mass index 2e-07 GWAS_Catalog TagSNP rs9469913 GCST004557 Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
314 chr6 35056443 35056443 1 + A G rs2005 35056443 - 35056423 35056463 41 GGCGATGGCGGTGGTGGCAGTGGGAGCCTATGCCCCCACGT GGCGATGGCGGTGGTGGCAGCGGGAGCCTATGCCCCCACGT Direct Gain 0 0.978184878826141 Functional Gain 0.978184878826141 ANKS1A ENSG00000064999 UTR3 Human protein_coding chr6:35056443 chr6:35056443 . . 0 21 hm5C_associated_SNPs_98401 0 23251661 Obesity-related traits 7e-06 GWAS_Catalog TagSNP rs2005 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
315 chr6 35263555 35263555 1 + A G rs1194 35263555 - 35263535 35263575 41 GGGGGCTGGGCACCTTTTCTTCAGCCACAGGCCCCTGAGGA GGGGGCTGGGCACCTTTTCTCCAGCCACAGGCCCCTGAGGA Direct Gain 0 0.93601655960083 Functional Gain 0.93601655960083 ZNF76 ENSG00000065029 UTR3 Human protein_coding chr6:35263555 chr6:35263555 . . 0 21 hm5C_associated_SNPs_98410 0 28714469 Systemic lupus erythematosus 5e-07 GWAS_Catalog TagSNP rs1194 GCST005752 Transancestral mapping and genetic load in systemic lupus erythematosus.
316 chr6 80410956 80410956 1 + A G rs2295015 80410956 - 80410936 80410976 41 AAAAATTCCTGGATAGTCCCTGGGATTTGTCAAATGGAATT AAAAATTCCTGGATAGTCCCCGGGATTTGTCAAATGGAATT Direct Gain 0 0.593071341514587 Functional Gain 0.593071341514587 SH3BGRL2 ENSG00000198478 UTR3 Human protein_coding chr6:80410956 chr6:80410956 . . 0 21 hm5C_associated_SNPs_98721 0 26112879 LDL peak particle diameter (total fat intake interaction) 5e-06 GWAS_Catalog TagSNP rs2295015 GCST002989 Interaction between Common Genetic Variants and Total Fat Intake on Low-Density Lipoprotein Peak Particle Diameter: A Genome-Wide Association Study.
317 chr6 90315789 90315789 1 + A G rs3748085 90315789 - 90315769 90315809 41 CACGTTGGCTCCTGCTTTAATGAGCAGCTTGGCTGACTGGC CACGTTGGCTCCTGCTTTAACGAGCAGCTTGGCTGACTGGC Direct Gain 0 0.882035136222839 Functional Gain 0.882035136222839 ANKRD6 ENSG00000135299 CDS Human protein_coding chr6:90315789 chr6:90315789 nonsynonymous SNV 0.991 0 21 hm5C_associated_SNPs_98763 0 17463246 Multiple continuous traits in DGI samples 0.0008674 Johnson and O'Donnell TagSNP rs3748085 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
318 chr6 106547372 106547372 1 + C G rs811925 106547372 - 106547352 106547392 41 TAGTGAAGCCTTTCTGCAAAGTCCCGACAATACCACACAAG TAGTGAAGCCTTTCTGCAAACTCCCGACAATACCACACAAG Direct Gain 0 0.547392010688782 Functional Gain 0.547392010688782 PRDM1 ENSG00000057657 CDS Human protein_coding chr6:106547372 chr6:106547372 nonsynonymous SNV 1.000 2 21 hm5C_associated_SNPs_98792 1 17463246 Multiple continuous traits in DGI samples 0.0009515 Johnson and O'Donnell TagSNP rs811925 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
319 chr6 123122464 123122464 1 + C G rs28385609 123122464 - 123122444 123122484 41 CACTTTACTGGTGACTACAGGCAGTTGATCCTGGCCACAAA CACTTTACTGGTGACTACAGCCAGTTGATCCTGGCCACAAA Direct Gain 0 0.537414848804474 Functional Gain 0.537414848804474 SMPDL3A ENSG00000172594 CDS Human protein_coding chr6:123122464 chr6:123122464 nonsynonymous SNV 0.837 5 21 hm5C_associated_SNPs_98873 0 28240269 Blood protein levels 2e-17 GWAS_Catalog TagSNP rs28385609 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
320 chr6 160505199 160505199 1 + C G rs614754 160505199 - 160505179 160505219 41 CACGAGACTCCGTTGTGGACGAGGGACCAGGACCCGGTGAG CACGAGACTCCGTTGTGGACCAGGGACCAGGACCCGGTGAG Direct Gain 0 0.835773229598999 Functional Gain 0.835773229598999 IGF2R ENSG00000197081 CDS Human protein_coding chr6:160505199 chr6:160505199 synonymous SNV . 0 21 hm5C_associated_SNPs_99085 0 28512139 Lipoprotein (a) levels 1e-15 GWAS_Catalog TagSNP rs614754 GCST004398 A genome-wide association meta-analysis on lipoprotein (a) concentrations adjusted for apolipoprotein (a) isoforms.
321 chr6 167548547 167548547 1 + A G rs62436827 167548547 - 167548527 167548567 41 CAATGGAGTATACCGTGTGCTGGGAACGCCAGCAGTGGCGG CAATGGAGTATACCGTGTGCCGGGAACGCCAGCAGTGGCGG Direct Gain 0 0.838923752307892 Functional Gain 0.838923752307892 CCR6 ENSG00000272980 ncRNA_exonic Human processed_transcript chr6:167548547 chr6:167548547 . . 0 21 hm5C_associated_SNPs_99108 0 24886709 Triglycerides 7e-09 GWAS_Catalog TagSNP rs62436827 GCST002468 Amerindian-specific regions under positive selection harbour new lipid variants in Latinos.
322 chr7 2653582 2653582 1 + A G rs1045714 2653582 - 2653562 2653602 41 GAGCAAAGAAAAAGCTACTTTGTCCAACACCGGGCCCTGGG GAGCAAAGAAAAAGCTACTTCGTCCAACACCGGGCCCTGGG Direct Gain 0 0.554723858833313 Functional Gain 0.554723858833313 IQCE ENSG00000106012 UTR3 Human protein_coding chr7:2653582 chr7:2653582 . . 0 21 hm5C_associated_SNPs_99224 0 25811787 Urate levels in lean individuals 6e-06 GWAS_Catalog TagSNP rs1045714 GCST002830 Modulation of genetic associations with serum urate levels by body-mass-index in humans.
323 chr7 12273152 12273152 1 + A G rs14978 12273152 - 12273132 12273172 41 TTGAAGATACTCAAGAAAACTTGCAGAAAATAATATGAAAA TTGAAGATACTCAAGAAAACCTGCAGAAAATAATATGAAAA Direct Gain 0 0.569965600967407 Functional Gain 0.569965600967407 TMEM106B ENSG00000106460 UTR3 Human protein_coding chr7:12273152 chr7:12273152 . . 0 21 hm5C_associated_SNPs_99342 0 22952603 Response to amphetamines 7e-06 GWAS_Catalog TagSNP rs14978 GCST001651 Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13).
324 chr7 18767343 18767343 1 + A G rs1178127 18767343 - 18767323 18767363 41 TGGAGGGGGCGGTCCATTGCTGGGTGAGGTAAAACAGAGGC TGGAGGGGGCGGTCCATTGCCGGGTGAGGTAAAACAGAGGC Direct Gain 0 0.847956120967865 Functional Gain 0.847956120967865 HDAC9 ENSG00000048052 CDS Human protein_coding chr7:18767343 chr7:18767343 synonymous SNV . 0 21 hm5C_associated_SNPs_99369 1 28441456 Facial morphology (factor 12, vertical position of sublabial sulcus relative to central midface) 1e-06 GWAS_Catalog TagSNP rs1178127 GCST004316 Genome-wide association study of facial morphology reveals novel associations with FREM1 and PARK2.
325 chr7 29186256 29186256 1 + A G rs245880 29186256 - 29186236 29186276 41 ACTTGATGCGGCCAGGTTTCTGGGACCAGGAGGTTGGGACA ACTTGATGCGGCCAGGTTTCCGGGACCAGGAGGTTGGGACA Direct Gain 0 0.927369713783264 Functional Gain 0.927369713783264 CHN2 ENSG00000106069 CDS Human protein_coding chr7:29186256 chr7:29186256 synonymous SNV . 0 21 hm5C_associated_SNPs_99448 0 26265036 Warfarin maintenance dose 8e-06 GWAS_Catalog TagSNP rs245880 GCST003085 Genome-wide association study of warfarin maintenance dose in a Brazilian sample.
326 chr7 36446121 36446121 1 + A G rs3735398 36446121 - 36446101 36446141 41 GCATCATCAGCACTTGAGGATAGGGCTTTATTCAAAGAGGC GCATCATCAGCACTTGAGGACAGGGCTTTATTCAAAGAGGC Direct Gain 0 0.586317121982574 Functional Gain 0.586317121982574 ANLN ENSG00000011426 CDS Human protein_coding chr7:36446121 chr7:36446121 synonymous SNV . 0 21 hm5C_associated_SNPs_99540 0 26969751 Systolic blood pressure 1e-07 GWAS_Catalog TagSNP rs3735398 GCST003670 International Genome-Wide Association Study Consortium Identifies Novel Loci Associated With Blood Pressure in Children and Adolescents.
327 chr7 39610177 39610177 1 + A G rs6947660 39610177 - 39610157 39610197 41 TAAAATGACTTCTGCACCTTTCTTATAACCTTGATTGAAGC TAAAATGACTTCTGCACCTTCCTTATAACCTTGATTGAAGC Direct Gain 0 0.581926584243774 Functional Gain 0.581926584243774 YAE1D1 ENSG00000241127 CDS Human protein_coding chr7:39610177 chr7:39610177 nonsynonymous SNV 0.985 0 21 hm5C_associated_SNPs_99548 0 17554300 Multiple complex diseases 0.000920222 Johnson and O'Donnell TagSNP rs6947660 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
328 chr7 44808091 44808091 1 + T G rs1050331 44808091 - 44808071 44808111 41 AATTCTTCACTTTCACAGAGAAGGGGAACTTGGGAGCGCAG AATTCTTCACTTTCACAGAGCAGGGGAACTTGGGAGCGCAG Direct Gain 0 0.551844656467438 Functional Gain 0.551844656467438 ZMIZ2 ENSG00000122515 UTR3 Human protein_coding chr7:44808091 chr7:44808091 . . 0 21 hm5C_associated_SNPs_99593 0 29942086 Intelligence 2e-09 GWAS_Catalog TagSNP rs1050331 GCST006250 Genome-wide association meta-analysis in 269,867 individuals identifies new genetic and functional links to intelligence.
329 chr7 50470604 50470604 1 + T G rs4132601 50470604 - 50470584 50470624 41 TTAGAGATATTAACTTGGATAAGGCGCATCTTTCTCTGTGA TTAGAGATATTAACTTGGATCAGGCGCATCTTTCTCTGTGA Direct Gain 0 0.766647338867188 Functional Gain 0.766647338867188 IKZF1 ENSG00000185811 UTR3 Human protein_coding chr7:50470604 chr7:50470604 . . 0 21 hm5C_associated_SNPs_99631 0 19684604 Acute lymphoblastic leukemia (childhood) 1e-19 GWAS_Catalog TagSNP rs4132601 GCST000463 Loci on 7p12.2, 10q21.2 and 14q11.2 are associated with risk of childhood acute lymphoblastic leukemia.
330 chr7 100458093 100458093 1 + C G rs7801190 100458093 - 100458073 100458113 41 GAACCCTGCACAATGCCCGTGTACCCCAAAAAGTGCCAGTG GAACCCTGCACAATGCCCGTCTACCCCAAAAAGTGCCAGTG Direct Gain 0 0.603367567062378 Functional Gain 0.603367567062378 SLC12A9 ENSG00000146828 intronic Human protein_coding chr7:100458093 chr7:100458093 . . 0 21 hm5C_associated_SNPs_99930 0 21347282 Hypertension 3e-08 GWAS_Catalog TagSNP rs7801190 GCST000973 Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project.
331 chr8 12870186 12870186 1 + C G rs12156420 12870186 - 12870166 12870206 41 TCCAGTCCCACAACCTATAAGAGAAAAACCTGCGTTACATG TCCAGTCCCACAACCTATAACAGAAAAACCTGCGTTACATG Direct Gain 0 0.706514537334442 Functional Gain 0.706514537334442 KIAA1456 ENSG00000250305 intronic Human protein_coding chr8:12870186 chr8:12870186 . . 0 21 hm5C_associated_SNPs_100617 0 17554300 Multiple complex diseases 0.000428899 Johnson and O'Donnell TagSNP rs12156420 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
332 chr8 33356074 33356074 1 + A G rs6468171 33356074 - 33356054 33356094 41 CCACATAGGCTCGTTTTCTCTGCAGTGGTCCTCTCAAGGGC CCACATAGGCTCGTTTTCTCCGCAGTGGTCCTCTCAAGGGC Direct Gain 0 0.789943933486938 Functional Gain 0.789943933486938 MAK16 ENSG00000198042 CDS Human protein_coding chr8:33356074 chr8:33356074 nonsynonymous SNV 0.027 0 21 hm5C_associated_SNPs_100789 0 17632509 Gallstone disease 0.000199 Johnson and O'Donnell TagSNP rs6468171 . A genome-wide association scan identifies the hepatic cholesterol transporter ABCG8 as a susceptibility factor for human gallstone disease.
333 chr8 123985708 123985708 1 + A G rs3802266 123985708 - 123985688 123985728 41 AAACTATGTACAAGGACCCATTGAAAACGCAGTAGTAGGAC AAACTATGTACAAGGACCCACTGAAAACGCAGTAGTAGGAC Direct Gain 0 0.688903510570526 Functional Gain 0.688903510570526 ZHX2 ENSG00000178764 UTR3 Human protein_coding chr8:123985708 chr8:123985708 . . 0 21 hm5C_associated_SNPs_101095 0 17052657 Parkinson's disease 0.000127478 Johnson and O'Donnell TagSNP rs3802266 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
334 chr8 146068322 146068322 1 + C G rs9004 146068322 - 146068302 146068342 41 TCCAGGGCATTCCCATATTCGTAAAACCACTGGGCCCTAGT TCCAGGGCATTCCCATATTCCTAAAACCACTGGGCCCTAGT Direct Gain 0 0.83848512172699 Functional Gain 0.83848512172699 ZNF7 ENSG00000147789 CDS Human protein_coding chr8:146068322 chr8:146068322 stopgain 0.546 0 21 hm5C_associated_SNPs_101243 0 29274321 Logical memory (immediate recall) in normal cognition 2e-07 GWAS_Catalog TagSNP rs9004 GCST007005 Genome-wide association study of Alzheimer's disease endophenotypes at prediagnosis stages.
335 chr9 129460914 129460914 1 + A G rs10733682 129460914 - 129460894 129460934 41 CTTGACCTCAGAGTTAAAGGTAGGGTTGTGAGCACCTGAAC CTTGACCTCAGAGTTAAAGGCAGGGTTGTGAGCACCTGAAC Direct Gain 0 0.811686754226685 Functional Gain 0.811686754226685 LMX1B ENSG00000136944 UTR3 Human protein_coding chr9:129460914 chr9:129460914 . . 0 21 hm5C_associated_SNPs_101869 1 25673413 Body mass index 2e-08 GWAS_Catalog TagSNP rs10733682 GCST002783 Genetic studies of body mass index yield new insights for obesity biology.
336 chr9 130167787 130167787 1 + C G rs115668237 130167787 - 130167767 130167807 41 ATGAGCCAGTTGGTGAGGACGCAGATGCCTGTCGCCACGCC ATGAGCCAGTTGGTGAGGACCCAGATGCCTGTCGCCACGCC Direct Gain 0 0.526226937770844 Functional Gain 0.526226937770844 SLC2A8 ENSG00000136856 CDS Human protein_coding chr9:130167787 chr9:130167787 nonsynonymous SNV 0.453 4 21 hm5C_associated_SNPs_101886 0 27777418 Major depressive disorder 6e-06 GWAS_Catalog TagSNP rs115668237 GCST005547 The PHF21B gene is associated with major depression and modulates the stress response.
337 chr9 136305530 136305530 1 + C G rs28647808 136305530 - 136305510 136305550 41 ACCATCCTCCAGGAGGGAGGGGTAGGTGGTGTTAGGGGAGA ACCATCCTCCAGGAGGGAGGCGTAGGTGGTGTTAGGGGAGA Direct Gain 0 0.51192182302475 Functional Gain 0.51192182302475 ADAMTS13 ENSG00000160323 CDS Human protein_coding chr9:136305530 chr9:136305530 nonsynonymous SNV 0.997 2 21 hm5C_associated_SNPs_102051 2 28240269 Blood protein levels 3e-42 GWAS_Catalog TagSNP rs28647808 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
338 chr9 139616742 139616742 1 + A G rs945384 139616742 - 139616722 139616762 41 CTGCCTGACCTTGAGGAAGCTGAGGGTCATCTCCCGGAATT CTGCCTGACCTTGAGGAAGCCGAGGGTCATCTCCCGGAATT Direct Gain 0 0.771297454833984 Functional Gain 0.771297454833984 FAM69B ENSG00000165716 CDS Human protein_coding chr9:139616742 chr9:139616742 nonsynonymous SNV 0.999 0 21 hm5C_associated_SNPs_102136 0 17293876 Type II Diabetes Mellitus 2.9e-05 Johnson and O'Donnell TagSNP rs945384 . A genome-wide association study identifies novel risk loci for type 2 diabetes.
339 chr9 140100317 140100317 1 + C G rs113809617 140100317 - 140100297 140100337 41 CCGGCAGCCAAGCCGCCGGCGCCGGGCCTCGCGACCCAGTC CCGGCAGCCAAGCCGCCGGCCCCGGGCCTCGCGACCCAGTC Direct Gain 0 0.55083554983139 Functional Gain 0.55083554983139 NDOR1 ENSG00000188566 CDS Human protein_coding chr9:140100317 chr9:140100317 nonsynonymous SNV 0.977 1 21 hm5C_associated_SNPs_102181 0 27863252 Mean corpuscular volume 8e-16 GWAS_Catalog TagSNP rs113809617 GCST004602 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
340 chr10 7772035 7772035 1 + A G rs35524242 7772035 - 7772015 7772055 41 GTGCAATTCCATGGTTTTCATTGGACAGTCTCTTCAAAAAA GTGCAATTCCATGGTTTTCACTGGACAGTCTCTTCAAAAAA Direct Gain 0 0.585447907447815 Functional Gain 0.585447907447815 ITIH2 ENSG00000151655 CDS Human protein_coding chr10:7772035 chr10:7772035 nonsynonymous SNV 0.939 0 21 hm5C_associated_SNPs_102264 0 29875488 Blood protein levels 7e-52 GWAS_Catalog TagSNP rs35524242 GCST005806 Genomic atlas of the human plasma proteome.
341 chr10 64564934 64564934 1 + C G rs10995311 64564934 - 64564914 64564954 41 CGGCTGCATCGGCGCCTCCGGGCCAGAAGCCGCGTCGCGAT CGGCTGCATCGGCGCCTCCGCGCCAGAAGCCGCGTCGCGAT Direct Gain 0 0.71004855632782 Functional Gain 0.71004855632782 ADO ENSG00000181915 CDS Human protein_coding chr10:64564934 chr10:64564934 nonsynonymous SNV 0.800 0 21 hm5C_associated_SNPs_102552 0 27618447 Diastolic blood pressure 1e-12 GWAS_Catalog TagSNP rs10995311 GCST006020 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
342 chr10 71393025 71393025 1 + A G rs1132075 71393025 - 71393005 71393045 41 CATACCACCTAAAAGTATCTTGGGAACCAACGGACCCACCC CATACCACCTAAAAGTATCTCGGGAACCAACGGACCCACCC Direct Gain 0 0.958556294441223 Functional Gain 0.958556294441223 C10orf35 ENSG00000171224 UTR3 Human protein_coding chr10:71393025 chr10:71393025 . . 0 21 hm5C_associated_SNPs_102583 0 17434096 Ischemic stroke 8.21e-05 Johnson and O'Donnell TagSNP rs1132075 . A genome-wide genotyping study in patients with ischaemic stroke: initial analysis and data release.
343 chr10 106039185 106039185 1 + A G rs156697 106039185 - 106039165 106039205 41 ACGCAGGGCTGCCTTCAGATTAGTGCATTCTCTCCCACATC ACGCAGGGCTGCCTTCAGATCAGTGCATTCTCTCCCACATC Direct Gain 0 0.59276294708252 Functional Gain 0.59276294708252 GSTO2 ENSG00000065621 CDS Human protein_coding chr10:106039185 chr10:106039185 nonsynonymous SNV 0.239 0 21 hm5C_associated_SNPs_102961 0 17903307 Pulmonary function phenotypes 9.78e-06 Johnson and O'Donnell TagSNP rs156697 . Framingham Heart Study genome-wide association: results for pulmonary function measures.
344 chr10 124190121 124190121 1 + A G rs17103541 124190121 - 124190101 124190141 41 CCAAGGCCTGATGAAGCTTTTTCAAACAAATGTCTAAGACA CCAAGGCCTGATGAAGCTTTCTCAAACAAATGTCTAAGACA Direct Gain 0 0.599739968776703 Functional Gain 0.599739968776703 PLEKHA1 ENSG00000107679 UTR3 Human protein_coding chr10:124190121 chr10:124190121 . . 0 21 hm5C_associated_SNPs_103089 0 17554300 Multiple complex diseases 3.16e-05 Johnson and O'Donnell TagSNP rs17103541 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
345 chr11 2167543 2167543 1 + T G rs1003483 2167543 - 2167523 2167563 41 GCTCTGAGGACCCTTGGAGAAAGGAGCTGGGTTTGTAAAAT GCTCTGAGGACCCTTGGAGACAGGAGCTGGGTTTGTAAAAT Direct Gain 0 0.786395192146301 Functional Gain 0.786395192146301 IGF2-AS ENSG00000099869 ncRNA_exonic Human antisense chr11:2167543 chr11:2167543 . . 0 21 hm5C_associated_SNPs_103328 0 17052657 Parkinson's disease 9.67286e-05 Johnson and O'Donnell TagSNP rs1003483 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
346 chr11 2169774 2169774 1 + A G rs3741208 2169774 - 2169754 2169794 41 GACAGGAGACTGAGGAGAAATGCCGGGAGAGGCAACAACCG GACAGGAGACTGAGGAGAAACGCCGGGAGAGGCAACAACCG Direct Gain 0 0.667055606842041 Functional Gain 0.667055606842041 IGF2-AS ENSG00000099869 ncRNA_exonic Human antisense chr11:2169774 chr11:2169774 . . 0 21 hm5C_associated_SNPs_103333 0 17554260 Type 1 diabetes 2e-07 GWAS_Catalog TagSNP rs3741208 GCST000038 Robust associations of four new chromosome regions from genome-wide analyses of type 1 diabetes.
347 chr11 4661285 4661285 1 + A G rs905871 4661285 - 4661265 4661305 41 GGCCATCTTGGGCATGGTGATAGAGGAGAGGACTAGGTCAA GGCCATCTTGGGCATGGTGACAGAGGAGAGGACTAGGTCAA Direct Gain 0 0.788462042808533 Functional Gain 0.788462042808533 OR51D1 ENSG00000197428 CDS Human protein_coding chr11:4661285 chr11:4661285 nonsynonymous SNV 0.487 0 21 hm5C_associated_SNPs_103362 0 30643258 Smoking status (ever vs never smokers) 3e-08 GWAS_Catalog TagSNP rs905871 GCST007327 Genome-wide association analyses of risk tolerance and risky behaviors in over 1 million individuals identify hundreds of loci and shared genetic influences.
348 chr11 4675379 4675379 1 + A G rs10500609 4675379 - 4675359 4675399 41 CAATTTTCCCATGGCTACAATGAGGGTACTAATAATATCTT CAATTTTCCCATGGCTACAACGAGGGTACTAATAATATCTT Direct Gain 0 0.63298636674881 Functional Gain 0.63298636674881 OR51E1 ENSG00000180785 UTR3 Human protein_coding chr11:4675379 chr11:4675379 . . 0 21 hm5C_associated_SNPs_103365 0 17846125 Type II Diabetes Mellitus 0.00099846 Johnson and O'Donnell TagSNP rs10500609 . A search for variants associated with young-onset type 2 diabetes in American Indians in a 100K genotyping array.
349 chr11 56019925 56019925 1 + T G rs17150243 56019925 - 56019905 56019945 41 ATACATGGGGTTGTGGAGCCAGGAATCCTCAATGACCAACA ATACATGGGGTTGTGGAGCCCGGAATCCTCAATGACCAACA Direct Gain 0 0.516663134098053 Functional Gain 0.516663134098053 OR5T3 ENSG00000172489 CDS Human protein_coding chr11:56019925 chr11:56019925 nonsynonymous SNV 0.066 1 21 hm5C_associated_SNPs_103737 0 23251661 Obesity-related traits 9e-06 GWAS_Catalog TagSNP rs17150243 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
350 chr11 60776209 60776209 1 + C G rs11230563 60776209 - 60776189 60776229 41 CGAGCAGTTCACCTGGTCCCGGTGGATAGGCCCGCGGCCGG CGAGCAGTTCACCTGGTCCCCGTGGATAGGCCCGCGGCCGG Direct Gain 0 0.952500998973846 Functional Gain 0.952500998973846 CD6 ENSG00000013725 CDS Human protein_coding chr11:60776209 chr11:60776209 nonsynonymous SNV 0.581 2 21 hm5C_associated_SNPs_103817 0 26974007 Chronic inflammatory diseases (ankylosing spondylitis, Crohn's disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy) 5e-15 GWAS_Catalog TagSNP rs11230563 GCST005537 Analysis of five chronic inflammatory diseases identifies 27 new associations and highlights disease-specific patterns at shared loci.
351 chr11 63974995 63974995 1 + C G rs142815441 63974995 - 63974975 63975015 41 GCGGGCAGCGGACACTCACTGATCTGCTCCACAATCTTCAG GCGGGCAGCGGACACTCACTCATCTGCTCCACAATCTTCAG Direct Gain 0 0.519668281078339 Functional Gain 0.519668281078339 FERMT3 ENSG00000149781 CDS Human protein_coding chr11:63974995 chr11:63974995 nonsynonymous SNV 0.995 0 21 hm5C_associated_SNPs_103879 1 30595370 White blood cell count 2e-08 GWAS_Catalog TagSNP rs142815441 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
352 chr11 67160961 67160961 1 + A G rs2066496 67160961 - 67160941 67160981 41 GACAGACAGGAAAGACTGCATGGGATAAGACACCTCAGCCT GACAGACAGGAAAGACTGCACGGGATAAGACACCTCAGCCT Direct Gain 0 0.903149366378784 Functional Gain 0.903149366378784 RAD9A ENSG00000172613 intronic Human protein_coding chr11:67160961 chr11:67160961 . . 0 21 hm5C_associated_SNPs_104015 0 30595370 Height 2e-11 GWAS_Catalog TagSNP rs2066496 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
353 chr11 68840160 68840160 1 + A G rs3750965 68840160 - 68840140 68840180 41 GTACCTCCATCATGGCCTGTTTGTGGGAGCTGTCCAGCTGG GTACCTCCATCATGGCCTGTCTGTGGGAGCTGTCCAGCTGG Direct Gain 0 0.779092192649841 Functional Gain 0.779092192649841 TPCN2 ENSG00000162341 CDS Human protein_coding chr11:68840160 chr11:68840160 nonsynonymous SNV 0.618 1 21 hm5C_associated_SNPs_104056 0 20585627 Hair color 3e-07 GWAS_Catalog TagSNP rs3750965 GCST000707 Web-based, participant-driven studies yield novel genetic associations for common traits.
354 chr11 113133676 113133676 1 + T G rs2288158 113133676 - 113133656 113133696 41 TTCATAGGAACTGGGCTTTTAAGCAAATTTAATTTTTGTGT TTCATAGGAACTGGGCTTTTCAGCAAATTTAATTTTTGTGT Direct Gain 0 0.646957635879517 Functional Gain 0.646957635879517 NCAM1 ENSG00000149294 UTR3 Human protein_coding chr11:113133676 chr11:113133676 . . 0 21 hm5C_associated_SNPs_104378 0 30072576 Blood protein levels 1e-10 GWAS_Catalog TagSNP rs2288158 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
355 chr11 121502745 121502745 1 + C G rs1131497 121502745 - 121502725 121502765 41 GTCACAGTGAAGACAGTTATGTGGTCACCTTCAGAGGCTGC GTCACAGTGAAGACAGTTATCTGGTCACCTTCAGAGGCTGC Direct Gain 0 0.588775634765625 Functional Gain 0.588775634765625 SORL1 ENSG00000137642 UTR3 Human protein_coding chr11:121502745 chr11:121502745 . . 0 21 hm5C_associated_SNPs_104490 0 17903297 Brain aging, MRI and cognition phenotypes 3.2e-06 Johnson and O'Donnell TagSNP rs1131497 . Genetic correlates of brain aging on MRI and cognitive test measures: a genome-wide association and linkage analysis in the Framingham Study.
356 chr12 3392351 3392351 1 + A G rs632887 3392351 - 3392331 3392371 41 ATCTGGAGAGCGCAGGCAGGTGACACAAAGCTCAATCCTCT ATCTGGAGAGCGCAGGCAGGCGACACAAAGCTCAATCCTCT Direct Gain 0 0.511098504066467 Functional Gain 0.511098504066467 TSPAN9 ENSG00000011105 UTR3 Human protein_coding chr12:3392351 chr12:3392351 . . 0 21 hm5C_associated_SNPs_104673 0 31015462 Estimated glomerular filtration rate 5e-20 GWAS_Catalog TagSNP rs632887 GCST007876 Sex-specific and pleiotropic effects underlying kidney function identified from GWAS meta-analysis.
357 chr12 6493351 6493351 1 + A G rs10849448 6493351 - 6493331 6493371 41 CCGGGCCTCCAGGGCTCCCATGGCGGAGCTCAGGAAGTGGG CCGGGCCTCCAGGGCTCCCACGGCGGAGCTCAGGAAGTGGG Direct Gain 0 0.818191349506378 Functional Gain 0.818191349506378 LTBR ENSG00000111321 UTR5 Human protein_coding chr12:6493351 chr12:6493351 . . 0 21 hm5C_associated_SNPs_104709 0 27182965 Tonsillectomy 2e-35 GWAS_Catalog TagSNP rs10849448 GCST003995 Detection and interpretation of shared genetic influences on 42 human traits.
358 chr12 8932201 8932201 1 + T G rs2377585 8932201 - 8932181 8932221 41 TTGCCAACTTTAAAAAAATCAGGAAATAAAACAAATACTGA TTGCCAACTTTAAAAAAATCCGGAAATAAAACAAATACTGA Direct Gain 0 0.534173250198364 Functional Gain 0.534173250198364 RIMKLB;A2ML1 ENSG00000256661 ncRNA_intronic Human antisense chr12:8932201 chr12:8932201 . . 0 21 hm5C_associated_SNPs_104774 0 27863252 Reticulocyte fraction of red cells 2e-15 GWAS_Catalog TagSNP rs2377585 GCST004619 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
359 chr12 26348429 26348429 1 + C G rs113819537 26348429 - 26348409 26348449 41 CACGGGGAGCCCGCAGCAGAGGGGGGATTCGAGGGGGGTCG CACGGGGAGCCCGCAGCAGACGGGGGATTCGAGGGGGGTCG Direct Gain 0 0.876715183258057 Functional Gain 0.876715183258057 SSPN ENSG00000123096 UTR5 Human protein_coding chr12:26348429 chr12:26348429 . . 0 21 hm5C_associated_SNPs_104895 0 29892015 Atrial fibrillation 2e-09 GWAS_Catalog TagSNP rs113819537 GCST006061 Multi-ethnic genome-wide association study for atrial fibrillation.
360 chr12 48513086 48513086 1 + T G rs12306290 48513086 - 48513066 48513106 41 GAGGAGCCAGGTGGAGGCAAAGAGGGAGGGGGAAGGAGGAG GAGGAGCCAGGTGGAGGCAACGAGGGAGGGGGAAGGAGGAG Direct Gain 0 0.775525748729706 Functional Gain 0.775525748729706 PFKM ENSG00000152556 UTR5 Human protein_coding chr12:48513086 chr12:48513086 . . 0 21 hm5C_associated_SNPs_104986 1 30038396 Highest math class taken (MTAG) 3e-10 GWAS_Catalog TagSNP rs12306290 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
361 chr12 53777171 53777171 1 + A G rs3741651 53777171 - 53777151 53777191 41 ATTGGGGCTAAGGTGATTGTTTGGGCTTGTGGGTTCTGAAC ATTGGGGCTAAGGTGATTGTCTGGGCTTGTGGGTTCTGAAC Direct Gain 0 0.883858919143677 Functional Gain 0.883858919143677 SP1 ENSG00000185591 CDS Human protein_coding chr12:53777171 chr12:53777171 synonymous SNV . 0 21 hm5C_associated_SNPs_105090 0 30595370 Red blood cell count 4e-41 GWAS_Catalog TagSNP rs3741651 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
362 chr12 57975700 57975700 1 + C G rs113247976 57975700 - 57975680 57975720 41 CCTTCTGGTAGGAAGCCAAGGGGCCGCCAGAAGATGTGGCT CCTTCTGGTAGGAAGCCAAGCGGCCGCCAGAAGATGTGGCT Direct Gain 0 0.813972413539886 Functional Gain 0.813972413539886 KIF5A ENSG00000155980 CDS Human protein_coding chr12:57975700 chr12:57975700 nonsynonymous SNV 0.851 1 21 hm5C_associated_SNPs_105179 1 29566793 Amyotrophic lateral sclerosis 7e-13 GWAS_Catalog TagSNP rs113247976 GCST005647 Genome-wide Analyses Identify KIF5A as a Novel ALS Gene.
363 chr12 80765800 80765800 1 + A G rs1551122 80765800 - 80765780 80765820 41 AAAGCTTCACAATCCCTTCATTCTAGAAAGAGAAAAAAGCA AAAGCTTCACAATCCCTTCACTCTAGAAAGAGAAAAAAGCA Direct Gain 0 0.632028222084045 Functional Gain 0.632028222084045 OTOGL ENSG00000165899 CDS Human protein_coding chr12:80765800 chr12:80765800 nonsynonymous SNV 0.998 3 21 hm5C_associated_SNPs_105308 1 29885931 End stage renal disease x APOL1 genotype interaction 9e-07 GWAS_Catalog TagSNP rs1551122 GCST006813 Genome-wide association studies suggest that APOL1-environment interactions more likely trigger kidney disease in African Americans with nondiabetic nephropathy than strong APOL1-second gene interactions.
364 chr12 95696420 95696420 1 + A G rs3596 95696420 - 95696400 95696440 41 AGTTACCCCACTAATACAACTGAGAACCACTGACTTCAAAT AGTTACCCCACTAATACAACCGAGAACCACTGACTTCAAAT Direct Gain 0 0.666472971439362 Functional Gain 0.666472971439362 VEZT ENSG00000028203 UTR3 Human protein_coding chr12:95696420 chr12:95696420 . . 0 21 hm5C_associated_SNPs_105354 0 23472165 Endometriosis 2e-06 GWAS_Catalog TagSNP rs3596 GCST001894 Genome-wide association study link novel loci to endometriosis.
365 chr12 110719192 110719192 1 + C G rs3026433 110719192 - 110719172 110719212 41 ACCACTGAGGGCGGAACGCGGCGAGGGAGGCGAGCCGGCGG ACCACTGAGGGCGGAACGCGCCGAGGGAGGCGAGCCGGCGG Direct Gain 0 0.793473243713379 Functional Gain 0.793473243713379 ATP2A2 ENSG00000174437 UTR5 Human protein_coding chr12:110719192 chr12:110719192 . . 0 21 hm5C_associated_SNPs_105557 1 31043756 Bipolar I disorder 6e-07 GWAS_Catalog TagSNP rs3026433 GCST008115 Genome-wide association study identifies 30 loci associated with bipolar disorder.
366 chr12 111887659 111887659 1 + A G rs739496 111887659 - 111887639 111887679 41 GAAGCAAAAATTTGACCTCTTGGAGCACAGAGACTAAGTAT GAAGCAAAAATTTGACCTCTCGGAGCACAGAGACTAAGTAT Direct Gain 0 0.677401721477509 Functional Gain 0.677401721477509 SH2B3 ENSG00000111252 UTR3 Human protein_coding chr12:111887659 chr12:111887659 . . 0 21 hm5C_associated_SNPs_105568 0 20139978 Platelet count 5e-19 GWAS_Catalog TagSNP rs739496 GCST000580 Genome-wide association study of hematological and biochemical traits in a Japanese population.
367 chr13 23824783 23824783 1 + T G rs1800351 23824783 - 23824763 23824803 41 ACATTCTGGGTTGATTGTAGAAGCAGAGATGAGTCCTAGAA ACATTCTGGGTTGATTGTAGCAGCAGAGATGAGTCCTAGAA Direct Gain 0 0.582186698913574 Functional Gain 0.582186698913574 SGCG ENSG00000102683 CDS Human protein_coding chr13:23824783 chr13:23824783 synonymous SNV . 0 21 hm5C_associated_SNPs_105815 3 30898391 Epithelial ovarian cancer 7e-06 GWAS_Catalog TagSNP rs1800351 GCST007728 Genome-wide association studies identify susceptibility loci for epithelial ovarian cancer in east Asian women.
368 chr13 43148546 43148546 1 + C G rs138818878 43148546 - 43148526 43148566 41 CAGGGGGCTGGTGCGGCGCAGGCGGCGGCGGGGCGTGCAGG CAGGGGGCTGGTGCGGCGCACGCGGCGGCGGGGCGTGCAGG Direct Gain 0 0.661723017692566 Functional Gain 0.661723017692566 TNFSF11 ENSG00000120659 CDS Human protein_coding chr13:43148546 chr13:43148546 nonsynonymous SNV 0.014 0 21 hm5C_associated_SNPs_105962 1 30598549 Heel bone mineral density 6e-15 GWAS_Catalog TagSNP rs138818878 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
369 chr14 63758432 63758432 1 + A G rs17100993 63758432 - 63758412 63758452 41 TCAGATGGTTTTCTTTCAATTAGGTTCAAAAATCATGGCTC TCAGATGGTTTTCTTTCAATCAGGTTCAAAAATCATGGCTC Direct Gain 0 0.80238550901413 Functional Gain 0.80238550901413 RHOJ ENSG00000126785 UTR3 Human protein_coding chr14:63758432 chr14:63758432 . . 0 21 hm5C_associated_SNPs_106527 0 17554300 Multiple complex diseases 0.000176523 Johnson and O'Donnell TagSNP rs17100993 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
370 chr14 75537381 75537381 1 + C G rs11546525 75537381 - 75537361 75537401 41 TGGGAAGAGTCACCTTGTTCGTAAGAGTCTTGCTTGGCTGA TGGGAAGAGTCACCTTGTTCCTAAGAGTCTTGCTTGGCTGA Direct Gain 0 0.58469820022583 Functional Gain 0.58469820022583 ZC2HC1C ENSG00000119703 CDS Human protein_coding chr14:75537381 chr14:75537381 stopgain 0.921 0 21 hm5C_associated_SNPs_106668 0 30595370 Systolic blood pressure 3e-10 GWAS_Catalog TagSNP rs11546525 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
371 chr14 96389331 96389331 1 + A G rs3811345 96389331 - 96389311 96389351 41 ACTTCCGTCTTTGGCCATTCTGAGGCCTCTGAGGACGCTCT ACTTCCGTCTTTGGCCATTCCGAGGCCTCTGAGGACGCTCT Direct Gain 0 0.866981983184814 Functional Gain 0.866981983184814 TUNAR ENSG00000250366 ncRNA_exonic Human protein_coding chr14:96389331 chr14:96389331 . . 0 21 hm5C_associated_SNPs_106800 0 26030696 Emphysema imaging phenotypes 2e-06 GWAS_Catalog TagSNP rs3811345 GCST002945 A Genome-Wide Association Study of Emphysema and Airway Quantitative Imaging Phenotypes.
372 chr14 101531854 101531854 1 + A G rs61992671 101531854 - 101531834 101531874 41 CTGCAGCGGATACGGACGGCTAGTGGACCAGGTGAAGTACA CTGCAGCGGATACGGACGGCCAGTGGACCAGGTGAAGTACA Direct Gain 0 0.657396733760834 Functional Gain 0.657396733760834 MIR412 ENSG00000199012 ncRNA_exonic Human miRNA chr14:101531854 chr14:101531854 . . 0 21 hm5C_associated_SNPs_106850 0 29691431 Hand grip strength 1e-08 GWAS_Catalog TagSNP rs61992671 GCST005830 Biological Insights Into Muscular Strength: Genetic Findings in the UK Biobank.
373 chr15 33905410 33905410 1 + A G rs2229116 33905410 - 33905390 33905430 41 TCTCAGGAGGTGCTGGTTGATGGAAGCCACAGCTCTGGGTA TCTCAGGAGGTGCTGGTTGACGGAAGCCACAGCTCTGGGTA Direct Gain 0 0.955233693122864 Functional Gain 0.955233693122864 RYR3 ENSG00000198838 CDS Human protein_coding chr15:33905410 chr15:33905410 nonsynonymous SNV 1.000 0 21 hm5C_associated_SNPs_107081 0 20009918 Carotid atherosclerosis in HIV infection 3e-08 GWAS_Catalog TagSNP rs2229116 GCST000555 A genome-wide association study of carotid atherosclerosis in HIV-infected men.
374 chr15 67457698 67457698 1 + A G rs35874463 67457698 - 67457678 67457718 41 AATATTGCTCTGGGGCTCGATGCCTGCGGGGAAGTTAGTGT AATATTGCTCTGGGGCTCGACGCCTGCGGGGAAGTTAGTGT Direct Gain 0 0.852921009063721 Functional Gain 0.852921009063721 SMAD3 ENSG00000166949 CDS Human protein_coding chr15:67457698 chr15:67457698 nonsynonymous SNV 0.998 1 21 hm5C_associated_SNPs_107388 3 26974007 Chronic inflammatory diseases (ankylosing spondylitis, Crohn's disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy) 1e-11 GWAS_Catalog TagSNP rs35874463 GCST005537 Analysis of five chronic inflammatory diseases identifies 27 new associations and highlights disease-specific patterns at shared loci.
375 chr15 74888196 74888196 1 + A G rs74781061 74888196 - 74888176 74888216 41 GTGCTCGTCGACGTGGGCTCTGTGAGATGAGGTAAATTCTG GTGCTCGTCGACGTGGGCTCCGTGAGATGAGGTAAATTCTG Direct Gain 0 0.78107225894928 Functional Gain 0.78107225894928 ARID3B ENSG00000179361 UTR3 Human protein_coding chr15:74888196 chr15:74888196 . . 0 21 hm5C_associated_SNPs_107489 0 28881265 Endometriosis 1e-06 GWAS_Catalog TagSNP rs74781061 GCST004873 New variants near RHOJ and C2, HLA-DRA region and susceptibility to endometriosis in the Polish population-The genome-wide association study.
376 chr15 78857939 78857939 1 + T G rs55853698 78857939 - 78857919 78857959 41 AACGAGGGCAGACGCAGCAGAGGGGCCGCTCCGCGCCACAG AACGAGGGCAGACGCAGCAGCGGGGCCGCTCCGCGCCACAG Direct Gain 0 0.928881645202637 Functional Gain 0.928881645202637 CHRNA5 ENSG00000169684 UTR5 Human protein_coding chr15:78857939 chr15:78857939 . . 0 21 hm5C_associated_SNPs_107545 0 28604730 Small cell lung carcinoma 5e-21 GWAS_Catalog TagSNP rs55853698 GCST004746 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
377 chr15 85606213 85606213 1 + A G rs11632658 85606213 - 85606193 85606233 41 TCTCTTGAGTTGTGTAACTATGGGCCAGTCTCATACTGGTG TCTCTTGAGTTGTGTAACTACGGGCCAGTCTCATACTGGTG Direct Gain 0 0.802372515201569 Functional Gain 0.802372515201569 PDE8A ENSG00000073417 intronic Human protein_coding chr15:85606213 chr15:85606213 . . 0 21 hm5C_associated_SNPs_107618 0 17554300 Multiple complex diseases 0.000549308 Johnson and O'Donnell TagSNP rs11632658 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
378 chr15 86077189 86077189 1 + A G rs2279168 86077189 - 86077169 86077209 41 AGACCTGAATATGATGACCATAGAAAAGTAGCCCCATTAAA AGACCTGAATATGATGACCACAGAAAAGTAGCCCCATTAAA Direct Gain 0 0.753304719924927 Functional Gain 0.753304719924927 AKAP13 ENSG00000170776 UTR3 Human protein_coding chr15:86077189 chr15:86077189 . . 0 21 hm5C_associated_SNPs_107622 0 21844884 Response to platinum-based chemotherapy (carboplatin) 9e-06 GWAS_Catalog TagSNP rs2279168 GCST001204 Genome-wide meta-analysis identifies variants associated with platinating agent susceptibility across populations.
379 chr15 86079115 86079115 1 + C G rs35343117 86079115 - 86079095 86079135 41 TCGCTTCAACCCAGGAGATGGAGGTTGCAGTGAGCCGAGAT TCGCTTCAACCCAGGAGATGCAGGTTGCAGTGAGCCGAGAT Direct Gain 0 0.724035739898682 Functional Gain 0.724035739898682 AKAP13 ENSG00000170776 UTR3 Human protein_coding chr15:86079115 chr15:86079115 . . 0 21 hm5C_associated_SNPs_107625 0 25939698 Psoriasis 2e-06 GWAS_Catalog TagSNP rs35343117 GCST002889 Enhanced meta-analysis and replication studies identify five new psoriasis susceptibility loci.
380 chr16 1306642 1306642 1 + C G rs61739908 1306642 - 1306622 1306662 41 CACCCACTGGGGGTGGATGAGGGAGCCCCCGCAGAAGTGCA CACCCACTGGGGGTGGATGACGGAGCCCCCGCAGAAGTGCA Direct Gain 0 0.782461762428284 Functional Gain 0.782461762428284 TPSD1 ENSG00000095917 CDS Human protein_coding chr16:1306642 chr16:1306642 nonsynonymous SNV 0.983 5 21 hm5C_associated_SNPs_107904 0 30072576 Blood protein levels 2e-76 GWAS_Catalog TagSNP rs61739908 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
381 chr16 15129970 15129970 1 + A G rs7200543 15129970 - 15129950 15129990 41 ATCTGCTCCGGCCCACTGGATAGGCGCTCCACCTTTTCTAA ATCTGCTCCGGCCCACTGGACAGGCGCTCCACCTTTTCTAA Direct Gain 0 0.7575563788414 Functional Gain 0.7575563788414 PDXDC1 ENSG00000179889 CDS Human protein_coding chr16:15129970 chr16:15129970 synonymous SNV . 0 21 hm5C_associated_SNPs_108207 0 21886157 Metabolic traits 5e-16 GWAS_Catalog TagSNP rs7200543 GCST001217 Human metabolic individuality in biomedical and pharmaceutical research.
382 chr16 28883241 28883241 1 + A G rs7498665 28883241 - 28883221 28883261 41 GAGGGGATGAACTGTCCCTGTTGGGGGTCCCTCTTCAATGG GAGGGGATGAACTGTCCCTGCTGGGGGTCCCTCTTCAATGG Direct Gain 0 0.506267368793488 Functional Gain 0.506267368793488 SH2B1 ENSG00000178188 CDS Human protein_coding chr16:28883241 chr16:28883241 nonsynonymous SNV 0.736 0 21 hm5C_associated_SNPs_108349 0 23563607 Obesity 5e-12 GWAS_Catalog TagSNP rs7498665 GCST001953 Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture.
383 chr16 69974546 69974546 1 + A G rs3748387 69974546 - 69974526 69974566 41 TAACAAAAAACCTGCAACCCTACAACACAACCACTTCAAGT TAACAAAAAACCTGCAACCCCACAACACAACCACTTCAAGT Direct Gain 0 0.554028511047363 Functional Gain 0.554028511047363 WWP2 ENSG00000198373 UTR3 Human protein_coding chr16:69974546 chr16:69974546 . . 0 21 hm5C_associated_SNPs_108699 0 30595370 Smoking status 4e-11 GWAS_Catalog TagSNP rs3748387 GCST007085 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
384 chr16 71885423 71885423 1 + A G rs61747555 71885423 - 71885403 71885443 41 CTGGCTTGGGGGAGCACAGCTGGCCTGAGAAACTGAGTTAC CTGGCTTGGGGGAGCACAGCCGGCCTGAGAAACTGAGTTAC Direct Gain 0 0.756735801696777 Functional Gain 0.756735801696777 ATXN1L ENSG00000224470 CDS Human protein_coding chr16:71885423 chr16:71885423 nonsynonymous SNV 1.000 0 21 hm5C_associated_SNPs_108727 0 30108127 Body mass index 9e-06 GWAS_Catalog TagSNP rs61747555 GCST006368 A Large Multi-ethnic Genome-Wide Association Study of Adult Body Mass Index Identifies Novel Loci.
385 chr16 84796603 84796603 1 + A G rs12932018 84796603 - 84796583 84796623 41 AAGTATTCCTCAGCATCTTCTTGTCGACCCTGAAAAGGTCA AAGTATTCCTCAGCATCTTCCTGTCGACCCTGAAAAGGTCA Direct Gain 0 0.58348536491394 Functional Gain 0.58348536491394 USP10 ENSG00000103194 CDS Human protein_coding chr16:84796603 chr16:84796603 synonymous SNV . 0 21 hm5C_associated_SNPs_108839 0 24009623 Response to mTOR inhibitor (everolimus) 6e-06 GWAS_Catalog TagSNP rs12932018 GCST002157 Genome-wide association study for biomarker identification of Rapamycin and Everolimus using a lymphoblastoid cell line system.
386 chr17 43924200 43924200 1 + C G rs12373142 43924200 - 43924180 43924220 41 CATGGCCCAGCTCTGAGGGCGGGGGCATCAGGGGCATGAGT CATGGCCCAGCTCTGAGGGCCGGGGCATCAGGGGCATGAGT Direct Gain 0 0.804306983947754 Functional Gain 0.804306983947754 SPPL2C ENSG00000185294 CDS Human protein_coding chr17:43924200 chr17:43924200 nonsynonymous SNV 0.000 0 21 hm5C_associated_SNPs_109689 0 30804561 Chronic obstructive pulmonary disease 1e-09 GWAS_Catalog TagSNP rs12373142 GCST007692 Genetic landscape of chronic obstructive pulmonary disease identifies heterogeneous cell-type and phenotype associations.
387 chr17 44073889 44073889 1 + A G rs1052553 44073889 - 44073869 44073909 41 TTGGGTGGAGTACGGACCACTGCCACCTTCTTGGGCTCCCG TTGGGTGGAGTACGGACCACCGCCACCTTCTTGGGCTCCCG Direct Gain 0 0.815310537815094 Functional Gain 0.815310537815094 MAPT ENSG00000186868 CDS Human protein_coding chr17:44073889 chr17:44073889 synonymous SNV . 0 21 hm5C_associated_SNPs_109694 3 25751624 Type 1 diabetes 8e-08 GWAS_Catalog TagSNP rs1052553 GCST005536 Fine mapping of type 1 diabetes susceptibility loci and evidence for colocalization of causal variants with lymphoid gene enhancers.
388 chr17 51901084 51901084 1 + A G rs3803825 51901084 - 51901064 51901104 41 GTGATGATATCCAGGTCCTTTAAGGTTGTCTCTCGCTGGTT GTGATGATATCCAGGTCCTTCAAGGTTGTCTCTCGCTGGTT Direct Gain 0 0.610753953456879 Functional Gain 0.610753953456879 KIF2B ENSG00000141200 CDS Human protein_coding chr17:51901084 chr17:51901084 synonymous SNV . 0 21 hm5C_associated_SNPs_109792 0 17634449 Coronary Artery Disease 0.0005573 Johnson and O'Donnell TagSNP rs3803825 . Genomewide association analysis of coronary artery disease.
389 chr17 58024275 58024275 1 + A G rs180515 58024275 - 58024255 58024295 41 ACGTTTATTTTTCCTGTGTCTGAAGTGTTCTATGTAATGAC ACGTTTATTTTTCCTGTGTCCGAAGTGTTCTATGTAATGAC Direct Gain 0 0.630329251289368 Functional Gain 0.630329251289368 RPS6KB1 ENSG00000108443 UTR3 Human protein_coding chr17:58024275 chr17:58024275 . . 0 21 hm5C_associated_SNPs_109842 0 21833088 Multiple sclerosis 9e-08 GWAS_Catalog TagSNP rs180515 GCST001198 Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis.
390 chr17 58024324 58024324 1 + A G rs1051424 58024324 - 58024304 58024344 41 ATTTTGCTTTAAGTTTTTTTTTGCACCATTGATTGATTTTT ATTTTGCTTTAAGTTTTTTTCTGCACCATTGATTGATTTTT Direct Gain 0 0.695957899093628 Functional Gain 0.695957899093628 RPS6KB1 ENSG00000108443 UTR3 Human protein_coding chr17:58024324 chr17:58024324 . . 0 21 hm5C_associated_SNPs_109843 0 23251661 Obesity-related traits 3e-06 GWAS_Catalog TagSNP rs1051424 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
391 chr17 66391232 66391232 1 + A G rs7342975 66391232 - 66391212 66391252 41 TGGGCCAGGGCTACCACAGTTGGAAAAATGTCCAGCACGCT TGGGCCAGGGCTACCACAGTCGGAAAAATGTCCAGCACGCT Direct Gain 0 0.923684120178223 Functional Gain 0.923684120178223 ARSG ENSG00000141337 CDS Human protein_coding chr17:66391232 chr17:66391232 synonymous SNV . 0 21 hm5C_associated_SNPs_109922 0 17554300 Multiple complex diseases 0.000131229 Johnson and O'Donnell TagSNP rs7342975 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
392 chr17 79612397 79612397 1 + A G rs6420484 79612397 - 79612377 79612417 41 TCTCACAGAGGGCGCCCAGGTAGCCAGCCAGGCTCACTGCG TCTCACAGAGGGCGCCCAGGCAGCCAGCCAGGCTCACTGCG Direct Gain 0 0.612357079982758 Functional Gain 0.612357079982758 TSPAN10 ENSG00000182612 CDS Human protein_coding chr17:79612397 chr17:79612397 nonsynonymous SNV 0.971 0 21 hm5C_associated_SNPs_110193 0 29808027 Spherical equivalent or myopia (age of diagnosis) 3e-09 GWAS_Catalog TagSNP rs6420484 GCST006291 Genome-wide association meta-analysis highlights light-induced signaling as a driver for refractive error.
393 chr17 79615572 79615572 1 + A G rs7405453 79615572 - 79615552 79615592 41 CTCGGAGGTGAGGGTCAGCTTCAGGATTTCCTCCGGCCCCG CTCGGAGGTGAGGGTCAGCTCCAGGATTTCCTCCGGCCCCG Direct Gain 0 0.605901122093201 Functional Gain 0.605901122093201 TSPAN10 ENSG00000182612 UTR3 Human protein_coding chr17:79615572 chr17:79615572 . . 0 21 hm5C_associated_SNPs_110196 0 29617998 Intraocular pressure 2e-13 GWAS_Catalog TagSNP rs7405453 GCST005580 Genome-Wide Association Analyses Identify New Loci Influencing Intraocular Pressure.
394 chr17 80685426 80685426 1 + A G rs1046875 80685426 - 80685406 80685446 41 GGAGAGCAGGGAGGAGGCAGTGGAAAGGTACCTATGAGCAG GGAGAGCAGGGAGGAGGCAGCGGAAAGGTACCTATGAGCAG Direct Gain 0 0.716934502124786 Functional Gain 0.716934502124786 FN3KRP ENSG00000141560 UTR3 Human protein_coding chr17:80685426 chr17:80685426 . . 0 21 hm5C_associated_SNPs_110229 0 24647736 Glycated hemoglobin levels 4e-17 GWAS_Catalog TagSNP rs1046875 GCST002390 Multiple nonglycemic genomic loci are newly associated with blood level of glycated hemoglobin in East Asians.
395 chr17 80853796 80853796 1 + A G rs4986131 80853796 - 80853776 80853816 41 TGTGATGATGAACAGGAGAGTGGGGCGACGGCTGGTCCCCC TGTGATGATGAACAGGAGAGCGGGGCGACGGCTGGTCCCCC Direct Gain 0 0.844029605388641 Functional Gain 0.844029605388641 TBCD ENSG00000141556 intronic Human protein_coding chr17:80853796 chr17:80853796 . . 0 21 hm5C_associated_SNPs_110235 0 17554300 Multiple complex diseases 0.000778119 Johnson and O'Donnell TagSNP rs4986131 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
396 chr18 33557466 33557466 1 + A G rs2276314 33557466 - 33557446 33557486 41 CTTCAGGCTGAGTTTACTTGTAGGAGTGGCAGGATTGCTCT CTTCAGGCTGAGTTTACTTGCAGGAGTGGCAGGATTGCTCT Direct Gain 0 0.86209762096405 Functional Gain 0.86209762096405 C18orf21 ENSG00000141428 CDS Human protein_coding chr18:33557466 chr18:33557466 nonsynonymous SNV 0.001 0 21 hm5C_associated_SNPs_110471 0 27506219 Endometriosis 7e-06 GWAS_Catalog TagSNP rs2276314 GCST003819 Pooling-Based Genome-Wide Association Study Identifies Risk Loci in the Pathogenesis of Ovarian Endometrioma in Chinese Han Women.
397 chr18 66513615 66513615 1 + A G rs2187094 66513615 - 66513595 66513635 41 ATTCTTTCAGTTCTTCATACTTCCACTTCCACAGAGACAAA ATTCTTTCAGTTCTTCATACCTCCACTTCCACAGAGACAAA Direct Gain 0 0.707040190696716 Functional Gain 0.707040190696716 CCDC102B ENSG00000150636 CDS Human protein_coding chr18:66513615 chr18:66513615 nonsynonymous SNV 0.997 1 21 hm5C_associated_SNPs_110624 0 17641165 HIV-1 disease progression 0.00015 Johnson and O'Donnell TagSNP rs2187094 . A whole-genome association study of major determinants for host control of HIV-1.
398 chr19 3179517 3179517 1 + C G rs61731111 3179517 - 3179497 3179537 41 CAGGCGGCGGGCCTTGCGGCGGGCCGCTGGGCGTGGGGCCT CAGGCGGCGGGCCTTGCGGCCGGCCGCTGGGCGTGGGGCCT Direct Gain 0 0.600794076919556 Functional Gain 0.600794076919556 S1PR4 ENSG00000125910 CDS Human protein_coding chr19:3179517 chr19:3179517 nonsynonymous SNV 0.933 1 21 hm5C_associated_SNPs_110846 0 27863252 Eosinophil percentage of granulocytes 1e-18 GWAS_Catalog TagSNP rs61731111 GCST004617 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
399 chr19 4493708 4493708 1 + A G rs892161 4493708 - 4493688 4493728 41 GAGTCGGAGTCGGAGGCTGATGGCGCCTTCTGGGGAGAAGC GAGTCGGAGTCGGAGGCTGACGGCGCCTTCTGGGGAGAAGC Direct Gain 0 0.81315279006958 Functional Gain 0.81315279006958 HDGFL2 ENSG00000167674 CDS Human protein_coding chr19:4493708 chr19:4493708 synonymous SNV . 0 21 hm5C_associated_SNPs_110895 0 30275531 LDL cholesterol 5e-08 GWAS_Catalog TagSNP rs892161 GCST006612 Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program.
400 chr19 10395683 10395683 1 + A G rs5498 10395683 - 10395663 10395703 41 GAGCACATTCACGGTCACCTTGCGGGTGACCTCCCCTTGAG GAGCACATTCACGGTCACCTCGCGGGTGACCTCCCCTTGAG Direct Gain 0 0.920810103416443 Functional Gain 0.920810103416443 ICAM1 ENSG00000090339 CDS Human protein_coding chr19:10395683 chr19:10395683 nonsynonymous SNV 0.000 0 21 hm5C_associated_SNPs_111031 0 28240269 Blood protein levels 8e-267 GWAS_Catalog TagSNP rs5498 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
401 chr19 11233941 11233941 1 + A G rs5927 11233941 - 11233921 11233961 41 CGGGAGGTGTCGGGAACAGGTCGGGTGGTTGTGTGCTGTGT CGGGAGGTGTCGGGAACAGGCCGGGTGGTTGTGTGCTGTGT Direct Gain 0 0.815237522125244 Functional Gain 0.815237522125244 LDLR ENSG00000130164 CDS Human protein_coding chr19:11233941 chr19:11233941 synonymous SNV . 0 21 hm5C_associated_SNPs_111063 2 28843169 Cortisol levels (saliva) 9e-06 GWAS_Catalog TagSNP rs5927 GCST004780 The low single nucleotide polymorphism heritability of plasma and saliva cortisol levels.
402 chr19 16211630 16211630 1 + A G rs59508494 16211630 - 16211610 16211650 41 AGAGAGAAAGTACTTTTTTTTTGAGACAGGGTCTCACTCTG AGAGAGAAAGTACTTTTTTTCTGAGACAGGGTCTCACTCTG Direct Gain 0 0.744230508804321 Functional Gain 0.744230508804321 TPM4 ENSG00000167460 intronic Human protein_coding chr19:16211630 chr19:16211630 . . 0 21 hm5C_associated_SNPs_111182 0 27863252 Mean platelet volume 1e-67 GWAS_Catalog TagSNP rs59508494 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
403 chr19 18304700 18304700 1 + A G rs874628 18304700 - 18304680 18304720 41 GTAGTGCAGGAAGGGACCCATGCTGCAGCCCACCGCAAACA GTAGTGCAGGAAGGGACCCACGCTGCAGCCCACCGCAAACA Direct Gain 0 0.52281665802002 Functional Gain 0.52281665802002 MPV17L2 ENSG00000254858 CDS Human protein_coding chr19:18304700 chr19:18304700 nonsynonymous SNV 1.000 2 21 hm5C_associated_SNPs_111244 0 21833088 Multiple sclerosis 1e-08 GWAS_Catalog TagSNP rs874628 GCST001198 Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis.
404 chr19 49869051 49869051 1 + T G rs2303759 49869051 - 49869031 49869071 41 CTCCTGTCTTGTTGTCGGTCATCTGTGAGGATCCGATGAGA CTCCTGTCTTGTTGTCGGTCCTCTGTGAGGATCCGATGAGA Direct Gain 0 0.674600720405579 Functional Gain 0.674600720405579 DKKL1 ENSG00000104901 CDS Human protein_coding chr19:49869051 chr19:49869051 nonsynonymous SNV 0.902 1 21 hm5C_associated_SNPs_111871 0 21833088 Multiple sclerosis 5e-09 GWAS_Catalog TagSNP rs2303759 GCST001198 Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis.
405 chr19 51628529 51628529 1 + A G rs2075803 51628529 - 51628509 51628549 41 GATGCTCAGGGTGCAATTCTTGGTATGTGGGTCCCCAAGGA GATGCTCAGGGTGCAATTCTCGGTATGTGGGTCCCCAAGGA Direct Gain 0 0.904226958751678 Functional Gain 0.904226958751678 SIGLEC9 ENSG00000129450 CDS Human protein_coding chr19:51628529 chr19:51628529 nonsynonymous SNV 0.004 0 21 hm5C_associated_SNPs_111956 0 28240269 Blood protein levels 7e-122 GWAS_Catalog TagSNP rs2075803 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
406 chr20 33764554 33764554 1 + A G rs867186 33764554 - 33764534 33764574 41 CACACCAGCAATGATGAAACTGCCCACCAGGACGCCCAGGA CACACCAGCAATGATGAAACCGCCCACCAGGACGCCCAGGA Direct Gain 0 0.67915940284729 Functional Gain 0.67915940284729 PROCR ENSG00000101000 CDS Human protein_coding chr20:33764554 chr20:33764554 nonsynonymous SNV 0.984 1 21 hm5C_associated_SNPs_112575 0 20802025 Protein C levels 2e-200 GWAS_Catalog TagSNP rs867186 GCST000780 Genome-wide association study identifies novel loci for plasma levels of protein C: the ARIC study.
407 chr20 34501092 34501092 1 + A G rs17093238 34501092 - 34501072 34501112 41 ATTCTTCTCCTAAGCAAGCATGTCCGATGGGTCTGGCTCTG ATTCTTCTCCTAAGCAAGCACGTCCGATGGGTCTGGCTCTG Direct Gain 0 0.548087894916534 Functional Gain 0.548087894916534 PHF20 ENSG00000025293 intronic Human protein_coding chr20:34501092 chr20:34501092 . . 0 21 hm5C_associated_SNPs_112588 0 27846195 Response to paliperidone in schizophrenia (PANSS score) 2e-06 GWAS_Catalog TagSNP rs17093238 GCST004042 Genome-wide association study of paliperidone efficacy.
408 chr20 36997655 36997655 1 + C G rs2232613 36997655 - 36997635 36997675 41 GGAGTTCCAGGTTCATGTTGGGGTAGAGCCTGGCTAACTGG GGAGTTCCAGGTTCATGTTGCGGTAGAGCCTGGCTAACTGG Direct Gain 0 0.828223466873169 Functional Gain 0.828223466873169 LBP ENSG00000129988 CDS Human protein_coding chr20:36997655 chr20:36997655 nonsynonymous SNV 0.971 4 21 hm5C_associated_SNPs_112629 0 29875488 Blood protein levels 4e-33 GWAS_Catalog TagSNP rs2232613 GCST005806 Genomic atlas of the human plasma proteome.
409 chr20 42839620 42839620 1 + A G rs4142441 42839620 - 42839600 42839640 41 AAGAATAACAGGAAATTACGTAAGGCGCACGTGCTTCTGAG AAGAATAACAGGAAATTACGCAAGGCGCACGTGCTTCTGAG Direct Gain 0 0.883982062339783 Functional Gain 0.883982062339783 OSER1-AS1 ENSG00000223891 ncRNA_exonic Human lincRNA chr20:42839620 chr20:42839620 . . 0 21 hm5C_associated_SNPs_112670 0 27863252 Monocyte count 4e-11 GWAS_Catalog TagSNP rs4142441 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
410 chr20 48507912 48507912 1 + A G rs13433386 48507912 - 48507892 48507932 41 GTGAGATGGAGGGCGTGAAATGGAGGGCGTTAGACAGAGGA GTGAGATGGAGGGCGTGAAACGGAGGGCGTTAGACAGAGGA Direct Gain 0 0.886090636253357 Functional Gain 0.886090636253357 SLC9A8 ENSG00000197818 UTR3 Human protein_coding chr20:48507912 chr20:48507912 . . 0 21 hm5C_associated_SNPs_112780 0 17554300 Multiple complex diseases 0.000384907 Johnson and O'Donnell TagSNP rs13433386 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
411 chr21 34640788 34640788 1 + A G rs2834167 34640788 - 34640768 34640808 41 TGTGAAAGTCAGGTTCCCTTTGGCAAAAGCAGGTGACTCCC TGTGAAAGTCAGGTTCCCTTCGGCAAAAGCAGGTGACTCCC Direct Gain 0 0.957489490509033 Functional Gain 0.957489490509033 IL10RB ENSG00000243646;ENSG00000249624 CDS Human other chr21:34640788 chr21:34640788 nonsynonymous SNV 0.985 0 21 hm5C_associated_SNPs_113047 3 30072576 Blood protein levels 1e-08 GWAS_Catalog TagSNP rs2834167 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
412 chr21 34787312 34787312 1 + A G rs9808753 34787312 - 34787292 34787332 41 CTTACTATTTAAACTGCACTTGGTAGACAACAGGCCTCGTG CTTACTATTTAAACTGCACTCGGTAGACAACAGGCCTCGTG Direct Gain 0 0.693625688552856 Functional Gain 0.693625688552856 IFNGR2 ENSG00000159128 CDS Human protein_coding chr21:34787312 chr21:34787312 nonsynonymous SNV 0.171 0 21 hm5C_associated_SNPs_113051 0 24076602 Multiple sclerosis 1e-07 GWAS_Catalog TagSNP rs9808753 GCST005531 Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis.
413 chr21 42718262 42718262 1 + C G rs57529409 42718262 - 42718242 42718282 41 GTGTCCTTCTTATTGGGTGGGTGCAGGCGTTTTCTATTCTT GTGTCCTTCTTATTGGGTGGCTGCAGGCGTTTTCTATTCTT Direct Gain 0 0.563451111316681 Functional Gain 0.563451111316681 FAM3B ENSG00000183844 intronic Human protein_coding chr21:42718262 chr21:42718262 . . 0 21 hm5C_associated_SNPs_113109 0 29875488 Blood protein levels 2e-52 GWAS_Catalog TagSNP rs57529409 GCST005806 Genomic atlas of the human plasma proteome.
414 chr21 45404338 45404338 1 + A G rs7435 45404338 - 45404318 45404358 41 ACTTCTATGGGAAACAATAATAATTAAATCATAAAAGATCT ACTTCTATGGGAAACAATAACAATTAAATCATAAAAGATCT Direct Gain 0 0.719859540462494 Functional Gain 0.719859540462494 AGPAT3 ENSG00000160216 UTR3 Human protein_coding chr21:45404338 chr21:45404338 . . 0 21 hm5C_associated_SNPs_113169 0 21829377 Plasma omega-3 polyunsaturated fatty acid levels (docosapentaenoic acid) 2e-07 GWAS_Catalog TagSNP rs7435 GCST001179 Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium.
415 chr22 17309881 17309881 1 + A G rs16981741 17309881 - 17309861 17309901 41 AGGGAGATATGATGTAGTATTGAGAAGCTGTGGTTGTAACA AGGGAGATATGATGTAGTATCGAGAAGCTGTGGTTGTAACA Direct Gain 0 0.826882004737854 Functional Gain 0.826882004737854 HSFY1P1 ENSG00000229027 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr22:17309881 chr22:17309881 . . 0 21 hm5C_associated_SNPs_113288 0 17554300 Multiple complex diseases 0.000621239 Johnson and O'Donnell TagSNP rs16981741 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
416 chr22 24582041 24582041 1 + A G rs8141797 24582041 - 24582021 24582061 41 GCACGTACTCTCCGCGCCCATTGAATGTGAAGTTGGTGCCG GCACGTACTCTCCGCGCCCACTGAATGTGAAGTTGGTGCCG Direct Gain 0 0.664506077766418 Functional Gain 0.664506077766418 SUSD2 ENSG00000099994 CDS Human protein_coding chr22:24582041 chr22:24582041 nonsynonymous SNV 0.070 0 21 hm5C_associated_SNPs_113478 0 23624525 Amyotrophic lateral sclerosis 2e-09 GWAS_Catalog TagSNP rs8141797 GCST001981 Genome-wide association analyses in Han Chinese identify two new susceptibility loci for amyotrophic lateral sclerosis.
417 chr22 27066535 27066535 1 + A G rs7985 27066535 - 27066515 27066555 41 GACATTTCCTAGAAGTTACTTTAAGAATTTCCCTAGAGGGT GACATTTCCTAGAAGTTACTCTAAGAATTTCCCTAGAGGGT Direct Gain 0 0.549760103225708 Functional Gain 0.549760103225708 MIAT ENSG00000225783 ncRNA_exonic Human lincRNA chr22:27066535 chr22:27066535 . . 0 21 hm5C_associated_SNPs_113529 0 25387704 Electroencephalogram traits 3e-06 GWAS_Catalog TagSNP rs7985 GCST002709 Heritability and molecular-genetic basis of resting EEG activity: a genome-wide association study.
418 chr22 39770597 39770597 1 + A G rs4821888 39770597 - 39770577 39770617 41 ATGGCCGGGACAGCCCTCTGTAGACTCTGTGCAGGGGGTAC ATGGCCGGGACAGCCCTCTGCAGACTCTGTGCAGGGGGTAC Direct Gain 0 0.571966230869293 Functional Gain 0.571966230869293 SYNGR1 ENSG00000100321 CDS Human protein_coding chr22:39770597 chr22:39770597 nonsynonymous SNV . 0 21 hm5C_associated_SNPs_113756 0 29942086 Intelligence 4e-08 GWAS_Catalog TagSNP rs4821888 GCST006250 Genome-wide association meta-analysis in 269,867 individuals identifies new genetic and functional links to intelligence.
419 chrX 25014784 25014784 1 + A G rs11573534 25014784 - 25014764 25014804 41 TACACATGTTAATGGATTGTTAGAGTATCAAATTATTTTCA TACACATGTTAATGGATTGTCAGAGTATCAAATTATTTTCA Direct Gain 0 0.776110649108887 Functional Gain 0.776110649108887 POLA1 ENSG00000101868 UTR3 Human protein_coding chrX:25014784 chrX:25014784 . . 0 21 hm5C_associated_SNPs_114103 0 16252231 Parkinson's disease 0.00078045 Johnson and O'Donnell TagSNP rs11573534 . High-resolution whole-genome association study of Parkinson disease.