1 chr6 26569135 26569135 1 + T A rs36162392 26569135 + 26569115 26569155 41 GACTGTAGTTGGCTGTGTCCTTAGACATCCTTAGGTCGCTG GACTGTAGTTGGCTGTGTCCATAGACATCCTTAGGTCGCTG Direct Loss 1 0 Functional Loss -1 LOC105374988 ENSG00000182952;ENSG00000146109 intergenic Human other chr6:26569135 chr6:26569135 . . 0 21 hm5U_associated_SNPs_1 0 28604730 Lung cancer in ever smokers 6e-07 GWAS_Catalog TagSNP rs36162392 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
2 chr1 2491205 2491205 1 + C T rs2234161 2491205 + 2491185 2491225 41 CTGTGGATGCTGTCCTGGCCCGTGGATGGTGTCCCGGCCTC CTGTGGATGCTGTCCTGGCCTGTGGATGGTGTCCCGGCCTC Direct Gain 0 0.799203395843506 Functional Gain 0.799203395843506 TNFRSF14 ENSG00000157873 intronic Human protein_coding chr1:2491205 chr1:2491205 . . 0 21 hm5U_associated_SNPs_318 1 26974007 Chronic inflammatory diseases (ankylosing spondylitis, Crohn's disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy) 2e-11 GWAS_Catalog TagSNP rs2234161 GCST005537 Analysis of five chronic inflammatory diseases identifies 27 new associations and highlights disease-specific patterns at shared loci.
3 chr1 11839923 11839923 1 + C T rs12561919 11839923 + 11839903 11839943 41 GGAGAGAGCTGGCTTCCCACCGGGCCTGGGATCGGACCTGC GGAGAGAGCTGGCTTCCCACTGGGCCTGGGATCGGACCTGC Direct Gain 0 0.629016280174255 Functional Gain 0.629016280174255 C1orf167 ENSG00000215910 CDS Human protein_coding chr1:11839923 chr1:11839923 nonsynonymous SNV 0.169 0 21 hm5U_associated_SNPs_599 0 27922604 Schizophrenia 2e-07 GWAS_Catalog TagSNP rs12561919 GCST003880 Common variants on 2p16.1, 6p22.1 and 10q24.32 are associated with schizophrenia in Han Chinese population.
4 chr1 16071010 16071010 1 + C T rs59905655 16071010 + 16070990 16071030 41 CCAGGACTTCCTGACCACCTCGGAGGCCATGCGGTTCTGGA CCAGGACTTCCTGACCACCTTGGAGGCCATGCGGTTCTGGA Direct Gain 0 0.731338500976562 Functional Gain 0.731338500976562 TMEM82 ENSG00000162460 CDS Human protein_coding chr1:16071010 chr1:16071010 nonsynonymous SNV 0.975 4 21 hm5U_associated_SNPs_730 0 23251661 Obesity-related traits 2e-06 GWAS_Catalog TagSNP rs59905655 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
5 chr1 17601165 17601165 1 + C T rs11585357 17601165 + 17601145 17601185 41 TACGTGACTCGGGAACCACGCGACAGGTCTGTGAGTGGCCT TACGTGACTCGGGAACCACGTGACAGGTCTGTGAGTGGCCT Direct Gain 0 0.583445012569427 Functional Gain 0.583445012569427 PADI3 ENSG00000142619 CDS Human protein_coding chr1:17601165 chr1:17601165 synonymous SNV . 0 21 hm5U_associated_SNPs_800 0 29220522 Hair shape 4e-18 GWAS_Catalog TagSNP rs11585357 GCST005191 Meta-analysis of genome-wide association studies identifies 8 novel loci involved in shape variation of human head hair.
6 chr1 31837632 31837632 1 + C T rs17495262 31837632 + 31837612 31837652 41 CAGTCTGCAGTGTGACTTAACTTGTGTATTGCATTCCAGCA CAGTCTGCAGTGTGACTTAATTTGTGTATTGCATTCCAGCA Direct Gain 0 0.623762369155884 Functional Gain 0.623762369155884 ZCCHC17 ENSG00000121766 UTR3 Human protein_coding chr1:31837632 chr1:31837632 . . 0 21 hm5U_associated_SNPs_1157 0 17554300 Multiple complex diseases 0.000263402 Johnson and O'Donnell TagSNP rs17495262 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
7 chr1 53550640 53550640 1 + C T rs41294750 53550640 + 53550620 53550660 41 TTGCCCCAGCCAGAATCAGCCATAGCAGCTCGCCGTCTGCC TTGCCCCAGCCAGAATCAGCTATAGCAGCTCGCCGTCTGCC Direct Gain 0 0.701340615749359 Functional Gain 0.701340615749359 PODN ENSG00000232993 ncRNA_intronic Human antisense chr1:53550640 chr1:53550640 . . 0 21 hm5U_associated_SNPs_1553 0 27989323 Interleukin-9 levels 2e-06 GWAS_Catalog TagSNP rs41294750 GCST004450 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
8 chr1 55505447 55505447 1 + C T rs45448095 55505447 + 55505427 55505467 41 CGCAAGGCTCAAGGCGCCGCCGGCGTGGACCGCGCACGGCC CGCAAGGCTCAAGGCGCCGCTGGCGTGGACCGCGCACGGCC Direct Gain 0 0.82462751865387 Functional Gain 0.82462751865387 PCSK9 ENSG00000169174 UTR5 Human protein_coding chr1:55505447 chr1:55505447 . . 0 21 hm5U_associated_SNPs_1604 2 29748315 Plasma proprotein convertase subtilisin/kexin type 9 levels in stable coronary artery disease 4e-12 GWAS_Catalog TagSNP rs45448095 GCST006284 Genetic Regulation of PCSK9 (Proprotein Convertase Subtilisin/Kexin Type 9) Plasma Levels and Its Impact on Atherosclerotic Vascular Disease Phenotypes.
9 chr1 109817590 109817590 1 + G T rs12740374 109817590 + 109817570 109817610 41 CTGGCTCGGCTGCCCTGAGGGTGCTCAATCAAGCACAGGTT CTGGCTCGGCTGCCCTGAGGTTGCTCAATCAAGCACAGGTT Direct Gain 0 0.813239634037018 Functional Gain 0.813239634037018 CELSR2 ENSG00000143126 UTR3 Human protein_coding chr1:109817590 chr1:109817590 . . 0 21 hm5U_associated_SNPs_1804 1 28753643 Lipoprotein phospholipase A2 activity in cardiovascular disease 4e-39 GWAS_Catalog TagSNP rs12740374 GCST004963 Pharmacogenetic meta-analysis of baseline risk factors, pharmacodynamic, efficacy and tolerability endpoints from two large global cardiovascular outcomes trials for darapladib.
10 chr1 113231503 113231503 1 + G T rs12129649 113231503 + 113231483 113231523 41 CCTTTCCCACCCGCCGCCCTGCCTCCCTCGAGCCCTGCCTT CCTTTCCCACCCGCCGCCCTTCCTCCCTCGAGCCCTGCCTT Direct Gain 0 0.605118274688721 Functional Gain 0.605118274688721 MOV10 ENSG00000155363 UTR5 Human protein_coding chr1:113231503 chr1:113231503 . . 0 21 hm5U_associated_SNPs_1910 0 28739976 Diastolic blood pressure 1e-10 GWAS_Catalog TagSNP rs12129649 GCST004777 Novel Blood Pressure Locus and Gene Discovery Using Genome-Wide Association Study and Expression Data Sets From Blood and the Kidney.
11 chr1 114448389 114448389 1 + C T rs11552449 114448389 + 114448369 114448409 41 CAGCCCACCTCTTGCATCGTCACCTACAGGTATGGGGCTGG CAGCCCACCTCTTGCATCGTTACCTACAGGTATGGGGCTGG Direct Gain 0 0.873629331588745 Functional Gain 0.873629331588745 DCLRE1B ENSG00000118655 CDS Human protein_coding chr1:114448389 chr1:114448389 nonsynonymous SNV 0.233 0 21 hm5U_associated_SNPs_1924 0 23535729 Breast cancer 2e-08 GWAS_Catalog TagSNP rs11552449 GCST001937 Large-scale genotyping identifies 41 new loci associated with breast cancer risk.
12 chr1 150234657 150234657 1 + G T rs34714364 150234657 + 150234637 150234677 41 GGTCAGAAAGGATCCCCAGGGGGGTCAGAACACCAGATCAA GGTCAGAAAGGATCCCCAGGTGGGTCAGAACACCAGATCAA Direct Gain 0 0.556926250457764 Functional Gain 0.556926250457764 CA14 ENSG00000118298 CDS Human protein_coding chr1:150234657 chr1:150234657 synonymous SNV . 0 21 hm5U_associated_SNPs_2038 0 26835600 Morning vs. evening chronotype 2e-10 GWAS_Catalog TagSNP rs34714364 GCST003429 GWAS of 89,283 individuals identifies genetic variants associated with self-reporting of being a morning person.
13 chr1 155178782 155178782 1 + A T rs760077 155178782 + 155178762 155178802 41 CTTGGACGAGGCGCCGTGACACTCCGAGGCGCGCCGGGCCG CTTGGACGAGGCGCCGTGACTCTCCGAGGCGCGCCGGGCCG Direct Gain 0 0.953915417194366 Functional Gain 0.953915417194366 MTX1 ENSG00000173171 CDS Human protein_coding chr1:155178782 chr1:155178782 nonsynonymous SNV . 0 21 hm5U_associated_SNPs_2197 0 27863252 Hematocrit 2e-23 GWAS_Catalog TagSNP rs760077 GCST004604 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
14 chr1 156084487 156084487 1 + C T rs188625872 156084487 + 156084467 156084507 41 ACCTATTAGAGCCTTTGCCCCGGCGTCGGTGACTCAGTGTT ACCTATTAGAGCCTTTGCCCTGGCGTCGGTGACTCAGTGTT Direct Gain 0 0.610178351402283 Functional Gain 0.610178351402283 LMNA ENSG00000160789 UTR5 Human protein_coding chr1:156084487 chr1:156084487 . . 0 21 hm5U_associated_SNPs_2226 0 30557369 Ovarian cancer 2e-06 GWAS_Catalog TagSNP rs188625872 GCST007239 Genome-wide association study (GWAS) of ovarian cancer in Japanese predicted regulatory variants in 22q13.1.
15 chr1 156878473 156878473 1 + C T rs77795865 156878473 + 156878453 156878493 41 CCCGATGAACGGGGAGTGCTCCTGCCTGCCGGGCTGGGCGG CCCGATGAACGGGGAGTGCTTCTGCCTGCCGGGCTGGGCGG Direct Gain 0 0.614414036273956 Functional Gain 0.614414036273956 PEAR1 ENSG00000187800 CDS Human protein_coding chr1:156878473 chr1:156878473 nonsynonymous SNV 0.997 2 21 hm5U_associated_SNPs_2273 0 27863252 Mean platelet volume 2e-09 GWAS_Catalog TagSNP rs77795865 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
16 chr1 176812896 176812896 1 + C T rs1883431 176812896 + 176812876 176812916 41 TGGAAGTGATCAGGGAGACTCGGTCCTTGTTCCAAGTCTCC TGGAAGTGATCAGGGAGACTTGGTCCTTGTTCCAAGTCTCC Direct Gain 0 0.766147255897522 Functional Gain 0.766147255897522 PAPPA2 ENSG00000116183 UTR3 Human protein_coding chr1:176812896 chr1:176812896 . . 0 21 hm5U_associated_SNPs_2459 0 17463246 Multiple continuous traits in DGI samples 0.0002385 Johnson and O'Donnell TagSNP rs1883431 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
17 chr1 180905694 180905694 1 + C T rs3795503 180905694 + 180905674 180905714 41 TCCACCAACAACTGCAACAACAGCGCACCTCGGGGGCTGCA TCCACCAACAACTGCAACAATAGCGCACCTCGGGGGCTGCA Direct Gain 0 0.90209686756134 Functional Gain 0.90209686756134 KIAA1614 ENSG00000135835 CDS Human protein_coding chr1:180905694 chr1:180905694 synonymous SNV . 0 21 hm5U_associated_SNPs_2526 0 31015462 Estimated glomerular filtration rate 8e-13 GWAS_Catalog TagSNP rs3795503 GCST007876 Sex-specific and pleiotropic effects underlying kidney function identified from GWAS meta-analysis.
18 chr1 204967186 204967186 1 + A T rs35068223 204967186 + 204967166 204967206 41 CACATTCCCCAAGCCCTCAAATGCAGGCATGGAGGGAAAAT CACATTCCCCAAGCCCTCAATTGCAGGCATGGAGGGAAAAT Direct Gain 0 0.600168704986572 Functional Gain 0.600168704986572 NFASC ENSG00000163531 intronic Human protein_coding chr1:204967186 chr1:204967186 . . 0 21 hm5U_associated_SNPs_2729 0 30643258 Number of sexual partners 3e-09 GWAS_Catalog TagSNP rs35068223 GCST007326 Genome-wide association analyses of risk tolerance and risky behaviors in over 1 million individuals identify hundreds of loci and shared genetic influences.
19 chr1 230416399 230416399 1 + G T rs1043897 230416399 + 230416379 230416419 41 CAGGCCTGGCTCACAGTCCTGCACACCTGCTGGCCTGGGGA CAGGCCTGGCTCACAGTCCTTCACACCTGCTGGCCTGGGGA Direct Gain 0 0.502520322799683 Functional Gain 0.502520322799683 GALNT2 ENSG00000224407 ncRNA_exonic Human antisense chr1:230416399 chr1:230416399 . . 0 21 hm5U_associated_SNPs_3082 0 30595370 Red cell distribution width 3e-09 GWAS_Catalog TagSNP rs1043897 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
20 chr2 272203 272203 1 + C T rs11553746 272203 + 272183 272223 41 GTGTTTCAGTGGGTCATTGACAGCGGTGCTGTTTCTGACTG GTGTTTCAGTGGGTCATTGATAGCGGTGCTGTTTCTGACTG Direct Gain 0 0.930557310581207 Functional Gain 0.930557310581207 ACP1 ENSG00000143727 CDS Human protein_coding chr2:272203 chr2:272203 nonsynonymous SNV 1.000 2 21 hm5U_associated_SNPs_3242 0 28240269 Blood protein levels 1e-257 GWAS_Catalog TagSNP rs11553746 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
21 chr2 3642756 3642756 1 + C T rs77246730 3642756 + 3642736 3642776 41 CCGTTCGCCTAGCGCGTGCTCAGGTAGGAGACTCTGCCCGG CCGTTCGCCTAGCGCGTGCTTAGGTAGGAGACTCTGCCCGG Direct Gain 0 0.963990330696106 Functional Gain 0.963990330696106 COLEC11 ENSG00000118004 UTR5 Human protein_coding chr2:3642756 chr2:3642756 . . 0 21 hm5U_associated_SNPs_3268 0 29875488 Blood protein levels 3e-42 GWAS_Catalog TagSNP rs77246730 GCST005806 Genomic atlas of the human plasma proteome.
22 chr2 26930411 26930411 1 + C T rs1731243 26930411 + 26930391 26930431 41 GGATCTTCTCAGGGTCAGGGCTTAGCCCTGGGGGTCTCCAC GGATCTTCTCAGGGTCAGGGTTTAGCCCTGGGGGTCTCCAC Direct Gain 0 0.899884343147278 Functional Gain 0.899884343147278 KCNK3 ENSG00000171303 intronic Human protein_coding chr2:26930411 chr2:26930411 . . 0 21 hm5U_associated_SNPs_3435 0 29912962 Diastolic blood pressure x alcohol consumption interaction (2df test) 1e-23 GWAS_Catalog TagSNP rs1731243 GCST006166 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
23 chr2 70488470 70488470 1 + C T rs2706762 70488470 + 70488450 70488490 41 TTGGCGCTATGGATTTCAATCCCTCCGTATGCACATGTGGG TTGGCGCTATGGATTTCAATTCCTCCGTATGCACATGTGGG Direct Gain 0 0.587639987468719 Functional Gain 0.587639987468719 PCYOX1 ENSG00000116005 CDS Human protein_coding chr2:70488470 chr2:70488470 nonsynonymous SNV 0.979 0 21 hm5U_associated_SNPs_3729 0 30038396 Educational attainment (MTAG) 3e-09 GWAS_Catalog TagSNP rs2706762 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
24 chr2 73829372 73829372 1 + C T rs1052162 73829372 + 73829352 73829392 41 CTGGGGAGCGGATAAAGCGCCTGAAGTTAATAGTCCAGGAG CTGGGGAGCGGATAAAGCGCTTGAAGTTAATAGTCCAGGAG Direct Gain 0 0.64672315120697 Functional Gain 0.64672315120697 ALMS1 ENSG00000116127 CDS Human protein_coding chr2:73829372 chr2:73829372 synonymous SNV . 0 21 hm5U_associated_SNPs_3782 1 23093944 Serum metabolite levels 1e-54 GWAS_Catalog TagSNP rs1052162 GCST006249 Mining the unknown: a systems approach to metabolite identification combining genetic and metabolic information.
25 chr2 87002229 87002229 1 + C T rs1193 87002229 + 87002209 87002249 41 ACCTCAGTCTGGCCCCATAGCGACTTTTGCCCCATGATTCT ACCTCAGTCTGGCCCCATAGTGACTTTTGCCCCATGATTCT Direct Gain 0 0.538851857185364 Functional Gain 0.538851857185364 RMND5A ENSG00000153561 UTR3 Human protein_coding chr2:87002229 chr2:87002229 . . 0 21 hm5U_associated_SNPs_3884 0 27863252 Immature fraction of reticulocytes 1e-09 GWAS_Catalog TagSNP rs1193 GCST004628 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
26 chr2 113890373 113890373 1 + C T rs4252023 113890373 + 113890353 113890393 41 TGCACAGCGATGGAAGCTGACCAGCCCGTCAGCCTCACCAA TGCACAGCGATGGAAGCTGATCAGCCCGTCAGCCTCACCAA Direct Gain 0 0.887285590171814 Functional Gain 0.887285590171814 IL1RN ENSG00000136689 CDS Human protein_coding chr2:113890373 chr2:113890373 synonymous SNV . 0 21 hm5U_associated_SNPs_4084 1 23251661 Obesity-related traits 2e-06 GWAS_Catalog TagSNP rs4252023 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
27 chr2 120848049 120848049 1 + C T rs28930677 120848049 + 120848029 120848069 41 GCCCCGTCCAAAAGAGTTCTCATCGATCAGGATTTATTCGA GCCCCGTCCAAAAGAGTTCTTATCGATCAGGATTTATTCGA Direct Gain 0 0.94723254442215 Functional Gain 0.94723254442215 EPB41L5 ENSG00000115109 CDS Human protein_coding chr2:120848049 chr2:120848049 nonsynonymous SNV 0.998 1 21 hm5U_associated_SNPs_4133 0 30595370 Red blood cell count 1e-15 GWAS_Catalog TagSNP rs28930677 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
28 chr2 145833813 145833813 1 + C T rs1852682 145833813 + 145833793 145833833 41 TGATCCAGCAACGGAAAGATCATATCAGCACAGCAGGGAGA TGATCCAGCAACGGAAAGATTATATCAGCACAGCAGGGAGA Direct Gain 0 0.865121364593506 Functional Gain 0.865121364593506 TEX41 ENSG00000226674 ncRNA_exonic Human lincRNA chr2:145833813 chr2:145833813 . . 0 21 hm5U_associated_SNPs_4288 0 17554300 Multiple complex diseases 0.000434936 Johnson and O'Donnell TagSNP rs1852682 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
29 chr2 159954175 159954175 1 + C T rs34588551 159954175 + 159954155 159954195 41 ACTTTGGTCCAGAGACTTCTCCAGTCCTGCACCTTGACCAC ACTTTGGTCCAGAGACTTCTTCAGTCCTGCACCTTGACCAC Direct Gain 0 0.552688181400299 Functional Gain 0.552688181400299 TANC1 ENSG00000115183 CDS Human protein_coding chr2:159954175 chr2:159954175 nonsynonymous SNV 0.959 0 21 hm5U_associated_SNPs_4317 0 28869591 Heel bone mineral density 8e-06 GWAS_Catalog TagSNP rs34588551 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
30 chr2 234115629 234115629 1 + C T rs1057258 234115629 + 234115609 234115649 41 TACTTGGGACCCCAGTGCCTCGTTGAGGGCGCCATTCTGAA TACTTGGGACCCCAGTGCCTTGTTGAGGGCGCCATTCTGAA Direct Gain 0 0.642408311367035 Functional Gain 0.642408311367035 INPP5D ENSG00000168918 UTR3 Human protein_coding chr2:234115629 chr2:234115629 . . 0 21 hm5U_associated_SNPs_4856 0 27863252 Sum eosinophil basophil counts 2e-13 GWAS_Catalog TagSNP rs1057258 GCST004624 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
31 chr3 49751585 49751585 1 + C T rs2291542 49751585 + 49751565 49751605 41 CTGAAAACCAAACTTGAGGACGCCAATTTGCCCAGCCTCCA CTGAAAACCAAACTTGAGGATGCCAATTTGCCCAGCCTCCA Direct Gain 0 0.932090878486633 Functional Gain 0.932090878486633 RNF123 ENSG00000164068 CDS Human protein_coding chr3:49751585 chr3:49751585 synonymous SNV . 0 21 hm5U_associated_SNPs_5544 0 17554300 Multiple complex diseases 5.32e-05 Johnson and O'Donnell TagSNP rs2291542 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
32 chr3 127872506 127872506 1 + C T rs11711710 127872506 + 127872486 127872526 41 GGCATCACGCTCGATCTGGGCTTCTCGTGCTTCTCGGTGCC GGCATCACGCTCGATCTGGGTTTCTCGTGCTTCTCGGTGCC Direct Gain 0 0.976464867591858 Functional Gain 0.976464867591858 EEFSEC ENSG00000132394 CDS Human protein_coding chr3:127872506 chr3:127872506 synonymous SNV . 0 21 hm5U_associated_SNPs_5985 0 26634245 Post bronchodilator FEV1 3e-06 GWAS_Catalog TagSNP rs11711710 GCST003262 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
33 chr3 186338564 186338564 1 + C T rs35457250 186338564 + 186338544 186338584 41 ACCGGGCGCACTACGACCTGCGCCACACCTTCATGGGTGTG ACCGGGCGCACTACGACCTGTGCCACACCTTCATGGGTGTG Direct Gain 0 0.512041807174683 Functional Gain 0.512041807174683 AHSG ENSG00000145192 CDS Human protein_coding chr3:186338564 chr3:186338564 nonsynonymous SNV 0.289 3 21 hm5U_associated_SNPs_6327 0 29875488 Blood protein levels 1e-56 GWAS_Catalog TagSNP rs35457250 GCST005806 Genomic atlas of the human plasma proteome.
34 chr4 3446091 3446091 1 + G T rs3748034 3446091 + 3446071 3446111 41 TGGAGGGGGGCGACCGCTGGGCCCGCGTGCGCCAGGGCCAC TGGAGGGGGGCGACCGCTGGTCCCGCGTGCGCCAGGGCCAC Direct Gain 0 0.958732604980469 Functional Gain 0.958732604980469 HGFAC ENSG00000109758 CDS Human protein_coding chr4:3446091 chr4:3446091 nonsynonymous SNV 0.560 1 21 hm5U_associated_SNPs_6730 0 27989323 Hepatocyte growth factor levels 2e-10 GWAS_Catalog TagSNP rs3748034 GCST004449 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
35 chr4 37849004 37849004 1 + C T rs2290741 37849004 + 37848984 37849024 41 CAAAGATCCACAGTGAAACACGGTTTATTTTGCCTCTCCAG CAAAGATCCACAGTGAAACATGGTTTATTTTGCCTCTCCAG Direct Gain 0 0.682115435600281 Functional Gain 0.682115435600281 PGM2 ENSG00000169299 UTR3 Human protein_coding chr4:37849004 chr4:37849004 . . 0 21 hm5U_associated_SNPs_7003 0 17554300 Multiple complex diseases 0.000150749 Johnson and O'Donnell TagSNP rs2290741 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
36 chr4 71554974 71554974 1 + C T rs111485612 71554974 + 71554954 71554994 41 AGGCCTTTGCAAAACCAGTGCCTCAGGTAGATGAGGCTGAG AGGCCTTTGCAAAACCAGTGTCTCAGGTAGATGAGGCTGAG Direct Gain 0 0.812402069568634 Functional Gain 0.812402069568634 UTP3 ENSG00000132467 CDS Human protein_coding chr4:71554974 chr4:71554974 nonsynonymous SNV 0.827 0 21 hm5U_associated_SNPs_7117 0 29093273 Glucagon levels in response to oral glucose tolerance test (120 minutes) 7e-06 GWAS_Catalog TagSNP rs111485612 GCST005163 Genetic determinants of circulating GIP and GLP-1 concentrations.
37 chr4 155486381 155486381 1 + C T rs2227401 155486381 + 155486361 155486401 41 AAGCAACTTGCCCAAGGTCTCATAGCTGTAAGTCAACCCTA AAGCAACTTGCCCAAGGTCTTATAGCTGTAAGTCAACCCTA Direct Gain 0 0.660506010055542 Functional Gain 0.660506010055542 FGB ENSG00000171564 UTR3 Human protein_coding chr4:155486381 chr4:155486381 . . 0 21 hm5U_associated_SNPs_7411 0 28107422 Fibrinogen levels 5e-134 GWAS_Catalog TagSNP rs2227401 GCST004122 Comparison of HapMap and 1000 Genomes Reference Panels in a Large-Scale Genome-Wide Association Study.
38 chr5 14488128 14488128 1 + C T rs115054458 14488128 + 14488108 14488148 41 GAACTCGCCGCTCTCCAGCGCGGTCCCTTCTCTCGGCAAGG GAACTCGCCGCTCTCCAGCGTGGTCCCTTCTCTCGGCAAGG Direct Gain 0 0.59400999546051 Functional Gain 0.59400999546051 TRIO ENSG00000038382 CDS Human protein_coding chr5:14488128 chr5:14488128 nonsynonymous SNV 0.039 1 21 hm5U_associated_SNPs_7691 0 27777418 Major depressive disorder 3e-07 GWAS_Catalog TagSNP rs115054458 GCST005547 The PHF21B gene is associated with major depression and modulates the stress response.
39 chr5 56168712 56168712 1 + C T rs2229882 56168712 + 56168692 56168732 41 AGAGCTGCACAGCAGCAAACCGTACAGCAGCAGCCTTTGGC AGAGCTGCACAGCAGCAAACTGTACAGCAGCAGCCTTTGGC Direct Gain 0 0.542501449584961 Functional Gain 0.542501449584961 MAP3K1 ENSG00000095015 CDS Human protein_coding chr5:56168712 chr5:56168712 synonymous SNV . 0 21 hm5U_associated_SNPs_7827 0 24493630 Breast cancer (early onset) 1e-14 GWAS_Catalog TagSNP rs2229882 GCST002346 A genome-wide association study of early-onset breast cancer identifies PFKM as a novel breast cancer gene and supports a common genetic spectrum for breast cancer at any age.
40 chr5 109221026 109221026 1 + C T rs112724034 109221026 + 109221006 109221046 41 TGAGGCTCGGCCGCGTGCCCCACGCCCAGGCCGGCGCCTCG TGAGGCTCGGCCGCGTGCCCTACGCCCAGGCCGGCGCCTCG Direct Gain 0 0.971552610397339 Functional Gain 0.971552610397339 LINC01848 ENSG00000253224 ncRNA_exonic Human processed_pseudogene chr5:109221026 chr5:109221026 . . 0 21 hm5U_associated_SNPs_8003 0 23535033 Alzheimer's disease (cognitive decline) 9e-13 GWAS_Catalog TagSNP rs112724034 GCST001915 Genome-wide association study of the rate of cognitive decline in Alzheimer's disease.
41 chr5 131607721 131607721 1 + C T rs10479001 131607721 + 131607701 131607741 41 CTCGTTCCCCCCATCAGGGGCACCATCGTCAAGGCACGGGA CTCGTTCCCCCCATCAGGGGTACCATCGTCAAGGCACGGGA Direct Gain 0 0.92932403087616 Functional Gain 0.92932403087616 PDLIM4 ENSG00000131435 CDS Human protein_coding chr5:131607721 chr5:131607721 nonsynonymous SNV 0.989 0 21 hm5U_associated_SNPs_8078 0 28957414 Red cell distribution width 1e-08 GWAS_Catalog TagSNP rs10479001 GCST006804 Red blood cell distribution width: Genetic evidence for aging pathways in 116,666 volunteers.
42 chr5 134343661 134343661 1 + C T rs10044000 134343661 + 134343641 134343681 41 TTGCAGACGCTGATCACCGCCGTGGGGCAGACAGTCTACAC TTGCAGACGCTGATCACCGCTGTGGGGCAGACAGTCTACAC Direct Gain 0 0.780209183692932 Functional Gain 0.780209183692932 CATSPER3 ENSG00000152705 CDS Human protein_coding chr5:134343661 chr5:134343661 synonymous SNV . 0 21 hm5U_associated_SNPs_8139 0 28552196 Hip circumference adjusted for BMI 8e-06 GWAS_Catalog TagSNP rs10044000 GCST008156 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
43 chr5 153837106 153837106 1 + C T rs148763909 153837106 + 153837086 153837126 41 AAACCCCCTACTGAGCAGGGCGGCGGAGTGTCCAAAGGTCT AAACCCCCTACTGAGCAGGGTGGCGGAGTGTCCAAAGGTCT Direct Gain 0 0.851855456829071 Functional Gain 0.851855456829071 SAP30L ENSG00000164576 UTR3 Human protein_coding chr5:153837106 chr5:153837106 . . 0 21 hm5U_associated_SNPs_8599 0 23535033 Alzheimer's disease (cognitive decline) 1e-08 GWAS_Catalog TagSNP rs148763909 GCST001915 Genome-wide association study of the rate of cognitive decline in Alzheimer's disease.
44 chr5 169461547 169461547 1 + C T rs3763048 169461547 + 169461527 169461567 41 GACAACCGCATGAGCTGCACCGTGAACCTGCTGGTGCGTGG GACAACCGCATGAGCTGCACTGTGAACCTGCTGGTGCGTGG Direct Gain 0 0.634948790073395 Functional Gain 0.634948790073395 DOCK2 ENSG00000134516 CDS Human protein_coding chr5:169461547 chr5:169461547 synonymous SNV . 0 21 hm5U_associated_SNPs_8657 0 23382691 IgG glycosylation 9e-06 GWAS_Catalog TagSNP rs3763048 GCST001848 Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers.
45 chr6 12296255 12296255 1 + G T rs5370 12296255 + 12296235 12296275 41 GATCCCAAGCTGAAAGGCAAGCCCTCCAGAGAGCGTTATGT GATCCCAAGCTGAAAGGCAATCCCTCCAGAGAGCGTTATGT Direct Gain 0 0.858134031295776 Functional Gain 0.858134031295776 EDN1 ENSG00000078401 CDS Human protein_coding chr6:12296255 chr6:12296255 nonsynonymous SNV 0.026 1 21 hm5U_associated_SNPs_8996 1 23381795 Circulating vasoactive peptide levels 1e-27 GWAS_Catalog TagSNP rs5370 GCST001853 Genome-wide association study on plasma levels of midregional-proadrenomedullin and C-terminal-pro-endothelin-1.
46 chr6 28912399 28912399 1 + C T rs140736187 28912399 + 28912379 28912419 41 CAGTCTCATAATCTGAAGGTCCTGAGTTCGAACCTCAGAGG CAGTCTCATAATCTGAAGGTTCTGAGTTCGAACCTCAGAGG Direct Gain 0 0.988787889480591 Functional Gain 0.988787889480591 LINC01556 ENSG00000204709 downstream Human lincRNA chr6:28912399 chr6:28912399 . . 0 21 hm5U_associated_SNPs_9187 0 28928442 Tonsillectomy 2e-07 GWAS_Catalog TagSNP rs140736187 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
47 chr6 29364615 29364615 1 + G T rs9257834 29364615 + 29364595 29364635 41 ATGGAGCCGTTCTGATGATTGTCATCTCCGATCCTAGACTC ATGGAGCCGTTCTGATGATTTTCATCTCCGATCCTAGACTC Direct Gain 0 0.864493310451508 Functional Gain 0.864493310451508 OR12D2 ENSG00000168787 CDS Human other chr6:29364615 chr6:29364615 nonsynonymous SNV 0.005 3 21 hm5U_associated_SNPs_9192 0 17554300 Multiple complex diseases 5.48e-12 Johnson and O'Donnell TagSNP rs9257834 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
48 chr6 29911030 29911030 1 + C T rs9260151 29911030 + 29911010 29911050 41 TCGGGGGACTGGGCTGACCGCGGGGTCGGGGCCAGGTTCTC TCGGGGGACTGGGCTGACCGTGGGGTCGGGGCCAGGTTCTC Direct Gain 0 0.934472560882568 Functional Gain 0.934472560882568 HLA-A ENSG00000206503 intronic Human protein_coding chr6:29911030 chr6:29911030 . . 0 21 hm5U_associated_SNPs_9268 0 29404672 C-peptide levels in type I diabetes 8e-08 GWAS_Catalog TagSNP rs9260151 GCST005436 Meta-genome-wide association studies identify a locus on chromosome 1 and multiple variants in the MHC region for serum C-peptide in type 1 diabetes.
49 chr6 30876152 30876152 1 + C T rs1052693 30876152 + 30876132 30876172 41 TTAAGCGACGGCCCGAGACTCGGGGTGCGCGAGGAGGATCG TTAAGCGACGGCCCGAGACTTGGGGTGCGCGAGGAGGATCG Direct Gain 0 0.851880788803101 Functional Gain 0.851880788803101 GTF2H4 ENSG00000213780 UTR5 Human protein_coding chr6:30876152 chr6:30876152 . . 0 21 hm5U_associated_SNPs_9324 0 23028341 Complement C3 and C4 levels 3e-48 GWAS_Catalog TagSNP rs1052693 GCST001679 Genome-wide association study for serum complement C3 and C4 levels in healthy Chinese subjects.
50 chr6 30879636 30879636 1 + C T rs886420 30879636 + 30879616 30879656 41 GTGGGGTCTTGGGGCAGTAGCAGGAAGCAGTTGCCAGAACT GTGGGGTCTTGGGGCAGTAGTAGGAAGCAGTTGCCAGAACT Direct Gain 0 0.802618503570557 Functional Gain 0.802618503570557 GTF2H4 ENSG00000213780 UTR3 Human protein_coding chr6:30879636 chr6:30879636 . . 0 21 hm5U_associated_SNPs_9325 0 26651848 Sarcoidosis (Lofgren's syndrome vs non-Lofgren's syndrome) 2e-24 GWAS_Catalog TagSNP rs886420 GCST005541 High-Density Genetic Mapping Identifies New Susceptibility Variants in Sarcoidosis Phenotypes and Shows Genomic-driven Phenotypic Differences.
51 chr6 30890483 30890483 1 + G T rs2074506 30890483 + 30890463 30890503 41 TTGCCCCCTTCCATCCCCAGGTGCTGCAGGAAAAGCTGAGA TTGCCCCCTTCCATCCCCAGTTGCTGCAGGAAAAGCTGAGA Direct Gain 0 0.501124024391174 Functional Gain 0.501124024391174 VARS2 ENSG00000137411 CDS Human protein_coding chr6:30890483 chr6:30890483 nonsynonymous SNV 0.983 0 21 hm5U_associated_SNPs_9335 1 17804836 Rheumatoid Arthritis 1.68e-12 Johnson and O'Donnell TagSNP rs2074506 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
52 chr6 31129310 31129310 1 + C T rs7750641 31129310 + 31129290 31129330 41 TGACCTTTGGCCCTGAAGGGCCCCCAGGAACCAGCCCCTCG TGACCTTTGGCCCTGAAGGGTCCCCAGGAACCAGCCCCTCG Direct Gain 0 0.533685266971588 Functional Gain 0.533685266971588 TCF19 ENSG00000137310 CDS Human protein_coding chr6:31129310 chr6:31129310 nonsynonymous SNV 0.948 0 21 hm5U_associated_SNPs_9379 0 21323541 Idiopathic membranous nephropathy 3e-58 GWAS_Catalog TagSNP rs7750641 GCST000984 Risk HLA-DQA1 and PLA(2)R1 alleles in idiopathic membranous nephropathy.
53 chr6 31129707 31129707 1 + C T rs2073724 31129707 + 31129687 31129727 41 GGATGATGAGAGTGAGCCTCCTGAGAACCCGCCACCGGTCC GGATGATGAGAGTGAGCCTCTTGAGAACCCGCCACCGGTCC Direct Gain 0 0.7349573969841 Functional Gain 0.7349573969841 TCF19 ENSG00000137310 CDS Human protein_coding chr6:31129707 chr6:31129707 nonsynonymous SNV 0.002 0 21 hm5U_associated_SNPs_9380 0 17554300 Multiple complex diseases 2.05e-09 Johnson and O'Donnell TagSNP rs2073724 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
54 chr6 31994782 31994782 1 + C T rs451637 31994782 + 31994762 31994802 41 CTATGTGTGGCCACCCCAGTCCAGCTCCGGGTGTTCCGCGA CTATGTGTGGCCACCCCAGTTCAGCTCCGGGTGTTCCGCGA Direct Gain 0 0.61471825838089 Functional Gain 0.61471825838089 C4B;C4B_2 ENSG00000224389 CDS Human protein_coding chr6:31994782 chr6:31994782 synonymous SNV . 0 21 hm5U_associated_SNPs_9447 0 29875488 Blood protein levels 2e-22 GWAS_Catalog TagSNP rs451637 GCST005806 Genomic atlas of the human plasma proteome.
55 chr6 32151443 32151443 1 + C T rs2070600 32151443 + 32151423 32151463 41 AGCCGGAAGGAAGAGGGAGCCGTTGGGAAGGACACGAGCCA AGCCGGAAGGAAGAGGGAGCTGTTGGGAAGGACACGAGCCA Direct Gain 0 0.554993212223053 Functional Gain 0.554993212223053 AGER ENSG00000204305 CDS Human protein_coding chr6:32151443 chr6:32151443 nonsynonymous SNV 0.998 3 21 hm5U_associated_SNPs_9461 0 20010834 Pulmonary function 3e-15 GWAS_Catalog TagSNP rs2070600 GCST000544 Genome-wide association study identifies five loci associated with lung function.
56 chr6 32862740 32862740 1 + C T rs241407 32862740 + 32862720 32862760 41 GCGGAGTCTCGGAACGCCTGCCTGGAAGAAGAGTTCCGGCG GCGGAGTCTCGGAACGCCTGTCTGGAAGAAGAGTTCCGGCG Direct Gain 0 0.852014422416687 Functional Gain 0.852014422416687 LOC100294145 ENSG00000234515;ENSG00000235301 intergenic Human other chr6:32862740 chr6:32862740 . . 0 21 hm5U_associated_SNPs_9492 0 17632545 Type I Diabetes 2.39e-10 Johnson and O'Donnell TagSNP rs241407 . A genome-wide association study identifies KIAA0350 as a type 1 diabetes gene.
57 chr6 33055538 33055538 1 + C T rs9277554 33055538 + 33055518 33055558 41 AGGAGAGGTGGGGCTGAAGGCACAGACTTGGGCGTCACTGG AGGAGAGGTGGGGCTGAAGGTACAGACTTGGGCGTCACTGG Direct Gain 0 0.565021693706512 Functional Gain 0.565021693706512 HLA-DPB1 ENSG00000223865 downstream Human protein_coding chr6:33055538 chr6:33055538 . . 0 21 hm5U_associated_SNPs_9520 0 23740775 Wegener's granulomatosis 2e-50 GWAS_Catalog TagSNP rs9277554 GCST002160 Association of granulomatosis with polyangiitis (Wegener's) with HLA-DPB1*04 and SEMA6A gene variants: evidence from genome-wide analysis.
58 chr6 43270151 43270151 1 + C T rs2270860 43270151 + 43270131 43270171 41 ACTAGACTGCTAGTGTCCTCCGGTGAGCCCAGTCCCATAGG ACTAGACTGCTAGTGTCCTCTGGTGAGCCCAGTCCCATAGG Direct Gain 0 0.867064595222473 Functional Gain 0.867064595222473 SLC22A7 ENSG00000137204 CDS Human protein_coding chr6:43270151 chr6:43270151 synonymous SNV . 0 21 hm5U_associated_SNPs_9775 0 29455858 Diastolic blood pressure (cigarette smoking interaction) 4e-11 GWAS_Catalog TagSNP rs2270860 GCST006187 A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
59 chr6 84234144 84234144 1 + C T rs3812141 84234144 + 84234124 84234164 41 TATCGGTTTTGCAGTGTGTCCGACGAATCCAATGATCTCCT TATCGGTTTTGCAGTGTGTCTGACGAATCCAATGATCTCCT Direct Gain 0 0.980954051017761 Functional Gain 0.980954051017761 PRSS35 ENSG00000146250 CDS Human protein_coding chr6:84234144 chr6:84234144 synonymous SNV . 0 21 hm5U_associated_SNPs_9930 0 26031901 Response to zileuton treatment in asthma (FEV1 change interaction) 8e-07 GWAS_Catalog TagSNP rs3812141 GCST002951 Genome-wide association study of leukotriene modifier response in asthma.
60 chr6 134824211 134824211 1 + C T rs10872424 134824211 + 134824191 134824231 41 CTCCGGGTGTGCCCAGAAGTCAAAGTCCAGCAGGGGCAAAG CTCCGGGTGTGCCCAGAAGTTAAAGTCCAGCAGGGGCAAAG Direct Gain 0 0.705202043056488 Functional Gain 0.705202043056488 LINC01010 ENSG00000236700 ncRNA_exonic Human lincRNA chr6:134824211 chr6:134824211 . . 0 21 hm5U_associated_SNPs_10116 0 26420894 Glomerular filtration rate in chronic kidney disease 4e-06 GWAS_Catalog TagSNP rs10872424 GCST003139 Genetic loci associated with renal function measures and chronic kidney disease in children: the Pediatric Investigation for Genetic Factors Linked with Renal Progression Consortium.
61 chr6 159621087 159621087 1 + C T rs62432291 159621087 + 159621067 159621107 41 ACCACAGTGGAGTGAGCCGTCCTGTTTACAGAGCTGAAAGC ACCACAGTGGAGTGAGCCGTTCTGTTTACAGAGCTGAAAGC Direct Gain 0 0.56091982126236 Functional Gain 0.56091982126236 FNDC1 ENSG00000164694 CDS Human protein_coding chr6:159621087 chr6:159621087 nonsynonymous SNV 0.996 2 21 hm5U_associated_SNPs_10274 0 27182965 Joint mobility (Beighton score) 1e-12 GWAS_Catalog TagSNP rs62432291 GCST003998 Detection and interpretation of shared genetic influences on 42 human traits.
62 chr6 160543148 160543148 1 + C T rs12208357 160543148 + 160543128 160543168 41 GGGTGGCTGAGCTGAGCCAGCGCTGTGGCTGGAGCCCTGCG GGGTGGCTGAGCTGAGCCAGTGCTGTGGCTGGAGCCCTGCG Direct Gain 0 0.844951987266541 Functional Gain 0.844951987266541 SLC22A1 ENSG00000175003 CDS Human protein_coding chr6:160543148 chr6:160543148 nonsynonymous SNV 0.799 3 21 hm5U_associated_SNPs_10301 0 25961943 Cholesterol, total 9e-14 GWAS_Catalog TagSNP rs12208357 GCST002896 The impact of low-frequency and rare variants on lipid levels.
63 chr6 167754975 167754975 1 + G T rs12528714 167754975 + 167754955 167754995 41 CCCTACGCGTCCCTCTTCCAGTCGCACTCCTGCAAGACCAA CCCTACGCGTCCCTCTTCCATTCGCACTCCTGCAAGACCAA Direct Gain 0 0.550043106079102 Functional Gain 0.550043106079102 TTLL2 ENSG00000120440 CDS Human protein_coding chr6:167754975 chr6:167754975 nonsynonymous SNV 0.000 2 21 hm5U_associated_SNPs_10333 0 23382691 IgG glycosylation 8e-06 GWAS_Catalog TagSNP rs12528714 GCST001848 Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers.
64 chr7 1885178 1885178 1 + C T rs140364877 1885178 + 1885158 1885198 41 GGACGTGCTCCACGCAGACACGCGTCCGGCTCTGGTTCACG GGACGTGCTCCACGCAGACATGCGTCCGGCTCTGGTTCACG Direct Gain 0 0.901417315006256 Functional Gain 0.901417315006256 MAD1L1 ENSG00000002822;ENSG00000176349 intronic Human other chr7:1885178 chr7:1885178 . . 0 21 hm5U_associated_SNPs_10512 0 28540026 Autism spectrum disorder or schizophrenia 2e-11 GWAS_Catalog TagSNP rs140364877 GCST004521 Meta-analysis of GWAS of over 16,000 individuals with autism spectrum disorder highlights a novel locus at 10q24.32 and a significant overlap with schizophrenia.
65 chr7 4832198 4832198 1 + C T rs11971803 4832198 + 4832178 4832218 41 CCGAACCGCGGGGTCCTCACCGCCAGGTTCCAGCCCAGGAA CCGAACCGCGGGGTCCTCACTGCCAGGTTCCAGCCCAGGAA Direct Gain 0 0.925763726234436 Functional Gain 0.925763726234436 AP5Z1 ENSG00000242802 downstream Human protein_coding chr7:4832198 chr7:4832198 . . 0 21 hm5U_associated_SNPs_10682 1 27082954 Peripheral arterial disease (traffic-related air pollution interaction) 9e-06 GWAS_Catalog TagSNP rs11971803 GCST004482 Genetic Variants in the Bone Morphogenic Protein Gene Family Modify the Association between Residential Exposure to Traffic and Peripheral Arterial Disease.
66 chr7 21582917 21582917 1 + C T rs2285942 21582917 + 21582897 21582937 41 GACTTCAGAGAAGCCCCGACCCTTCGCCTAACCTCGGGGGC GACTTCAGAGAAGCCCCGACTCTTCGCCTAACCTCGGGGGC Direct Gain 0 0.850419700145721 Functional Gain 0.850419700145721 DNAH11 ENSG00000105877 CDS Human protein_coding chr7:21582917 chr7:21582917 synonymous SNV . 0 21 hm5U_associated_SNPs_10784 2 29507422 Total cholesterol levels 4e-07 GWAS_Catalog TagSNP rs2285942 GCST007143 A large electronic-health-record-based genome-wide study of serum lipids.
67 chr7 34818113 34818113 1 + A T rs324981 34818113 + 34818093 34818133 41 CAACATCTTGACAGATATTAATTGGCGATTCACTGGAGACT CAACATCTTGACAGATATTATTTGGCGATTCACTGGAGACT Direct Gain 0 0.844795107841492 Functional Gain 0.844795107841492 NPSR1 ENSG00000187258 CDS Human protein_coding chr7:34818113 chr7:34818113 nonsynonymous SNV 0.392 0 21 hm5U_associated_SNPs_10927 1 17903308 Sleep and circadian phenotypes 1.8e-05 Johnson and O'Donnell TagSNP rs324981 . Genome-wide association of sleep and circadian phenotypes.
68 chr7 93551428 93551428 1 + C T rs4262 93551428 + 93551408 93551448 41 CTCCGCTGCCAGAGCTAGCCCGAGCCCGGTTCTGGGGCGAA CTCCGCTGCCAGAGCTAGCCTGAGCCCGGTTCTGGGGCGAA Direct Gain 0 0.827712535858154 Functional Gain 0.827712535858154 GNG11 ENSG00000127920 UTR5 Human protein_coding chr7:93551428 chr7:93551428 . . 0 21 hm5U_associated_SNPs_11350 0 28613276 Heart rate variability traits (SDNN) 4e-17 GWAS_Catalog TagSNP rs4262 GCST004734 Genetic loci associated with heart rate variability and their effects on cardiac disease risk.
69 chr7 100862768 100862768 1 + C T rs10215699 100862768 + 100862748 100862788 41 CCCAGGCTGGAGTGCAGTGGCGCAATCTCGGTTCACTGCAA CCCAGGCTGGAGTGCAGTGGTGCAATCTCGGTTCACTGCAA Direct Gain 0 0.697429895401001 Functional Gain 0.697429895401001 ZNHIT1 ENSG00000106400 intronic Human protein_coding chr7:100862768 chr7:100862768 . . 0 21 hm5U_associated_SNPs_11543 0 30072576 Blood protein levels 7e-06 GWAS_Catalog TagSNP rs10215699 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
70 chr7 142479940 142479940 1 + C T rs58649169 142479940 + 142479920 142479960 41 TTTGATGATGATGACAAGATCGTTGGGGGCTACACCTGTGA TTTGATGATGATGACAAGATTGTTGGGGGCTACACCTGTGA Direct Gain 0 0.596722841262817 Functional Gain 0.596722841262817 PRSS3P2 ENSG00000250606 ncRNA_exonic Human other chr7:142479940 chr7:142479940 . . 0 21 hm5U_associated_SNPs_11867 0 28754779 Alcoholic chronic pancreatitis 3e-15 GWAS_Catalog TagSNP rs58649169 GCST004860 Genome-wide association study identifies inversion in the CTRB1-CTRB2 locus to modify risk for alcoholic and non-alcoholic chronic pancreatitis.
71 chr8 1719494 1719494 1 + C T rs34030778 1719494 + 1719474 1719514 41 TGCTGGGGGACCCTGTGCTGCATGCCGACAAGGCGCGTGGC TGCTGGGGGACCCTGTGCTGTATGCCGACAAGGCGCGTGGC Direct Gain 0 0.894521117210388 Functional Gain 0.894521117210388 CLN8 ENSG00000182372 CDS Human protein_coding chr8:1719494 chr8:1719494 nonsynonymous SNV 0.002 1 21 hm5U_associated_SNPs_12308 3 28736931 Total cholesterol change in response to fenofibrate in statin-treated type 2 diabetes 4e-08 GWAS_Catalog TagSNP rs34030778 GCST004765 Genetic Variants in HSD17B3, SMAD3, and IPO11 Impact Circulating Lipids in Response to Fenofibrate in Individuals With Type 2 Diabetes.
72 chr8 22436681 22436681 1 + C T rs11545016 22436681 + 22436661 22436701 41 GCGGGAGCGGTGGCGTCTCCCCGCCTTCCCTCCCTCCCGGG GCGGGAGCGGTGGCGTCTCCTCGCCTTCCCTCCCTCCCGGG Direct Gain 0 0.898512721061707 Functional Gain 0.898512721061707 PDLIM2 ENSG00000120913 CDS Human protein_coding chr8:22436681 chr8:22436681 nonsynonymous SNV 0.002 0 21 hm5U_associated_SNPs_12525 0 30595370 White blood cell count 3e-08 GWAS_Catalog TagSNP rs11545016 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
73 chr8 145584694 145584694 1 + C T rs34383175 145584694 + 145584674 145584714 41 GAGCCTGGGCAGGTGGGGACCCCGCTCCCCAACACCTGTCT GAGCCTGGGCAGGTGGGGACTCCGCTCCCCAACACCTGTCT Direct Gain 0 0.645600080490112 Functional Gain 0.645600080490112 SLC52A2 ENSG00000185803 UTR3 Human protein_coding chr8:145584694 chr8:145584694 . . 0 21 hm5U_associated_SNPs_13144 1 27989323 Interferon gamma-induced protein 10 levels 2e-06 GWAS_Catalog TagSNP rs34383175 GCST004440 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
74 chr9 35906471 35906471 1 + C T rs76452347 35906471 + 35906451 35906491 41 CCCAGCCTTGGCCCTTCCGGCGGCGGGGCCACCTGGGAATC CCCAGCCTTGGCCCTTCCGGTGGCGGGGCCACCTGGGAATC Direct Gain 0 0.893179893493652 Functional Gain 0.893179893493652 HRCT1 ENSG00000196196 CDS Human protein_coding chr9:35906471 chr9:35906471 nonsynonymous SNV 0.013 2 21 hm5U_associated_SNPs_13375 0 27618448 Diastolic blood pressure 7e-10 GWAS_Catalog TagSNP rs76452347 GCST006227 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
75 chr9 78505692 78505692 1 + C T rs76937529 78505692 + 78505672 78505712 41 GAGGGGGCGCCCGGTCGCTGCCTGTACCGCTCCCGCTGGTC GAGGGGGCGCCCGGTCGCTGTCTGTACCGCTCCCGCTGGTC Direct Gain 0 0.963534951210022 Functional Gain 0.963534951210022 PCSK5 ENSG00000099139 UTR5 Human protein_coding chr9:78505692 chr9:78505692 . . 0 21 hm5U_associated_SNPs_13458 0 30595370 Waist-hip ratio 5e-09 GWAS_Catalog TagSNP rs76937529 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
76 chr9 115634639 115634639 1 + C T rs1324930 115634639 + 115634619 115634659 41 GTGTGACTTGGTCCTGCCATCGTTAGCTTTGAAATCACAGG GTGTGACTTGGTCCTGCCATTGTTAGCTTTGAAATCACAGG Direct Gain 0 0.622286736965179 Functional Gain 0.622286736965179 SNX30 ENSG00000148158 UTR3 Human protein_coding chr9:115634639 chr9:115634639 . . 0 21 hm5U_associated_SNPs_13738 0 17554300 Multiple complex diseases 0.000461968 Johnson and O'Donnell TagSNP rs1324930 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
77 chr9 131186783 131186783 1 + C T rs61732491 131186783 + 131186763 131186803 41 GGTCCACTCCACCTTCCTTGCATCCCTGCGGGCTGAAGGGG GGTCCACTCCACCTTCCTTGTATCCCTGCGGGCTGAAGGGG Direct Gain 0 0.636140704154968 Functional Gain 0.636140704154968 CERCAM ENSG00000167123 CDS Human protein_coding chr9:131186783 chr9:131186783 nonsynonymous SNV 0.527 1 21 hm5U_associated_SNPs_13996 0 26606652 Systemic lupus erythematosus 2e-06 GWAS_Catalog TagSNP rs61732491 GCST003252 Genome-Wide Association Study in an Amerindian Ancestry Population Reveals Novel Systemic Lupus Erythematosus Risk Loci and the Role of European Admixture.
78 chr9 131700209 131700209 1 + C T rs10113912 131700209 + 131700189 131700229 41 AGCCACCTTCCATTCCTTCCCCTGATAGTGGATTGGTAGGG AGCCACCTTCCATTCCTTCCTCTGATAGTGGATTGGTAGGG Direct Gain 0 0.58950287103653 Functional Gain 0.58950287103653 PHYHD1 ENSG00000175287 UTR3 Human protein_coding chr9:131700209 chr9:131700209 . . 0 21 hm5U_associated_SNPs_14038 0 17554300 Multiple complex diseases 0.000669264 Johnson and O'Donnell TagSNP rs10113912 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
79 chr9 133924451 133924451 1 + C T rs869457 133924451 + 133924431 133924471 41 GTGTGGGGGGCTCTGAGCACCCCCCACAATGGAGCCCAAAT GTGTGGGGGGCTCTGAGCACTCCCCACAATGGAGCCCAAAT Direct Gain 0 0.606926620006561 Functional Gain 0.606926620006561 LAMC3 ENSG00000050555 CDS Human protein_coding chr9:133924451 chr9:133924451 nonsynonymous SNV 0.003 0 21 hm5U_associated_SNPs_14173 1 30573740 Male-pattern baldness 5e-18 GWAS_Catalog TagSNP rs869457 GCST007020 Dissection of genetic variation and evidence for pleiotropy in male pattern baldness.
80 chr9 136243324 136243324 1 + C T rs3739893 136243324 + 136243304 136243344 41 GCCAGGGGTGGACGCTCGCCCGTACGCGGTCGCTACTGATC GCCAGGGGTGGACGCTCGCCTGTACGCGGTCGCTACTGATC Direct Gain 0 0.950515389442444 Functional Gain 0.950515389442444 STKLD1 ENSG00000198870 UTR5 Human protein_coding chr9:136243324 chr9:136243324 . . 0 21 hm5U_associated_SNPs_14251 0 29296746 ADAMTS13 levels 1e-30 GWAS_Catalog TagSNP rs3739893 GCST005945 Genetic variants in ADAMTS13 as well as smoking are major determinants of plasma ADAMTS13 levels.
81 chr9 136307825 136307825 1 + C T rs41314453 136307825 + 136307805 136307845 41 AGGGAGCCAGCAGCCACCAGCGTGGCCAGAGGCCTGCGTGC AGGGAGCCAGCAGCCACCAGTGTGGCCAGAGGCCTGCGTGC Direct Gain 0 0.597126424312592 Functional Gain 0.597126424312592 ADAMTS13 ENSG00000160323 CDS Human protein_coding chr9:136307825 chr9:136307825 nonsynonymous SNV 0.427 0 21 hm5U_associated_SNPs_14271 1 25934476 ADAMTS13 activity 1e-63 GWAS_Catalog TagSNP rs41314453 GCST002881 Genetic variants in the ADAMTS13 and SUPT3H genes are associated with ADAMTS13 activity.
82 chr9 136522274 136522274 1 + C T rs6271 136522274 + 136522254 136522294 41 TTCCCTGGAACTCCTTCAACCGCGACGTACTGAAGGCCCTG TTCCCTGGAACTCCTTCAACTGCGACGTACTGAAGGCCCTG Direct Gain 0 0.665362596511841 Functional Gain 0.665362596511841 DBH ENSG00000123454 CDS Human protein_coding chr9:136522274 chr9:136522274 nonsynonymous SNV 0.002 1 21 hm5U_associated_SNPs_14297 1 27618452 Systolic blood pressure 5e-11 GWAS_Catalog TagSNP rs6271 GCST006259 The genetics of blood pressure regulation and its target organs from association studies in 342,415 individuals.
83 chr9 139316744 139316744 1 + C T rs11145974 139316744 + 139316724 139316764 41 GTTAGTAGGCGAGAAGGGCTCAGTAGAGGACTGCTACATTG GTTAGTAGGCGAGAAGGGCTTAGTAGAGGACTGCTACATTG Direct Gain 0 0.851370990276337 Functional Gain 0.851370990276337 PMPCA ENSG00000165688 UTR3 Human protein_coding chr9:139316744 chr9:139316744 . . 0 21 hm5U_associated_SNPs_14478 0 30595370 White blood cell count 3e-25 GWAS_Catalog TagSNP rs11145974 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
84 chr10 72517837 72517837 1 + C T rs6480463 72517837 + 72517817 72517857 41 GTCCAGGTCTGCAGCCTGCCCGCCTGTGGAGGTGAGCCAGA GTCCAGGTCTGCAGCCTGCCTGCCTGTGGAGGTGAGCCAGA Direct Gain 0 0.507190465927124 Functional Gain 0.507190465927124 ADAMTS14 ENSG00000138316 CDS Human protein_coding chr10:72517837 chr10:72517837 synonymous SNV . 0 21 hm5U_associated_SNPs_15223 0 26079190 Suicide behavior 2e-06 GWAS_Catalog TagSNP rs6480463 GCST002969 A genome-wide association study of suicidal behavior.
85 chr10 111967555 111967555 1 + C T rs1475502 111967555 + 111967535 111967575 41 AGAGGACGAGCTCGGCGGACCCCCGCTCCTCCATGGGCAAA AGAGGACGAGCTCGGCGGACTCCCGCTCCTCCATGGGCAAA Direct Gain 0 0.956196546554565 Functional Gain 0.956196546554565 MXI1 ENSG00000119950 UTR5 Human protein_coding chr10:111967555 chr10:111967555 . . 0 21 hm5U_associated_SNPs_15709 0 30595370 Height 1e-09 GWAS_Catalog TagSNP rs1475502 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
86 chr10 131265545 131265545 1 + C T rs16906252 131265545 + 131265525 131265565 41 CCGCAGGTCCTCGCGGTGCGCACCGTTTGCGACTTGGTGAG CCGCAGGTCCTCGCGGTGCGTACCGTTTGCGACTTGGTGAG Direct Gain 0 0.974999248981476 Functional Gain 0.974999248981476 MGMT ENSG00000170430 CDS Human protein_coding chr10:131265545 chr10:131265545 synonymous SNV . 0 21 hm5U_associated_SNPs_15890 1 26183928 MGMT methylation in smokers 4e-31 GWAS_Catalog TagSNP rs16906252 GCST003031 Implication of a Chromosome 15q15.2 Locus in Regulating UBR1 and Predisposing Smokers to MGMT Methylation in Lung.
87 chr11 1874221 1874221 1 + C T rs907612 1874221 + 1874201 1874241 41 CACCCTGACCCAAGCCGAGACAGGTTCCAAACCTCAACCTG CACCCTGACCCAAGCCGAGATAGGTTCCAAACCTCAACCTG Direct Gain 0 0.69847297668457 Functional Gain 0.69847297668457 LSP1 ENSG00000130592 UTR5 Human protein_coding chr11:1874221 chr11:1874221 . . 0 21 hm5U_associated_SNPs_16304 0 27863252 Monocyte count 5e-16 GWAS_Catalog TagSNP rs907612 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
88 chr11 45949534 45949534 1 + C T rs939105 45949534 + 45949514 45949554 41 GCACTGGTGGTGCCGGCATTCGAGACCCTGCGCTACCGCTT GCACTGGTGGTGCCGGCATTTGAGACCCTGCGCTACCGCTT Direct Gain 0 0.941296219825745 Functional Gain 0.941296219825745 LARGE2 ENSG00000165905 CDS Human protein_coding chr11:45949534 chr11:45949534 synonymous SNV . 0 21 hm5U_associated_SNPs_16751 0 30595370 Height 4e-16 GWAS_Catalog TagSNP rs939105 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
89 chr11 46747662 46747662 1 + C T rs5899 46747662 + 46747642 46747682 41 CCAGACGGGGATGAGGAGGGCGTGTGGTGCTATGTGGCCGG CCAGACGGGGATGAGGAGGGTGTGTGGTGCTATGTGGCCGG Direct Gain 0 0.578009009361267 Functional Gain 0.578009009361267 F2 ENSG00000180210 CDS Human protein_coding chr11:46747662 chr11:46747662 synonymous SNV . 0 21 hm5U_associated_SNPs_16772 2 30072576 Blood protein levels 8e-14 GWAS_Catalog TagSNP rs5899 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
90 chr11 64120451 64120451 1 + C T rs61886887 64120451 + 64120431 64120471 41 CCTGTCTGGCCTCCCCTCCCCGGCATAACTTCTCTGGCCAG CCTGTCTGGCCTCCCCTCCCTGGCATAACTTCTCTGGCCAG Direct Gain 0 0.80668568611145 Functional Gain 0.80668568611145 CCDC88B ENSG00000168071 intronic Human protein_coding chr11:64120451 chr11:64120451 . . 0 21 hm5U_associated_SNPs_17060 0 30595370 Eczema 7e-08 GWAS_Catalog TagSNP rs61886887 GCST007075 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
91 chr11 65405600 65405600 1 + G T rs2306363 65405600 + 65405580 65405620 41 CGCCGGGAGCGGTAGCGGGAGAGCGGCAGCGGGACCCCAGC CGCCGGGAGCGGTAGCGGGATAGCGGCAGCGGGACCCCAGC Direct Gain 0 0.799193620681763 Functional Gain 0.799193620681763 SIPA1 ENSG00000213445 UTR5 Human protein_coding chr11:65405600 chr11:65405600 . . 0 21 hm5U_associated_SNPs_17184 0 29912962 Systolic blood pressure x alcohol consumption interaction (2df test) 1e-20 GWAS_Catalog TagSNP rs2306363 GCST006434 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
92 chr11 68201295 68201295 1 + C T rs3736228 68201295 + 68201275 68201315 41 TCAGGACCGCTCAGACGAGGCGGACTGTGACGGTGAGGCCC TCAGGACCGCTCAGACGAGGTGGACTGTGACGGTGAGGCCC Direct Gain 0 0.683665454387665 Functional Gain 0.683665454387665 LRP5 ENSG00000162337 CDS Human protein_coding chr11:68201295 chr11:68201295 nonsynonymous SNV 0.005 1 21 hm5U_associated_SNPs_17361 1 18455228 Bone mineral density 6e-12 GWAS_Catalog TagSNP rs3736228 GCST000182 Bone mineral density, osteoporosis, and osteoporotic fractures: a genome-wide association study.
93 chr11 75274150 75274150 1 + G T rs590121 75274150 + 75274130 75274170 41 CCACTGCCACAGGGTTCTTGGAGTAACTGCAGGGTTTAAAC CCACTGCCACAGGGTTCTTGTAGTAACTGCAGGGTTTAAAC Direct Gain 0 0.780246138572693 Functional Gain 0.780246138572693 SERPINH1 ENSG00000149257 UTR5 Human protein_coding chr11:75274150 chr11:75274150 . . 0 21 hm5U_associated_SNPs_17598 0 29212778 Coronary artery disease 2e-10 GWAS_Catalog TagSNP rs590121 GCST005196 Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease.
94 chr11 102980324 102980324 1 + C T rs17301028 102980324 + 102980304 102980344 41 ATGGCGAACGGGACTGCGGACGTTCGGAAGCTCTTCATCTT ATGGCGAACGGGACTGCGGATGTTCGGAAGCTCTTCATCTT Direct Gain 0 0.602043092250824 Functional Gain 0.602043092250824 DYNC2H1 ENSG00000187240 CDS Human protein_coding chr11:102980324 chr11:102980324 synonymous SNV . 0 21 hm5U_associated_SNPs_17748 3 17998437 Alzheimer's disease 0.000489 Johnson and O'Donnell TagSNP rs17301028 . Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.
95 chr11 117042408 117042408 1 + C T rs186808413 117042408 + 117042388 117042428 41 ACAAGGGTCGGTTAACTGGTCGATCGGGACCTATCCTGATG ACAAGGGTCGGTTAACTGGTTGATCGGGACCTATCCTGATG Direct Gain 0 0.722474753856659 Functional Gain 0.722474753856659 PAFAH1B2 ENSG00000168092 CDS Human protein_coding chr11:117042408 chr11:117042408 nonsynonymous SNV 0.616 0 21 hm5U_associated_SNPs_17848 0 24507774 HDL cholesterol 2e-10 GWAS_Catalog TagSNP rs186808413 GCST007850 Association of low-frequency and rare coding-sequence variants with blood lipids and coronary heart disease in 56,000 whites and blacks.
96 chr11 126310082 126310082 1 + A T rs878830 126310082 + 126310062 126310102 41 TGTGCCCCTCTGCCCTTAGGATGCGGAATTTGGTCAGAGCC TGTGCCCCTCTGCCCTTAGGTTGCGGAATTTGGTCAGAGCC Direct Gain 0 0.596811771392822 Functional Gain 0.596811771392822 KIRREL3 ENSG00000149571 intronic Human protein_coding chr11:126310082 chr11:126310082 . . 0 21 hm5U_associated_SNPs_18036 0 26528553 Gut microbiome composition (winter) 5e-06 GWAS_Catalog TagSNP rs878830 GCST003223 Genome-Wide Association Studies of the Human Gut Microbiota.
97 chr12 6938872 6938872 1 + C T rs3741920 6938872 + 6938852 6938892 41 CCTCTAGGGGATCTGCAGTTCGGGCGGTGGGCGGTTCTGAT CCTCTAGGGGATCTGCAGTTTGGGCGGTGGGCGGTTCTGAT Direct Gain 0 0.685918092727661 Functional Gain 0.685918092727661 P3H3 ENSG00000110811;ENSG00000250510 intronic Human other chr12:6938872 chr12:6938872 . . 0 21 hm5U_associated_SNPs_18330 0 22437554 Response to Vitamin E supplementation 4e-06 GWAS_Catalog TagSNP rs3741920 GCST001450 Genome-wide association study identifies three common variants associated with serologic response to vitamin E supplementation in men.
98 chr12 40873251 40873251 1 + C T rs2588400 40873251 + 40873231 40873271 41 TTCAGGGACAAGTGGACAATCGGTTACAGGATCAAGAGCAA TTCAGGGACAAGTGGACAATTGGTTACAGGATCAAGAGCAA Direct Gain 0 0.622840046882629 Functional Gain 0.622840046882629 MUC19 ENSG00000205592 CDS Human processed_transcript chr12:40873251 chr12:40873251 nonsynonymous SNV . 0 21 hm5U_associated_SNPs_18542 0 17554300 Multiple complex diseases 0.00053808 Johnson and O'Donnell TagSNP rs2588400 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
99 chr12 53581383 53581383 1 + G T rs74796725 53581383 + 53581363 53581403 41 TTTTCTCTATAGGCGCAAGGGGCCCCGGGTGGTGGGAGTGA TTTTCTCTATAGGCGCAAGGTGCCCCGGGTGGTGGGAGTGA Direct Gain 0 0.598284065723419 Functional Gain 0.598284065723419 ZNF740 ENSG00000139651 UTR3 Human protein_coding chr12:53581383 chr12:53581383 . . 0 21 hm5U_associated_SNPs_18747 0 29064472 Initial pursuit acceleration in psychotic disorders 2e-08 GWAS_Catalog TagSNP rs74796725 GCST005026 Genome-wide association studies of smooth pursuit and antisaccade eye movements in psychotic disorders: findings from the B-SNIP study.
100 chr12 69979517 69979517 1 + C T rs2601006 69979517 + 69979497 69979537 41 GTGGACCGCAAAGCCAGCGTCTCCTTGTGCCTAGGTCTTTG GTGGACCGCAAAGCCAGCGTTTCCTTGTGCCTAGGTCTTTG Direct Gain 0 0.812712669372559 Functional Gain 0.812712669372559 CCT2 ENSG00000166226 UTR5 Human protein_coding chr12:69979517 chr12:69979517 . . 0 21 hm5U_associated_SNPs_18945 0 30220432 Urinary albumin excretion 2e-11 GWAS_Catalog TagSNP rs2601006 GCST006586 Genetic Association of Albuminuria with Cardiometabolic Disease and Blood Pressure.
101 chr14 24035016 24035016 1 + C T rs77436356 24035016 + 24034996 24035036 41 GCCCAGGGCCTGCCCCTTCACCAGCCCACCTTTCGGAAGTG GCCCAGGGCCTGCCCCTTCATCAGCCCACCTTTCGGAAGTG Direct Gain 0 0.857208669185638 Functional Gain 0.857208669185638 LOC102724814 ENSG00000258727 ncRNA_exonic Human antisense chr14:24035016 chr14:24035016 . . 0 21 hm5U_associated_SNPs_20217 0 30595370 Eosinophil counts 3e-08 GWAS_Catalog TagSNP rs77436356 GCST007065 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
102 chr14 55227152 55227152 1 + G T rs149416017 55227152 + 55227132 55227172 41 GCAGCTGCGATGGGGAGCTGGCCGTCGCCCCCCTGCCAGAG GCAGCTGCGATGGGGAGCTGTCCGTCGCCCCCCTGCCAGAG Direct Gain 0 0.953799486160278 Functional Gain 0.953799486160278 SAMD4A ENSG00000020577 CDS Human protein_coding chr14:55227152 chr14:55227152 nonsynonymous SNV 0.876 1 21 hm5U_associated_SNPs_20384 0 28521775 Subclinical trait of interstitial lung disease (basilar percentage of high attenuation areas on CT scan) 3e-08 GWAS_Catalog TagSNP rs149416017 GCST004526 Genome-wide association study of subclinical interstitial lung disease in MESA.
103 chr14 95107973 95107973 1 + C T rs4905226 95107973 + 95107953 95107993 41 TGGAGGGCCTGGGGTTCACCCTCACCGTGGTGCCTGAGGAG TGGAGGGCCTGGGGTTCACCTTCACCGTGGTGCCTGAGGAG Direct Gain 0 0.712952256202698 Functional Gain 0.712952256202698 SERPINA13P ENSG00000187483 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr14:95107973 chr14:95107973 . . 0 21 hm5U_associated_SNPs_20783 0 24564958 Social communication problems 4e-06 GWAS_Catalog TagSNP rs4905226 GCST002367 Variability in the common genetic architecture of social-communication spectrum phenotypes during childhood and adolescence.
104 chr14 103566785 103566785 1 + C T rs2297067 103566785 + 103566765 103566805 41 AGGAAGATACGGGCCTGTTCCGGCGAAGCTCCTGCTCCCTG AGGAAGATACGGGCCTGTTCTGGCGAAGCTCCTGCTCCCTG Direct Gain 0 0.771588027477264 Functional Gain 0.771588027477264 EXOC3L4 ENSG00000205436 CDS Human protein_coding chr14:103566785 chr14:103566785 nonsynonymous SNV 0.000 2 21 hm5U_associated_SNPs_20954 0 22139419 Platelet count 2e-10 GWAS_Catalog TagSNP rs2297067 GCST001337 New gene functions in megakaryopoiesis and platelet formation.
105 chr14 105954705 105954705 1 + C T rs55633823 105954705 + 105954685 105954725 41 CTGCAACCACCCCTGCTACGCAGCCATGTTTGGGCCTAAAG CTGCAACCACCCCTGCTACGTAGCCATGTTTGGGCCTAAAG Direct Gain 0 0.513370156288147 Functional Gain 0.513370156288147 CRIP1 ENSG00000213145;ENSG00000257341 CDS Human other chr14:105954705 chr14:105954705 nonsynonymous SNV 0.535 2 21 hm5U_associated_SNPs_21161 0 30048462 Heel bone mineral density 3e-14 GWAS_Catalog TagSNP rs55633823 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
106 chr15 41247859 41247859 1 + A T rs112036939 41247859 + 41247839 41247879 41 TGCTGCGTCTGGCAGACTTCATGCAGCTCTGTGGGCCTCAG TGCTGCGTCTGGCAGACTTCTTGCAGCTCTGTGGGCCTCAG Direct Gain 0 0.690841913223267 Functional Gain 0.690841913223267 CHAC1 ENSG00000128965 CDS Human protein_coding chr15:41247859 chr15:41247859 nonsynonymous SNV 0.976 0 21 hm5U_associated_SNPs_21457 0 30595370 Menarche (age at onset) 7e-09 GWAS_Catalog TagSNP rs112036939 GCST007078 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
107 chr15 44720011 44720011 1 + C T rs116908763 44720011 + 44719991 44720031 41 GCCGCCGCTGCTTCCAATCTCAGTCCTCCTCCTCTTCCAGG GCCGCCGCTGCTTCCAATCTTAGTCCTCCTCCTCTTCCAGG Direct Gain 0 0.601042449474335 Functional Gain 0.601042449474335 CTDSPL2 ENSG00000137770 UTR5 Human protein_coding chr15:44720011 chr15:44720011 . . 0 21 hm5U_associated_SNPs_21561 0 27863252 Mean corpuscular hemoglobin 2e-10 GWAS_Catalog TagSNP rs116908763 GCST004630 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
108 chr15 63886593 63886593 1 + C T rs2649 63886593 + 63886573 63886613 41 TCTGTAGTCCAAGGTCTCTGCGTCTCGTCAGTGGGTGCAGT TCTGTAGTCCAAGGTCTCTGTGTCTCGTCAGTGGGTGCAGT Direct Gain 0 0.639338910579681 Functional Gain 0.639338910579681 USP3-AS1 ENSG00000259248 ncRNA_intronic Human antisense chr15:63886593 chr15:63886593 . . 0 21 hm5U_associated_SNPs_21689 0 28394258 Aortic root size 5e-08 GWAS_Catalog TagSNP rs2649 GCST004651 Large-scale genome-wide analysis identifies genetic variants associated with cardiac structure and function.
109 chr15 74219546 74219546 1 + G T rs1048661 74219546 + 74219526 74219566 41 GGACAGCACGGGCATGGCCCGGGCCCGCACCTCCGTCTCCC GGACAGCACGGGCATGGCCCTGGCCCGCACCTCCGTCTCCC Direct Gain 0 0.874503493309021 Functional Gain 0.874503493309021 LOXL1 ENSG00000129038 CDS Human protein_coding chr15:74219546 chr15:74219546 nonsynonymous SNV 0.983 1 21 hm5U_associated_SNPs_21825 1 17690259 Glaucoma 2.3e-12 Johnson and O'Donnell TagSNP rs1048661 . Common sequence variants in the LOXL1 gene confer susceptibility to exfoliation glaucoma.
110 chr15 74244344 74244344 1 + C T rs3522 74244344 + 74244324 74244364 41 AAAACCACAGGGATTCCGGACGCCAGACCCCATTTTATACT AAAACCACAGGGATTCCGGATGCCAGACCCCATTTTATACT Direct Gain 0 0.559032320976257 Functional Gain 0.559032320976257 LOXL1 ENSG00000129038 UTR3 Human protein_coding chr15:74244344 chr15:74244344 . . 0 21 hm5U_associated_SNPs_21828 0 17690259 Glaucoma 0.0027 Johnson and O'Donnell TagSNP rs3522 . Common sequence variants in the LOXL1 gene confer susceptibility to exfoliation glaucoma.
111 chr15 78832792 78832792 1 + G T rs3813571 78832792 + 78832772 78832812 41 CATGCGCGGGGGCCATATTAGCAGCGGTTATTCGGTGAGCG CATGCGCGGGGGCCATATTATCAGCGGTTATTCGGTGAGCG Direct Gain 0 0.923894762992859 Functional Gain 0.923894762992859 PSMA4 ENSG00000041357 UTR5 Human protein_coding chr15:78832792 chr15:78832792 . . 0 21 hm5U_associated_SNPs_21949 0 17554300 Multiple complex diseases 0.00045763 Johnson and O'Donnell TagSNP rs3813571 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
112 chr15 85188839 85188839 1 + C T rs11073619 85188839 + 85188819 85188859 41 GGGGGTCAAGAAGACAAAGACGCCCATCTGAGCCAAGGCTG GGGGGTCAAGAAGACAAAGATGCCCATCTGAGCCAAGGCTG Direct Gain 0 0.940328776836395 Functional Gain 0.940328776836395 WDR73 ENSG00000177082 CDS Human protein_coding chr15:85188839 chr15:85188839 nonsynonymous SNV 0.440 0 21 hm5U_associated_SNPs_22049 0 27089181 Positive affect 1e-06 GWAS_Catalog TagSNP rs11073619 GCST003768 Genetic variants associated with subjective well-being, depressive symptoms, and neuroticism identified through genome-wide analyses.
113 chr15 89388905 89388905 1 + C T rs16942341 89388905 + 89388885 89388925 41 GTAAAGCCCATCTTCGAGGTCTCCCCCAGTCCCCTGGAACC GTAAAGCCCATCTTCGAGGTTTCCCCCAGTCCCCTGGAACC Direct Gain 0 0.761777877807617 Functional Gain 0.761777877807617 ACAN ENSG00000157766 CDS Human protein_coding chr15:89388905 chr15:89388905 synonymous SNV . 0 21 hm5U_associated_SNPs_22113 0 20881960 Height 4e-27 GWAS_Catalog TagSNP rs16942341 GCST000817 Hundreds of variants clustered in genomic loci and biological pathways affect human height.
114 chr16 716512 716512 1 + C T rs35506206 716512 + 716492 716532 41 TGGCTGCCAGTGGGGACCAGCGGGTCAGCGTCTGGGCCTCC TGGCTGCCAGTGGGGACCAGTGGGTCAGCGTCTGGGCCTCC Direct Gain 0 0.739238917827606 Functional Gain 0.739238917827606 WDR90 ENSG00000161996 CDS Human protein_coding chr16:716512 chr16:716512 nonsynonymous SNV 0.526 3 21 hm5U_associated_SNPs_22485 0 30595370 Mean corpuscular hemoglobin 4e-12 GWAS_Catalog TagSNP rs35506206 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
115 chr16 1724693 1724693 1 + G T rs2294444 1724693 + 1724673 1724713 41 ACTCTTAACAGGGAGTGGGGGCAGGAAGAGTCCTGTACTAT ACTCTTAACAGGGAGTGGGGTCAGGAAGAGTCCTGTACTAT Direct Gain 0 0.630351185798645 Functional Gain 0.630351185798645 CRAMP1 ENSG00000007545;ENSG00000261732 UTR3 Human other chr16:1724693 chr16:1724693 . . 0 21 hm5U_associated_SNPs_22672 0 17052657 Parkinson's disease 0.00056677 Johnson and O'Donnell TagSNP rs2294444 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
116 chr16 2086421 2086421 1 + C T rs139491786 2086421 + 2086401 2086441 41 ACCTGCATAGTGACAAGTCCCGGCCCGGCCAGTACATCCGC ACCTGCATAGTGACAAGTCCTGGCCCGGCCAGTACATCCGC Direct Gain 0 0.854988813400269 Functional Gain 0.854988813400269 SLC9A3R2 ENSG00000065054 CDS Human protein_coding chr16:2086421 chr16:2086421 nonsynonymous SNV 0.998 4 21 hm5U_associated_SNPs_22731 0 30578418 Systolic blood pressure 1e-30 GWAS_Catalog TagSNP rs139491786 GCST007270 Trans-ethnic association study of blood pressure determinants in over 750,000 individuals.
117 chr16 2222286 2222286 1 + C T rs11547311 2222286 + 2222266 2222306 41 CTCTTCATCCACTGCCGGCACGGCTGCCGGGTAGCGGGCAG CTCTTCATCCACTGCCGGCATGGCTGCCGGGTAGCGGGCAG Direct Gain 0 0.597670257091522 Functional Gain 0.597670257091522 TRAF7 ENSG00000131653 CDS Human protein_coding chr16:2222286 chr16:2222286 synonymous SNV . 0 21 hm5U_associated_SNPs_22752 0 28552196 Height 7e-07 GWAS_Catalog TagSNP rs11547311 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
118 chr16 11038360 11038360 1 + C T rs8054198 11038360 + 11038340 11038380 41 GGGTGAACTGCATTTCCCAGCGCCCCACGCGGCGGCGGCCG GGGTGAACTGCATTTCCCAGTGCCCCACGCGGCGGCGGCCG Direct Gain 0 0.741619050502777 Functional Gain 0.741619050502777 CLEC16A ENSG00000038532 UTR5 Human protein_coding chr16:11038360 chr16:11038360 . . 0 21 hm5U_associated_SNPs_23115 0 28714469 Systemic lupus erythematosus 2e-08 GWAS_Catalog TagSNP rs8054198 GCST005752 Transancestral mapping and genetic load in systemic lupus erythematosus.
119 chr16 16142079 16142079 1 + G T rs60782127 16142079 + 16142059 16142099 41 ATGTCTGTGGACGCTCAGAGGTTCATGGACTTGGCCACGTA ATGTCTGTGGACGCTCAGAGTTTCATGGACTTGGCCACGTA Direct Gain 0 0.525330066680908 Functional Gain 0.525330066680908 ABCC1 ENSG00000103222 CDS Human protein_coding chr16:16142079 chr16:16142079 nonsynonymous SNV 0.994 5 21 hm5U_associated_SNPs_23201 0 30595370 Height 5e-17 GWAS_Catalog TagSNP rs60782127 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
120 chr16 16367613 16367613 1 + G T rs202070282 16367613 + 16367593 16367633 41 CTGTGCAGGAGCTGCGGAGGGAGCAGCAGCTGGCTGAGATC CTGTGCAGGAGCTGCGGAGGTAGCAGCAGCTGGCTGAGATC Direct Gain 0 0.559297800064087 Functional Gain 0.559297800064087 NOMO3 ENSG00000103226 CDS Human protein_coding chr16:16367613 chr16:16367613 stopgain 1.000 1 21 hm5U_associated_SNPs_23210 0 29875488 Blood protein levels 2e-49 GWAS_Catalog TagSNP rs202070282 GCST005806 Genomic atlas of the human plasma proteome.
121 chr16 28875204 28875204 1 + A T rs11864750 28875204 + 28875184 28875224 41 CGCGTAGTGGGTGGGGGCGCAGGGAGCGGGAGCCGCCGCCG CGCGTAGTGGGTGGGGGCGCTGGGAGCGGGAGCCGCCGCCG Direct Gain 0 0.958346128463745 Functional Gain 0.958346128463745 SH2B1 ENSG00000178188 UTR5 Human protein_coding chr16:28875204 chr16:28875204 . . 0 21 hm5U_associated_SNPs_23380 0 30038396 Highest math class taken (MTAG) 7e-37 GWAS_Catalog TagSNP rs11864750 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
122 chr16 29820480 29820480 1 + C T rs34286592 29820480 + 29820460 29820500 41 CGGGTAGCAGAGAAAGCTGCCTTCAGTCAGACTCACCGGTT CGGGTAGCAGAGAAAGCTGCTTTCAGTCAGACTCACCGGTT Direct Gain 0 0.673554539680481 Functional Gain 0.673554539680481 MAZ ENSG00000238045;ENSG00000261962 ncRNA_intronic Human other chr16:29820480 chr16:29820480 . . 0 21 hm5U_associated_SNPs_23429 0 27386562 Multiple sclerosis 5e-07 GWAS_Catalog TagSNP rs34286592 GCST003566 Novel multiple sclerosis susceptibility loci implicated in epigenetic regulation.
123 chr16 29994922 29994922 1 + C T rs3814883 29994922 + 29994902 29994942 41 CCCACTTCCACCACCTCTTCCGCCCGCCGCCGGGCCTACTG CCCACTTCCACCACCTCTTCTGCCCGCCGCCGGGCCTACTG Direct Gain 0 0.752814650535583 Functional Gain 0.752814650535583 TAOK2 ENSG00000149930 CDS Human protein_coding chr16:29994922 chr16:29994922 synonymous SNV . 0 21 hm5U_associated_SNPs_23445 0 30595370 Body mass index 7e-35 GWAS_Catalog TagSNP rs3814883 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
124 chr16 30785824 30785824 1 + C T rs11642862 30785824 + 30785804 30785844 41 GAAGGCTCGCTCCCTGCCTACTGGCTCACAAATGAGGACCA GAAGGCTCGCTCCCTGCCTATTGGCTCACAAATGAGGACCA Direct Gain 0 0.605594992637634 Functional Gain 0.605594992637634 RNF40 ENSG00000103549 UTR3 Human protein_coding chr16:30785824 chr16:30785824 . . 0 21 hm5U_associated_SNPs_23496 0 28928442 Tonsillectomy 2e-06 GWAS_Catalog TagSNP rs11642862 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
125 chr16 31141993 31141993 1 + C T rs1549293 31141993 + 31141973 31142013 41 GGGCCACGATCCTGCTTCCTCATACCCTGTCACCATCCTGG GGGCCACGATCCTGCTTCCTTATACCCTGTCACCATCCTGG Direct Gain 0 0.78047114610672 Functional Gain 0.78047114610672 KAT8 ENSG00000103510 UTR3 Human protein_coding chr16:31141993 chr16:31141993 . . 0 21 hm5U_associated_SNPs_23529 0 25673412 Waist circumference 7e-09 GWAS_Catalog TagSNP rs1549293 GCST004065 New genetic loci link adipose and insulin biology to body fat distribution.
126 chr16 31343005 31343005 1 + C T rs1143678 31343005 + 31342985 31343025 41 ACATGATGAGTGAAGGGGGTCCCCCGGGGGCCGAACCCCAG ACATGATGAGTGAAGGGGGTTCCCCGGGGGCCGAACCCCAG Direct Gain 0 0.812413811683655 Functional Gain 0.812413811683655 ITGAM ENSG00000169896 CDS Human protein_coding chr16:31343005 chr16:31343005 nonsynonymous SNV 0.183 1 21 hm5U_associated_SNPs_23543 0 18204446 Systemic Lupus Erythematosus (SLE), gender differentiated in women 3.7e-16 Johnson and O'Donnell TagSNP rs1143678 . Genome-wide association scan in women with systemic lupus erythematosus identifies susceptibility variants in ITGAM, PXK, KIAA1542 and other loci.
127 chr16 50705254 50705254 1 + C T rs59302410 50705254 + 50705234 50705274 41 ATTCAGCCCTAAAACATGGGCGAGTGCCCGCTTGCAGTTCA ATTCAGCCCTAAAACATGGGTGAGTGCCCGCTTGCAGTTCA Direct Gain 0 0.594821572303772 Functional Gain 0.594821572303772 LOC101927272 ENSG00000260249 ncRNA_exonic Human antisense chr16:50705254 chr16:50705254 . . 0 21 hm5U_associated_SNPs_23610 0 30048462 Heel bone mineral density 2e-19 GWAS_Catalog TagSNP rs59302410 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
128 chr16 50819910 50819910 1 + C T rs2111435 50819910 + 50819890 50819930 41 AGTAAACTTATGGTAGCCGCCAAGTTCTCCTCTGAAGCCAT AGTAAACTTATGGTAGCCGCTAAGTTCTCCTCTGAAGCCAT Direct Gain 0 0.658317148685455 Functional Gain 0.658317148685455 CYLD ENSG00000260616 ncRNA_intronic Human antisense chr16:50819910 chr16:50819910 . . 0 21 hm5U_associated_SNPs_23616 0 17804789 Crohn's disease 2.6e-05 Johnson and O'Donnell TagSNP rs2111435 . Genome-wide association study for Crohn's disease in the Quebec Founder Population identifies multiple validated disease loci.
129 chr16 57418725 57418725 1 + C T rs8102 57418725 + 57418705 57418745 41 TTCCAGGCTGGGAGAGCCTTCCAGGGGTGGGACACCCTGTG TTCCAGGCTGGGAGAGCCTTTCAGGGGTGGGACACCCTGTG Direct Gain 0 0.723989844322205 Functional Gain 0.723989844322205 CX3CL1 ENSG00000006210 UTR3 Human protein_coding chr16:57418725 chr16:57418725 . . 0 21 hm5U_associated_SNPs_23728 0 29875488 Blood protein levels 1e-16 GWAS_Catalog TagSNP rs8102 GCST005806 Genomic atlas of the human plasma proteome.
130 chr16 67572130 67572130 1 + C T rs567068501 67572130 + 67572110 67572150 41 GGGGCCGAGCCGAGGCCACGCTGAGTCCGAGGCCGAGTCGC GGGGCCGAGCCGAGGCCACGTTGAGTCCGAGGCCGAGTCGC Direct Gain 0 0.984796226024628 Functional Gain 0.984796226024628 RIPOR1 ENSG00000039523 UTR5 Human protein_coding chr16:67572130 chr16:67572130 . . 0 21 hm5U_associated_SNPs_23872 0 30598549 Heel bone mineral density 5e-15 GWAS_Catalog TagSNP rs567068501 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
131 chr16 87678441 87678441 1 + C T rs8051448 87678441 + 87678421 87678461 41 GAGTGGGCCAGCAACCGGCGCCATGGCTACGGCTGCATGAC GAGTGGGCCAGCAACCGGCGTCATGGCTACGGCTGCATGAC Direct Gain 0 0.621907353401184 Functional Gain 0.621907353401184 JPH3 ENSG00000154118 CDS Human protein_coding chr16:87678441 chr16:87678441 synonymous SNV . 0 21 hm5U_associated_SNPs_24193 0 29495422 Idiopathic dilated cardiomyopathy 8e-06 GWAS_Catalog TagSNP rs8051448 GCST005588 A Genome-Wide Association Study of Idiopathic Dilated Cardiomyopathy in African Americans.
132 chr16 87678576 87678576 1 + C T rs34975147 87678576 + 87678556 87678596 41 ATCCGCGAGAAGGTGGACCGCGCCGTTGAGGCCGCTGAGCG ATCCGCGAGAAGGTGGACCGTGCCGTTGAGGCCGCTGAGCG Direct Gain 0 0.559176087379456 Functional Gain 0.559176087379456 JPH3 ENSG00000154118 CDS Human protein_coding chr16:87678576 chr16:87678576 synonymous SNV . 0 21 hm5U_associated_SNPs_24195 0 24322204 Bipolar disorder (body mass index interaction) 5e-06 GWAS_Catalog TagSNP rs34975147 GCST002306 Genome-wide association study of bipolar disorder accounting for effect of body mass index identifies a new risk allele in TCF7L2.
133 chr16 89736157 89736157 1 + C T rs35063026 89736157 + 89736137 89736177 41 GAGGGTGCACCAGGCCTGCCCCCGCCGTGAGAAACTGCAGT GAGGGTGCACCAGGCCTGCCTCCGCCGTGAGAAACTGCAGT Direct Gain 0 0.578066170215607 Functional Gain 0.578066170215607 SPATA33 ENSG00000167523 UTR3 Human protein_coding chr16:89736157 chr16:89736157 . . 0 21 hm5U_associated_SNPs_24387 0 25705849 Facial pigmentation 9e-15 GWAS_Catalog TagSNP rs35063026 GCST002785 A Genome-Wide Association Study Identifies the Skin Color Genes IRF4, MC1R, ASIP, and BNC2 Influencing Facial Pigmented Spots.
134 chr16 89985844 89985844 1 + G T rs1805005 89985844 + 89985824 89985864 41 TGGTGGAGAACGCGCTGGTGGTGGCCACCATCGCCAAGAAC TGGTGGAGAACGCGCTGGTGTTGGCCACCATCGCCAAGAAC Direct Gain 0 0.781878709793091 Functional Gain 0.781878709793091 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89985844 chr16:89985844 nonsynonymous SNV 0.718 3 21 hm5U_associated_SNPs_24419 3 30531825 Red vs. brown/black hair color 3e-243 GWAS_Catalog TagSNP rs1805005 GCST006986 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
135 chr16 89986144 89986144 1 + C T rs1805008 89986144 + 89986124 89986164 41 ACAGCATCGTGACCCTGCCGCGGGCGCGGCGAGCCGTTGCG ACAGCATCGTGACCCTGCCGTGGGCGCGGCGAGCCGTTGCG Direct Gain 0 0.557327568531036 Functional Gain 0.557327568531036 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89986144 chr16:89986144 nonsynonymous SNV 0.000 1 21 hm5U_associated_SNPs_24420 6 30038396 Educational attainment (MTAG) 2e-15 GWAS_Catalog TagSNP rs1805008 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
136 chr16 90110950 90110950 1 + C T rs1048149 90110950 + 90110930 90110970 41 TTTCCTGCCCCCTCTTCCTCCAGTAGCCCTCAGTGTCGAAG TTTCCTGCCCCCTCTTCCTCTAGTAGCCCTCAGTGTCGAAG Direct Gain 0 0.658168911933899 Functional Gain 0.658168911933899 URAHP ENSG00000222019 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr16:90110950 chr16:90110950 . . 0 21 hm5U_associated_SNPs_24458 0 17952075 Hair, eye and skin pigmentation 5.7e-10 Johnson and O'Donnell TagSNP rs1048149 . Genetic determinants of hair, eye and skin pigmentation in Europeans.
137 chr17 1673276 1673276 1 + C T rs1136287 1673276 + 1673256 1673296 41 GTACCGGGTGCGATCCAGCACGAGCCCCACGACCAACGTGC GTACCGGGTGCGATCCAGCATGAGCCCCACGACCAACGTGC Direct Gain 0 0.922146737575531 Functional Gain 0.922146737575531 SERPINF1 ENSG00000132386 CDS Human protein_coding chr17:1673276 chr17:1673276 nonsynonymous SNV 0.003 1 21 hm5U_associated_SNPs_24537 1 30072576 Blood protein levels 5e-49 GWAS_Catalog TagSNP rs1136287 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
138 chr17 4835627 4835627 1 + C T rs56337033 4835627 + 4835607 4835647 41 TCGAGTGGCACCCTAGAAGACGCTCTGTGCCTTCGGAGGTC TCGAGTGGCACCCTAGAAGATGCTCTGTGCCTTCGGAGGTC Direct Gain 0 0.816631972789764 Functional Gain 0.816631972789764 GP1BA ENSG00000185245 UTR5 Human protein_coding chr17:4835627 chr17:4835627 . . 0 21 hm5U_associated_SNPs_24639 0 27863252 Platelet distribution width 1e-12 GWAS_Catalog TagSNP rs56337033 GCST004616 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
139 chr17 4836381 4836381 1 + C T rs6065 4836381 + 4836361 4836401 41 CCTGCCCCCAGGGCTCCTGACGCCCACACCCAAGCTGGAGA CCTGCCCCCAGGGCTCCTGATGCCCACACCCAAGCTGGAGA Direct Gain 0 0.849607229232788 Functional Gain 0.849607229232788 GP1BA ENSG00000185245 CDS Human protein_coding chr17:4836381 chr17:4836381 nonsynonymous SNV 0.004 0 21 hm5U_associated_SNPs_24641 2 20139978 Platelet count 2e-12 GWAS_Catalog TagSNP rs6065 GCST000580 Genome-wide association study of hematological and biochemical traits in a Japanese population.
140 chr17 7417640 7417640 1 + C T rs8753 7417640 + 7417620 7417660 41 GCAGAGCTCCCGGTGAACTTCTGGATCCCGTTTCTGATGCA GCAGAGCTCCCGGTGAACTTTTGGATCCCGTTTCTGATGCA Direct Gain 0 0.89852774143219 Functional Gain 0.89852774143219 POLR2A ENSG00000181222 UTR3 Human protein_coding chr17:7417640 chr17:7417640 . . 0 21 hm5U_associated_SNPs_24772 0 26424050 Non-glioblastoma glioma 8e-18 GWAS_Catalog TagSNP rs8753 GCST003227 Genome-wide association study identifies multiple susceptibility loci for glioma.
141 chr17 7417663 7417663 1 + C T rs6761 7417663 + 7417643 7417683 41 GATCCCGTTTCTGATGCAGACTCTTGTCTTGTTCTCCACTT GATCCCGTTTCTGATGCAGATTCTTGTCTTGTTCTCCACTT Direct Gain 0 0.510997831821442 Functional Gain 0.510997831821442 POLR2A ENSG00000181222 UTR3 Human protein_coding chr17:7417663 chr17:7417663 . . 0 21 hm5U_associated_SNPs_24773 0 18464913 Protein quantitative trait loci 3e-07 GWAS_Catalog TagSNP rs6761 GCST000189 A genome-wide association study identifies protein quantitative trait loci (pQTLs).
142 chr17 7554772 7554772 1 + C T rs1642762 7554772 + 7554752 7554792 41 GGGTGTGTGGAGGGCTTCAGCGCGCGGCGCCCCCGCTTCTC GGGTGTGTGGAGGGCTTCAGTGCGCGGCGCCCCCGCTTCTC Direct Gain 0 0.94600784778595 Functional Gain 0.94600784778595 ATP1B2 ENSG00000129244 UTR5 Human protein_coding chr17:7554772 chr17:7554772 . . 0 21 hm5U_associated_SNPs_24793 0 29875488 Blood protein levels 2e-29 GWAS_Catalog TagSNP rs1642762 GCST005806 Genomic atlas of the human plasma proteome.
143 chr17 38119254 38119254 1 + G T rs3902025 38119254 + 38119234 38119274 41 GCCTGTCCTGGCAAGGGATGGTCATCCTCTCAACCTACAGA GCCTGTCCTGGCAAGGGATGTTCATCCTCTCAACCTACAGA Direct Gain 0 0.665025472640991 Functional Gain 0.665025472640991 GSDMA ENSG00000167914 UTR5 Human protein_coding chr17:38119254 chr17:38119254 . . 0 21 hm5U_associated_SNPs_25426 0 24387989 Limited cutaneous systemic scleroderma 2e-06 GWAS_Catalog TagSNP rs3902025 GCST005533 Immunochip analysis identifies multiple susceptibility loci for systemic sclerosis.
144 chr17 38240216 38240216 1 + C T rs2230701 38240216 + 38240196 38240236 41 CGCTTCAAGAAGTGCATCGCCGTGGGCATGGCCATGGACTG CGCTTCAAGAAGTGCATCGCTGTGGGCATGGCCATGGACTG Direct Gain 0 0.688309371471405 Functional Gain 0.688309371471405 THRA ENSG00000126351 CDS Human protein_coding chr17:38240216 chr17:38240216 synonymous SNV . 0 21 hm5U_associated_SNPs_25432 1 30108127 Body mass index 2e-07 GWAS_Catalog TagSNP rs2230701 GCST006368 A Large Multi-ethnic Genome-Wide Association Study of Adult Body Mass Index Identifies Novel Loci.
145 chr17 40913366 40913366 1 + C T rs9892728 40913366 + 40913346 40913386 41 GCAGCGCTCCGCCTCCTCCTCCTGCTGGGCGGTGAGCGCGG GCAGCGCTCCGCCTCCTCCTTCTGCTGGGCGGTGAGCGCGG Direct Gain 0 0.815603196620941 Functional Gain 0.815603196620941 RAMP2 ENSG00000131477 CDS Human protein_coding chr17:40913366 chr17:40913366 synonymous SNV . 0 21 hm5U_associated_SNPs_25509 0 30718926 Type 2 diabetes 4e-08 GWAS_Catalog TagSNP rs9892728 GCST007847 Identification of 28 new susceptibility loci for type 2 diabetes in the Japanese population.
146 chr17 42637488 42637488 1 + C T rs4792948 42637488 + 42637468 42637508 41 CTGCAGGCTGGAAGATCTTTCTCCTGTCTGGCTTCTCTTCT CTGCAGGCTGGAAGATCTTTTTCCTGTCTGGCTTCTCTTCT Direct Gain 0 0.608561456203461 Functional Gain 0.608561456203461 FZD2 ENSG00000180340 downstream Human protein_coding chr17:42637488 chr17:42637488 . . 0 21 hm5U_associated_SNPs_25583 0 17486107 Bipolar disorder 0.0054 Johnson and O'Donnell TagSNP rs4792948 . A genome-wide association study implicates diacylglycerol kinase eta (DGKH) and several other genes in the etiology of bipolar disorder.
147 chr17 48919039 48919039 1 + C T rs3803884 48919039 + 48919019 48919059 41 ATTTCTTCTCCTTGGCTGCACTGGTTTGTCGATCTAGTTCA ATTTCTTCTCCTTGGCTGCATTGGTTTGTCGATCTAGTTCA Direct Gain 0 0.654001235961914 Functional Gain 0.654001235961914 WFIKKN2 ENSG00000173714 UTR3 Human protein_coding chr17:48919039 chr17:48919039 . . 0 21 hm5U_associated_SNPs_25813 0 28240269 Blood protein levels 1e-40 GWAS_Catalog TagSNP rs3803884 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
148 chr17 78178893 78178893 1 + C T rs11652075 78178893 + 78178873 78178913 41 TGGTGCCCTATACCCTGGTGCGGCCCCATCGACCCGCCCGG TGGTGCCCTATACCCTGGTGTGGCCCCATCGACCCGCCCGG Direct Gain 0 0.883184790611267 Functional Gain 0.883184790611267 CARD14 ENSG00000141527 CDS Human protein_coding chr17:78178893 chr17:78178893 nonsynonymous SNV 0.297 1 21 hm5U_associated_SNPs_26483 1 23143594 Psoriasis 3e-08 GWAS_Catalog TagSNP rs11652075 GCST005527 Identification of 15 new psoriasis susceptibility loci highlights the role of innate immunity.
149 chr17 78939964 78939964 1 + C T rs1045626 78939964 + 78939944 78939984 41 GAGCCCACCCCCATGGGCACCGCGTGCCGCCTGCACGTGGG GAGCCCACCCCCATGGGCACTGCGTGCCGCCTGCACGTGGG Direct Gain 0 0.689290881156921 Functional Gain 0.689290881156921 RPTOR ENSG00000141564 UTR3 Human protein_coding chr17:78939964 chr17:78939964 . . 0 21 hm5U_associated_SNPs_26559 0 30038396 Educational attainment (MTAG) 8e-09 GWAS_Catalog TagSNP rs1045626 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
150 chr17 79090198 79090198 1 + C T rs62073016 79090198 + 79090178 79090218 41 TGCCCCTCGGTGGGGCTCTCCTGGGCCCCTCACTCCCACTG TGCCCCTCGGTGGGGCTCTCTTGGGCCCCTCACTCCCACTG Direct Gain 0 0.674510955810547 Functional Gain 0.674510955810547 BAIAP2 ENSG00000175866 UTR3 Human protein_coding chr17:79090198 chr17:79090198 . . 0 21 hm5U_associated_SNPs_26585 0 30593698 Fat-free mass 6e-11 GWAS_Catalog TagSNP rs62073016 GCST007063 Genomics of body fat percentage may contribute to sex bias in anorexia nervosa.
151 chr18 67992432 67992432 1 + C T rs2231563 67992432 + 67992412 67992452 41 GGCGTCCGGAAGGATTTCCACGACCTCCAGTCTGAGACCAC GGCGTCCGGAAGGATTTCCATGACCTCCAGTCTGAGACCAC Direct Gain 0 0.855081915855408 Functional Gain 0.855081915855408 SOCS6 ENSG00000170677 CDS Human protein_coding chr18:67992432 chr18:67992432 synonymous SNV . 0 21 hm5U_associated_SNPs_27158 0 17554300 Multiple complex diseases 5.1e-05 Johnson and O'Donnell TagSNP rs2231563 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
152 chr19 579100 579100 1 + C T rs2283573 579100 + 579080 579120 41 CTGGGGCTGCTACAAGAGCTCGATGCCCTGGTCCCTGCTCA CTGGGGCTGCTACAAGAGCTTGATGCCCTGGTCCCTGCTCA Direct Gain 0 0.724524855613708 Functional Gain 0.724524855613708 BSG ENSG00000172270 intronic Human protein_coding chr19:579100 chr19:579100 . . 0 21 hm5U_associated_SNPs_27268 0 17554300 Multiple complex diseases 5.01e-06 Johnson and O'Donnell TagSNP rs2283573 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
153 chr19 1026477 1026477 1 + G T rs4807440 1026477 + 1026457 1026497 41 GTCCGGGGGCGACCGAGGGGGCTCAGGAAGTCCGCGGCCGC GTCCGGGGGCGACCGAGGGGTCTCAGGAAGTCCGCGGCCGC Direct Gain 0 0.947900056838989 Functional Gain 0.947900056838989 CNN2 ENSG00000064666 UTR5 Human protein_coding chr19:1026477 chr19:1026477 . . 0 21 hm5U_associated_SNPs_27367 0 27863252 Monocyte count 3e-11 GWAS_Catalog TagSNP rs4807440 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
154 chr19 1205889 1205889 1 + C T rs147615524 1205889 + 1205869 1205909 41 CGGGTGGCGGCACTTGCTGCCGCGGCCTTGGATGGGCTGGG CGGGTGGCGGCACTTGCTGCTGCGGCCTTGGATGGGCTGGG Direct Gain 0 0.64623087644577 Functional Gain 0.64623087644577 STK11 ENSG00000118046 UTR5 Human protein_coding chr19:1205889 chr19:1205889 . . 0 21 hm5U_associated_SNPs_27415 1 24324551 PR interval in Tripanosoma cruzi seropositivity 2e-06 GWAS_Catalog TagSNP rs147615524 GCST002279 Genome wide association study (GWAS) of Chagas cardiomyopathy in Trypanosoma cruzi seropositive subjects.
155 chr19 2249477 2249477 1 + G T rs10407022 2249477 + 2249457 2249497 41 CTTGGACTGGCCTCCAGGCAGCCCACAAGAGCCTCTGTGCC CTTGGACTGGCCTCCAGGCATCCCACAAGAGCCTCTGTGCC Direct Gain 0 0.744202196598053 Functional Gain 0.744202196598053 AMH ENSG00000104899 CDS Human protein_coding chr19:2249477 chr19:2249477 nonsynonymous SNV 0.001 2 21 hm5U_associated_SNPs_27564 0 27618447 Pulse pressure 3e-08 GWAS_Catalog TagSNP rs10407022 GCST006022 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
156 chr19 6857245 6857245 1 + C T rs56100731 6857245 + 6857225 6857265 41 GATGGACTGGAGGAGGCCAGCGTCCAGCTGGCGGTGCTCCC GATGGACTGGAGGAGGCCAGTGTCCAGCTGGCGGTGCTCCC Direct Gain 0 0.907329201698303 Functional Gain 0.907329201698303 VAV1 ENSG00000141968 UTR3 Human protein_coding chr19:6857245 chr19:6857245 . . 0 21 hm5U_associated_SNPs_27848 0 30072576 Blood protein levels 6e-14 GWAS_Catalog TagSNP rs56100731 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
157 chr19 11350488 11350488 1 + C T rs2278426 11350488 + 11350468 11350508 41 TGTACAGGACCACGGAGGGACGGCTGACAAAGGCCAGGAAC TGTACAGGACCACGGAGGGATGGCTGACAAAGGCCAGGAAC Direct Gain 0 0.728179574012756 Functional Gain 0.728179574012756 ANGPTL8 ENSG00000130173 CDS Human protein_coding chr19:11350488 chr19:11350488 nonsynonymous SNV 0.526 2 21 hm5U_associated_SNPs_28093 0 23505323 HDL cholesterol 3e-09 GWAS_Catalog TagSNP rs2278426 GCST001904 Genomic study in Mexicans identifies a new locus for triglycerides and refines European lipid loci.
158 chr19 21666210 21666210 1 + C T rs2562456 21666210 + 21666190 21666230 41 TTTGAGGCTCTGGCCGATTTCTTTTCCCAAGTCCCCATGGA TTTGAGGCTCTGGCCGATTTTTTTTCCCAAGTCCCCATGGA Direct Gain 0 0.907192349433899 Functional Gain 0.907192349433899 LINC00664 ENSG00000268658 ncRNA_exonic Human lincRNA chr19:21666210 chr19:21666210 . . 0 21 hm5U_associated_SNPs_28626 0 19207018 Pain 2e-10 GWAS_Catalog TagSNP rs2562456 GCST000326 Genome-wide association study of acute post-surgical pain in humans.
159 chr19 33635761 33635761 1 + C T rs3848596 33635761 + 33635741 33635781 41 TGATTTGAGGATCCGGTGGACGGTTCTGTGGTTCGCGATTT TGATTTGAGGATCCGGTGGATGGTTCTGTGGTTCGCGATTT Direct Gain 0 0.716507792472839 Functional Gain 0.716507792472839 WDR88 ENSG00000166359 CDS Human protein_coding chr19:33635761 chr19:33635761 synonymous SNV . 0 21 hm5U_associated_SNPs_28690 0 17463246 Multiple continuous traits in DGI samples 0.0003427 Johnson and O'Donnell TagSNP rs3848596 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
160 chr19 38778569 38778569 1 + C T rs141683432 38778569 + 38778549 38778589 41 ATGCAGCGGATTCCTCTGTCCCAAGTGGTAGGTTCTTAAAG ATGCAGCGGATTCCTCTGTCTCAAGTGGTAGGTTCTTAAAG Direct Gain 0 0.792870461940765 Functional Gain 0.792870461940765 SPINT2 ENSG00000167642 CDS Human protein_coding chr19:38778569 chr19:38778569 nonsynonymous SNV 0.989 0 21 hm5U_associated_SNPs_28924 0 27989323 Stromal-cell-derived factor 1 alpha levels 1e-06 GWAS_Catalog TagSNP rs141683432 GCST004427 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
161 chr19 41302706 41302706 1 + C T rs7937 41302706 + 41302686 41302726 41 CCCCTGAACCCCTAACCATACCCCAAGAGCTCCCAAAGCCT CCCCTGAACCCCTAACCATATCCCAAGAGCTCCCAAAGCCT Direct Gain 0 0.838300466537476 Functional Gain 0.838300466537476 MIA-RAB4B ENSG00000167578 UTR3 Human protein_coding chr19:41302706 chr19:41302706 . . 0 21 hm5U_associated_SNPs_29088 0 22080838 Chronic obstructive pulmonary disease 3e-09 GWAS_Catalog TagSNP rs7937 GCST001321 A genome-wide association study of COPD identifies a susceptibility locus on chromosome 19q13.
162 chr19 41305138 41305138 1 + G T rs184088518 41305138 + 41305118 41305158 41 GCAGGGCGGCTGGCACAAACGGCGGCGCCGGGGCCGGAGGA GCAGGGCGGCTGGCACAAACTGCGGCGCCGGGGCCGGAGGA Direct Gain 0 0.902860641479492 Functional Gain 0.902860641479492 RAB4B-EGLN2 ENSG00000269858 UTR5 Human protein_coding chr19:41305138 chr19:41305138 . . 0 21 hm5U_associated_SNPs_29091 0 27863252 Hemoglobin concentration 4e-16 GWAS_Catalog TagSNP rs184088518 GCST004615 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
163 chr19 45147340 45147340 1 + G T rs11540084 45147340 + 45147320 45147360 41 GCGACCGCGGCAGAGCGAGCGGGCGCCGGGAAGCGAGGAGA GCGACCGCGGCAGAGCGAGCTGGCGCCGGGAAGCGAGGAGA Direct Gain 0 0.844147920608521 Functional Gain 0.844147920608521 PVR ENSG00000266903 ncRNA_intronic Human antisense chr19:45147340 chr19:45147340 . . 0 21 hm5U_associated_SNPs_29236 0 27863252 Mean platelet volume 1e-17 GWAS_Catalog TagSNP rs11540084 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
164 chr19 45296806 45296806 1 + C T rs3208856 45296806 + 45296786 45296826 41 CCGTGAGTATCTACCAGTTCCACGGTCAGGCTACTGCTGAG CCGTGAGTATCTACCAGTTCTACGGTCAGGCTACTGCTGAG Direct Gain 0 0.638869285583496 Functional Gain 0.638869285583496 CBLC ENSG00000142273 CDS Human protein_coding chr19:45296806 chr19:45296806 nonsynonymous SNV 0.005 1 21 hm5U_associated_SNPs_29256 0 29507422 Total cholesterol levels 1e-41 GWAS_Catalog TagSNP rs3208856 GCST007143 A large electronic-health-record-based genome-wide study of serum lipids.
165 chr19 45392254 45392254 1 + C T rs6857 45392254 + 45392234 45392274 41 ACCAAGCAAGCAGCCCCAGCCTAGGGTCAGACAGGGTGAGC ACCAAGCAAGCAGCCCCAGCTTAGGGTCAGACAGGGTGAGC Direct Gain 0 0.857054710388184 Functional Gain 0.857054710388184 NECTIN2 ENSG00000267282 ncRNA_intronic Human antisense chr19:45392254 chr19:45392254 . . 0 21 hm5U_associated_SNPs_29271 0 23419831 Alzheimer's disease biomarkers 1e-10 GWAS_Catalog TagSNP rs6857 GCST001868 APOE and BCHE as modulators of cerebral amyloid deposition: a florbetapir PET genome-wide association study.
166 chr19 45396144 45396144 1 + C T rs11556505 45396144 + 45396124 45396164 41 GGGGAGTCCAACTACCACTTCGGGGTCACATATGTGGGGAC GGGGAGTCCAACTACCACTTTGGGGTCACATATGTGGGGAC Direct Gain 0 0.683111429214478 Functional Gain 0.683111429214478 TOMM40 ENSG00000130204 CDS Human protein_coding chr19:45396144 chr19:45396144 synonymous SNV . 0 21 hm5U_associated_SNPs_29273 0 30361487 Cerebral amyloid deposition (PET imaging) 2e-15 GWAS_Catalog TagSNP rs11556505 GCST006904 Genome-wide association study of brain amyloid deposition as measured by Pittsburgh Compound-B (PiB)-PET imaging.
167 chr19 45412040 45412040 1 + C T rs769455 45412040 + 45412020 45412060 41 CCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGAT CCTCCCACCTGCGCAAGCTGTGTAAGCGGCTCCTCCGCGAT Direct Gain 0 0.666913211345673 Functional Gain 0.666913211345673 APOE ENSG00000130203 CDS Human protein_coding chr19:45412040 chr19:45412040 nonsynonymous SNV 0.993 3 21 hm5U_associated_SNPs_29280 2 29507422 Triglycerides 1e-09 GWAS_Catalog TagSNP rs769455 GCST007142 A large electronic-health-record-based genome-wide study of serum lipids.
168 chr19 45412079 45412079 1 + C T rs7412 45412079 + 45412059 45412099 41 ATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCC ATGCCGATGACCTGCAGAAGTGCCTGGCAGTGTACCAGGCC Direct Gain 0 0.932675838470459 Functional Gain 0.932675838470459 APOE ENSG00000130203 CDS Human protein_coding chr19:45412079 chr19:45412079 nonsynonymous SNV 0.965 4 21 hm5U_associated_SNPs_29281 6 22286219 Lipid metabolism phenotypes 3e-58 GWAS_Catalog TagSNP rs7412 GCST001392 Genome-wide association study identifies multiple loci influencing human serum metabolite levels.
169 chr19 50016748 50016748 1 + C T rs59774409 50016748 + 50016728 50016768 41 CAGGTGAGGGCCGCTCCGGGCCAGGGCCCTGCTGCAGGCGG CAGGTGAGGGCCGCTCCGGGTCAGGGCCCTGCTGCAGGCGG Direct Gain 0 0.869209051132202 Functional Gain 0.869209051132202 FCGRT ENSG00000104870 intronic Human protein_coding chr19:50016748 chr19:50016748 . . 0 21 hm5U_associated_SNPs_29601 0 29507422 Triglycerides 8e-09 GWAS_Catalog TagSNP rs59774409 GCST007142 A large electronic-health-record-based genome-wide study of serum lipids.
170 chr19 51228746 51228746 1 + C T rs13866 51228746 + 51228726 51228766 41 GGGGCCGGTACCCCGCCTCCCTGCCCATCCCACCACCCGGC GGGGCCGGTACCCCGCCTCCTTGCCCATCCCACCACCCGGC Direct Gain 0 0.877092242240906 Functional Gain 0.877092242240906 CLEC11A ENSG00000105472 UTR3 Human protein_coding chr19:51228746 chr19:51228746 . . 0 21 hm5U_associated_SNPs_29733 0 30072576 Blood protein levels 4e-09 GWAS_Catalog TagSNP rs13866 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
171 chr19 51383200 51383200 1 + G T rs80050017 51383200 + 51383180 51383220 41 CAGGGGATGAGGGAAAGGGAGAGGATGAGGAAGCCCCCCTG CAGGGGATGAGGGAAAGGGATAGGATGAGGAAGCCCCCCTG Direct Gain 0 0.783758223056793 Functional Gain 0.783758223056793 KLK2 ENSG00000167751 UTR3 Human protein_coding chr19:51383200 chr19:51383200 . . 0 21 hm5U_associated_SNPs_29739 0 26219847 Tandem gait 4e-07 GWAS_Catalog TagSNP rs80050017 GCST003055 Heritability and Genome-Wide Association Analyses of Human Gait Suggest Contribution of Common Variants.
172 chr19 55993436 55993436 1 + G T rs147110934 55993436 + 55993416 55993456 41 GCGGCGGAGACCACGGTGGAGCTGGTGTACCGCTGCGATGG GCGGCGGAGACCACGGTGGATCTGGTGTACCGCTGCGATGG Direct Gain 0 0.893891334533691 Functional Gain 0.893891334533691 ZNF628 ENSG00000197483 CDS Human protein_coding chr19:55993436 chr19:55993436 nonsynonymous SNV 0.952 0 21 hm5U_associated_SNPs_29970 0 30593698 Fat-free mass 8e-09 GWAS_Catalog TagSNP rs147110934 GCST007063 Genomics of body fat percentage may contribute to sex bias in anorexia nervosa.
173 chr19 58992001 58992001 1 + C T rs58632700 58992001 + 58991981 58992021 41 GCAAGAGCCACACAGGCCAGCGGCGTCACTTCTGCAGTGAC GCAAGAGCCACACAGGCCAGTGGCGTCACTTCTGCAGTGAC Direct Gain 0 0.74433958530426 Functional Gain 0.74433958530426 ZNF446 ENSG00000083838 CDS Human protein_coding chr19:58992001 chr19:58992001 nonsynonymous SNV 0.995 2 21 hm5U_associated_SNPs_30136 0 23251661 Obesity-related traits 1e-07 GWAS_Catalog TagSNP rs58632700 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
174 chr20 43042364 43042364 1 + C T rs1800961 43042364 + 43042344 43042384 41 TGAGCGGGACCGGATCAGCACTCGAAGGTCAAGCTATGAGG TGAGCGGGACCGGATCAGCATTCGAAGGTCAAGCTATGAGG Direct Gain 0 0.852504253387451 Functional Gain 0.852504253387451 HNF4A ENSG00000101076 CDS Human protein_coding chr20:43042364 chr20:43042364 nonsynonymous SNV 0.662 2 21 hm5U_associated_SNPs_30707 4 20686565 HDL cholesterol 1e-15 GWAS_Catalog TagSNP rs1800961 GCST000755 Biological, clinical and population relevance of 95 loci for blood lipids.
175 chr20 62729431 62729431 1 + C T rs2229205 62729431 + 62729411 62729451 41 TCCAGCAAAGCCCAGGCTGTCAATGTGGCCATCTGGGCCCT TCCAGCAAAGCCCAGGCTGTTAATGTGGCCATCTGGGCCCT Direct Gain 0 0.954325079917908 Functional Gain 0.954325079917908 OPRL1 ENSG00000125510 CDS Human protein_coding chr20:62729431 chr20:62729431 synonymous SNV . 0 21 hm5U_associated_SNPs_31224 0 26112879 LDL peak particle diameter (total fat intake interaction) 7e-06 GWAS_Catalog TagSNP rs2229205 GCST002989 Interaction between Common Genetic Variants and Total Fat Intake on Low-Density Lipoprotein Peak Particle Diameter: A Genome-Wide Association Study.
176 chr21 37692507 37692507 1 + C T rs62229372 37692507 + 37692487 37692527 41 AGGGCTCCACAGTCGTTCCGCCACCTCCCAGTCGGGTTGCG AGGGCTCCACAGTCGTTCCGTCACCTCCCAGTCGGGTTGCG Direct Gain 0 0.955086052417755 Functional Gain 0.955086052417755 MORC3 ENSG00000273199 ncRNA_exonic Human antisense chr21:37692507 chr21:37692507 . . 0 21 hm5U_associated_SNPs_31338 0 30595370 Systolic blood pressure 2e-08 GWAS_Catalog TagSNP rs62229372 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
177 chr21 43442991 43442991 1 + C T rs118131263 43442991 + 43442971 43443011 41 AAAGAGCCTGTGCCCGGGCGCGGAGGCTCACGCCTAGAATC AAAGAGCCTGTGCCCGGGCGTGGAGGCTCACGCCTAGAATC Direct Gain 0 0.841631054878235 Functional Gain 0.841631054878235 ZNF295-AS1 ENSG00000237232 ncRNA_exonic Human lincRNA chr21:43442991 chr21:43442991 . . 0 21 hm5U_associated_SNPs_31411 0 28584286 Cognitive empathy 3e-06 GWAS_Catalog TagSNP rs118131263 GCST005755 Genome-wide meta-analysis of cognitive empathy: heritability, and correlates with sex, neuropsychiatric conditions and cognition.
178 chr21 44871148 44871148 1 + C T rs55946466 44871148 + 44871128 44871168 41 TCATCGCTGGGCCCACACGCCGCCGACAGCTTCCGCGTGTG TCATCGCTGGGCCCACACGCTGCCGACAGCTTCCGCGTGTG Direct Gain 0 0.818506062030792 Functional Gain 0.818506062030792 LINC00319 ENSG00000188660 ncRNA_exonic Human lincRNA chr21:44871148 chr21:44871148 . . 0 21 hm5U_associated_SNPs_31460 0 29855589 Velopharyngeal dysfunction 1e-06 GWAS_Catalog TagSNP rs55946466 GCST006280 GWAS reveals loci associated with velopharyngeal dysfunction.
179 chr21 45182064 45182064 1 + C T rs1299 45182064 + 45182044 45182084 41 GCCTGGAGTGGCCGGCCCTGCTTGTGCCATGTGGATGTTTG GCCTGGAGTGGCCGGCCCTGTTTGTGCCATGTGGATGTTTG Direct Gain 0 0.944952070713043 Functional Gain 0.944952070713043 PDXK ENSG00000160209 UTR3 Human protein_coding chr21:45182064 chr21:45182064 . . 0 21 hm5U_associated_SNPs_31499 0 16252231 Parkinson's disease 0.045228 Johnson and O'Donnell TagSNP rs1299 . High-resolution whole-genome association study of Parkinson disease.
180 chr21 46348764 46348764 1 + A T rs4818988 46348764 + 46348744 46348784 41 CACCCTGGATGCCTGTGGGCAGCCTTCCTCACCCTGGATGC CACCCTGGATGCCTGTGGGCTGCCTTCCTCACCCTGGATGC Direct Gain 0 0.853068590164185 Functional Gain 0.853068590164185 ITGB2-AS1 ENSG00000227039 ncRNA_exonic Human antisense chr21:46348764 chr21:46348764 . . 0 21 hm5U_associated_SNPs_31591 0 28869591 Heel bone mineral density 3e-07 GWAS_Catalog TagSNP rs4818988 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
181 chr22 19712094 19712094 1 + C T rs1059196 19712094 + 19712074 19712114 41 CGCGCCAACCTGGACCGGTCCCCGCCTCCTCCGCTGCCCAA CGCGCCAACCTGGACCGGTCTCCGCCTCCTCCGCTGCCCAA Direct Gain 0 0.89963972568512 Functional Gain 0.89963972568512 SEPT5-GP1BB ENSG00000184702;ENSG00000203618 UTR3 Human other chr22:19712094 chr22:19712094 . . 0 21 hm5U_associated_SNPs_31815 0 27863252 Mean platelet volume 2e-21 GWAS_Catalog TagSNP rs1059196 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
182 chr22 22049783 22049783 1 + C T rs12484060 22049783 + 22049763 22049803 41 ACTTCAGCTCCTGGTAGCAGCAGGTTGGCCGCTGTGGACCT ACTTCAGCTCCTGGTAGCAGTAGGTTGGCCGCTGTGGACCT Direct Gain 0 0.918439507484436 Functional Gain 0.918439507484436 PPIL2 ENSG00000100023 CDS Human protein_coding chr22:22049783 chr22:22049783 nonsynonymous SNV . 0 21 hm5U_associated_SNPs_31994 0 17554300 Multiple complex diseases 0.000310468 Johnson and O'Donnell TagSNP rs12484060 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
183 chr22 42666026 42666026 1 + C T rs187166731 42666026 + 42666006 42666046 41 CACCCAAGGCCTCGCGCGACCAGCAGGTAGACCTTCCCTCC CACCCAAGGCCTCGCGCGACTAGCAGGTAGACCTTCCCTCC Direct Gain 0 0.93047833442688 Functional Gain 0.93047833442688 OGFRP1 ENSG00000182057 ncRNA_exonic Human lincRNA chr22:42666026 chr22:42666026 . . 0 21 hm5U_associated_SNPs_32655 0 27989323 Interleukin-1-receptor antagonist levels 5e-06 GWAS_Catalog TagSNP rs187166731 GCST004447 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
184 chr1 2494330 2494330 1 + G A rs2234167 2494330 - 2494310 2494350 41 GAGGAGGATCAATACCTGGACGGAGACGATCACCTTGACTA GAGGAGGATCAATACCTGGATGGAGACGATCACCTTGACTA Direct Gain 0 0.738068819046021 Functional Gain 0.738068819046021 TNFRSF14 ENSG00000157873 CDS Human protein_coding chr1:2494330 chr1:2494330 nonsynonymous SNV 0.000 1 21 hm5U_associated_SNPs_179730 1 31015401 Medication use (thyroid preparations) 9e-10 GWAS_Catalog TagSNP rs2234167 GCST007932 Genome-wide association study of medication-use and associated disease in the UK Biobank.
185 chr1 3649562 3649562 1 + G A rs9662633 3649562 - 3649542 3649582 41 GGCAGGTCGAAGCCGAAGTCCGCCCACTCGTCAGGGCCGCC GGCAGGTCGAAGCCGAAGTCTGCCCACTCGTCAGGGCCGCC Direct Gain 0 0.546568393707275 Functional Gain 0.546568393707275 TP73 ENSG00000078900 CDS Human protein_coding chr1:3649562 chr1:3649562 synonymous SNV . 0 21 hm5U_associated_SNPs_179811 0 22589738 Visceral adipose tissue adjusted for BMI 6e-06 GWAS_Catalog TagSNP rs9662633 GCST001523 Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women.
186 chr1 3651409 3651409 1 + G A rs10910018 3651409 - 3651389 3651429 41 GCAGCCAGATCCCCTGAGAGCCGACAGCCCCGTTCCTGCTG GCAGCCAGATCCCCTGAGAGTCGACAGCCCCGTTCCTGCTG Direct Gain 0 0.857759833335876 Functional Gain 0.857759833335876 TP73 ENSG00000078900 UTR3 Human protein_coding chr1:3651409 chr1:3651409 . . 0 21 hm5U_associated_SNPs_179819 0 22589738 Visceral fat 2e-06 GWAS_Catalog TagSNP rs10910018 GCST001525 Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women.
187 chr1 3669356 3669356 1 + G A rs76597070 3669356 - 3669336 3669376 41 CGGGACCCCATACCGTCTTCCTGTAGTAGCGGCTGATGGTC CGGGACCCCATACCGTCTTCTTGTAGTAGCGGCTGATGGTC Direct Gain 0 0.63482141494751 Functional Gain 0.63482141494751 CCDC27 ENSG00000162592 CDS Human protein_coding chr1:3669356 chr1:3669356 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_179826 0 23251661 Obesity-related traits 3e-06 GWAS_Catalog TagSNP rs76597070 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
188 chr1 11838762 11838762 1 + G A rs72640211 11838762 - 11838742 11838782 41 GCCCTCAAGTGCCACCATCTCAGGCTGCGCTGCAGCATCCG GCCCTCAAGTGCCACCATCTTAGGCTGCGCTGCAGCATCCG Direct Gain 0 0.810525953769684 Functional Gain 0.810525953769684 C1orf167 ENSG00000215910 CDS Human protein_coding chr1:11838762 chr1:11838762 synonymous SNV . 0 21 hm5U_associated_SNPs_180101 0 29912962 Pulse pressure x alcohol consumption interaction (2df test) 1e-13 GWAS_Catalog TagSNP rs72640211 GCST006168 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
189 chr1 12175658 12175658 1 + G A rs2230624 12175658 - 12175638 12175678 41 TGCGGGAGGAGTTCCATGCACATGGCGTCTTCTCCACAAGG TGCGGGAGGAGTTCCATGCATATGGCGTCTTCTCCACAAGG Direct Gain 0 0.583286583423615 Functional Gain 0.583286583423615 TNFRSF8 ENSG00000120949 CDS Human protein_coding chr1:12175658 chr1:12175658 nonsynonymous SNV 0.002 4 21 hm5U_associated_SNPs_180139 0 28199695 Mosquito bite size 4e-08 GWAS_Catalog TagSNP rs2230624 GCST004863 GWAS of self-reported mosquito bite size, itch intensity and attractiveness to mosquitoes implicates immune-related predisposition loci.
190 chr1 15793913 15793913 1 + G A rs1042010 15793913 - 15793893 15793933 41 ACCTGCCACCGGCCGTCAGACGCCTGACAGTTCAGTGGCCC ACCTGCCACCGGCCGTCAGATGCCTGACAGTTCAGTGGCCC Direct Gain 0 0.818112373352051 Functional Gain 0.818112373352051 CELA2A ENSG00000142615 CDS Human protein_coding chr1:15793913 chr1:15793913 synonymous SNV . 0 21 hm5U_associated_SNPs_180249 0 28739976 Systolic blood pressure 4e-07 GWAS_Catalog TagSNP rs1042010 GCST004776 Novel Blood Pressure Locus and Gene Discovery Using Genome-Wide Association Study and Expression Data Sets From Blood and the Kidney.
191 chr1 15808872 15808872 1 + G A rs3766160 15808872 - 15808852 15808892 41 GAACCCTTTGGAGACCTGGTCGGAGTTCCAGTCCTTGTGCA GAACCCTTTGGAGACCTGGTTGGAGTTCCAGTCCTTGTGCA Direct Gain 0 0.984156131744385 Functional Gain 0.984156131744385 CELA2B ENSG00000215704 CDS Human protein_coding chr1:15808872 chr1:15808872 nonsynonymous SNV 0.000 1 21 hm5U_associated_SNPs_180252 0 30237584 Resistant hypertension 1e-06 GWAS_Catalog TagSNP rs3766160 GCST007135 Genome-wide association analysis of common genetic variants of resistant hypertension.
192 chr1 17674537 17674537 1 + C A rs2240335 17674537 - 17674517 17674557 41 CCCCATGCAGGTACCATCACGCGTTTGATGGGAAACTCCTT CCCCATGCAGGTACCATCACTCGTTTGATGGGAAACTCCTT Direct Gain 0 0.678547620773315 Functional Gain 0.678547620773315 PADI4 ENSG00000159339 CDS Human protein_coding chr1:17674537 chr1:17674537 synonymous SNV . 0 21 hm5U_associated_SNPs_180415 0 21505073 Rheumatoid arthritis 2e-08 GWAS_Catalog TagSNP rs2240335 GCST001042 The human AIRE gene at chromosome 21q22 is a genetic determinant for the predisposition to rheumatoid arthritis in Japanese population.
193 chr1 18808292 18808292 1 + C A rs2992753 18808292 - 18808272 18808312 41 CTCCGCCTTCTGTATGAAATGCTCCTCCATTCGGACGCGGG CTCCGCCTTCTGTATGAAATTCTCCTCCATTCGGACGCGGG Direct Gain 0 0.543541729450226 Functional Gain 0.543541729450226 KLHDC7A ENSG00000179023 CDS Human protein_coding chr1:18808292 chr1:18808292 nonsynonymous SNV 0.947 0 21 hm5U_associated_SNPs_180460 0 30275531 LDL cholesterol 5e-09 GWAS_Catalog TagSNP rs2992753 GCST006612 Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program.
194 chr1 22895820 22895820 1 + G A rs45498698 22895820 - 22895800 22895840 41 AGCCGGATACGTGAGCCAGCCCCAGTCCCCGTGGATGGTCG AGCCGGATACGTGAGCCAGCTCCAGTCCCCGTGGATGGTCG Direct Gain 0 0.946500957012177 Functional Gain 0.946500957012177 EPHA8 ENSG00000070886 CDS Human protein_coding chr1:22895820 chr1:22895820 nonsynonymous SNV 1.000 4 21 hm5U_associated_SNPs_180606 0 27989323 Interferon gamma levels 1e-08 GWAS_Catalog TagSNP rs45498698 GCST004456 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
195 chr1 39995074 39995074 1 + C A rs755249 39995074 - 39995054 39995094 41 CTCAGCAGAGACCCTAGCGCGTGGGTCACTGCTGGCCCAGA CTCAGCAGAGACCCTAGCGCTTGGGTCACTGCTGGCCCAGA Direct Gain 0 0.680026590824127 Functional Gain 0.680026590824127 PPIEL ENSG00000182109 ncRNA_intronic Human antisense chr1:39995074 chr1:39995074 . . 0 21 hm5U_associated_SNPs_181116 0 27082954 Peripheral arterial disease (traffic-related air pollution interaction) 2e-08 GWAS_Catalog TagSNP rs755249 GCST004482 Genetic Variants in the Bone Morphogenic Protein Gene Family Modify the Association between Residential Exposure to Traffic and Peripheral Arterial Disease.
196 chr1 42880516 42880516 1 + T A rs1055055 42880516 - 42880496 42880536 41 CCCAGTTCAGGCTCACTTTCACTAGAGGTAGACCCACTGTT CCCAGTTCAGGCTCACTTTCTCTAGAGGTAGACCCACTGTT Direct Gain 0 0.564967215061188 Functional Gain 0.564967215061188 RIMKLA ENSG00000177181 CDS Human protein_coding chr1:42880516 chr1:42880516 nonsynonymous SNV 0.899 3 21 hm5U_associated_SNPs_181150 0 17463246 Multiple continuous traits in DGI samples 0.0005965 Johnson and O'Donnell TagSNP rs1055055 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
197 chr1 43699970 43699970 1 + G A rs2484714 43699970 - 43699950 43699990 41 TCTGTTTTAAACCTTTTGACCAGCGCTTCCAAGTCTCGCTC TCTGTTTTAAACCTTTTGACTAGCGCTTCCAAGTCTCGCTC Direct Gain 0 0.824351191520691 Functional Gain 0.824351191520691 CFAP57 ENSG00000243710 CDS Human protein_coding chr1:43699970 chr1:43699970 synonymous SNV . 0 21 hm5U_associated_SNPs_181183 0 17998437 Alzheimer's disease 2.56e-05 Johnson and O'Donnell TagSNP rs2484714 . Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.
198 chr1 43919486 43919486 1 + C A rs182798940 43919486 - 43919466 43919506 41 CTTTGGATCCCGCGGACTCCGCCCGGCCCGGCCTCCCCAGG CTTTGGATCCCGCGGACTCCTCCCGGCCCGGCCTCCCCAGG Direct Gain 0 0.916134357452393 Functional Gain 0.916134357452393 HYI;SZT2 ENSG00000178922 UTR5 Human protein_coding chr1:43919486 chr1:43919486 . . 0 21 hm5U_associated_SNPs_181218 0 26830138 Alzheimer disease and age of onset 7e-07 GWAS_Catalog TagSNP rs182798940 GCST003427 Family-based association analyses of imputed genotypes reveal genome-wide significant association of Alzheimer's disease with OSBPL6, PTPRG, and PDCL3.
199 chr1 44087925 44087925 1 + G A rs72673097 44087925 - 44087905 44087945 41 GCGCAACAGAGAGCTTGAAGCGGGCTCCAGGTGGGTCTGGT GCGCAACAGAGAGCTTGAAGTGGGCTCCAGGTGGGTCTGGT Direct Gain 0 0.859636068344116 Functional Gain 0.859636068344116 PTPRF ENSG00000142949 UTR3 Human protein_coding chr1:44087925 chr1:44087925 . . 0 21 hm5U_associated_SNPs_181229 0 30038396 Educational attainment (years of education) 9e-10 GWAS_Catalog TagSNP rs72673097 GCST006442 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
200 chr1 55505647 55505647 1 + G A rs11591147 55505647 - 55505627 55505667 41 CCAGGCCGTCCTCCTCGGAACGCAAGGCTAGCACCAGCTCC CCAGGCCGTCCTCCTCGGAATGCAAGGCTAGCACCAGCTCC Direct Gain 0 0.774921417236328 Functional Gain 0.774921417236328 PCSK9 ENSG00000169174 CDS Human protein_coding chr1:55505647 chr1:55505647 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_181475 0 22331829 Response to statins (LDL cholesterol change) 5e-09 GWAS_Catalog TagSNP rs11591147 GCST001408 Genetic determinants of statin-induced low-density lipoprotein cholesterol reduction: the Justification for the Use of Statins in Prevention: an Intervention Trial Evaluating Rosuvastatin (JUPITER) trial.
201 chr1 55529215 55529215 1 + C A rs28362286 55529215 - 55529195 55529235 41 TGCGCCAGGTGCCGGCTCCGGCAGCAGATGGCAACGGCTGT TGCGCCAGGTGCCGGCTCCGTCAGCAGATGGCAACGGCTGT Direct Gain 0 0.526047885417938 Functional Gain 0.526047885417938 PCSK9 ENSG00000169174 CDS Human protein_coding chr1:55529215 chr1:55529215 stopgain 0.974 1 21 hm5U_associated_SNPs_181483 1 31217584 Low density lipoprotein cholesterol levels 3e-42 GWAS_Catalog TagSNP rs28362286 GCST008037 Genetic analyses of diverse populations improves discovery for complex traits.
202 chr1 67648596 67648596 1 + G A rs76418789 67648596 - 67648576 67648616 41 GTCTATGTAGGTGAGCTTCCCAGCATTCCAGGTGCAAGTCA GTCTATGTAGGTGAGCTTCCTAGCATTCCAGGTGCAAGTCA Direct Gain 0 0.763486325740814 Functional Gain 0.763486325740814 IL23R ENSG00000162594 CDS Human protein_coding chr1:67648596 chr1:67648596 nonsynonymous SNV 0.706 4 21 hm5U_associated_SNPs_181532 0 23850713 Crohn's disease 2e-10 GWAS_Catalog TagSNP rs76418789 GCST002094 Genome-wide association study of Crohn's disease in Koreans revealed three new susceptibility loci and common attributes of genetic susceptibility across ethnic populations.
203 chr1 107599918 107599918 1 + C A rs2232016 107599918 - 107599898 107599938 41 GCATCTGGTCGCTGATGGGGGCTATGAAGAGCTCGGCGGAG GCATCTGGTCGCTGATGGGGTCTATGAAGAGCTCGGCGGAG Direct Gain 0 0.938175439834595 Functional Gain 0.938175439834595 PRMT6 ENSG00000198890 CDS Human protein_coding chr1:107599918 chr1:107599918 nonsynonymous SNV 0.956 4 21 hm5U_associated_SNPs_181657 0 30595370 Red cell distribution width 2e-10 GWAS_Catalog TagSNP rs2232016 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
204 chr1 110082551 110082551 1 + T A rs41279738 110082551 - 110082531 110082571 41 GCTGAGCAGTCCCGGCTCCCATGTGATAGCTCCTCTCAGCT GCTGAGCAGTCCCGGCTCCCTTGTGATAGCTCCTCTCAGCT Direct Gain 0 0.925232291221619 Functional Gain 0.925232291221619 GPR61 ENSG00000254942 ncRNA_exonic Human antisense chr1:110082551 chr1:110082551 . . 0 21 hm5U_associated_SNPs_181726 0 30593698 Body fat percentage 7e-10 GWAS_Catalog TagSNP rs41279738 GCST007064 Genomics of body fat percentage may contribute to sex bias in anorexia nervosa.
205 chr1 145727683 145727683 1 + C A rs1797052 145727683 - 145727663 145727703 41 GTCTCTGCAGGTGAGCATTAGGCTTGCAACTCACTGGACTT GTCTCTGCAGGTGAGCATTATGCTTGCAACTCACTGGACTT Direct Gain 0 0.560446918010712 Functional Gain 0.560446918010712 PDZK1 ENSG00000174827 UTR5 Human protein_coding chr1:145727683 chr1:145727683 . . 0 21 hm5U_associated_SNPs_181933 0 24152035 Contrast sensitivity 8e-09 GWAS_Catalog TagSNP rs1797052 GCST002238 Variants in the 1q21 risk region are associated with a visual endophenotype of autism and schizophrenia.
206 chr1 150954720 150954720 1 + G A rs28521412 150954720 - 150954700 150954740 41 TGAACAGCCAGTCAGATGACCTCTCTTAGGGACGAACCCAG TGAACAGCCAGTCAGATGACTTCTCTTAGGGACGAACCCAG Direct Gain 0 0.539962112903595 Functional Gain 0.539962112903595 ANXA9 ENSG00000143412 UTR5 Human protein_coding chr1:150954720 chr1:150954720 . . 0 21 hm5U_associated_SNPs_182020 0 30593698 Fat-free mass 2e-06 GWAS_Catalog TagSNP rs28521412 GCST007063 Genomics of body fat percentage may contribute to sex bias in anorexia nervosa.
207 chr1 151062957 151062957 1 + G A rs11204774 151062957 - 151062937 151062977 41 AGTCCGGGCATCCCTGCTAACACCTGCTCGAAGGAGTACTT AGTCCGGGCATCCCTGCTAATACCTGCTCGAAGGAGTACTT Direct Gain 0 0.549691557884216 Functional Gain 0.549691557884216 GABPB2 ENSG00000143458 CDS Human protein_coding chr1:151062957 chr1:151062957 nonsynonymous SNV 0.998 2 21 hm5U_associated_SNPs_182035 0 17554300 Multiple complex diseases 0.000171624 Johnson and O'Donnell TagSNP rs11204774 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
208 chr1 153662423 153662423 1 + G A rs35479618 153662423 - 153662403 153662443 41 AATGCGCAAGCGCAGCTGCTCCTGGGGCCGGTGGCGGATTC AATGCGCAAGCGCAGCTGCTTCTGGGGCCGGTGGCGGATTC Direct Gain 0 0.925485491752625 Functional Gain 0.925485491752625 NPR1 ENSG00000169418 CDS Human protein_coding chr1:153662423 chr1:153662423 nonsynonymous SNV 0.998 2 21 hm5U_associated_SNPs_182122 0 27618448 Systolic blood pressure 6e-08 GWAS_Catalog TagSNP rs35479618 GCST006228 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
209 chr1 155033308 155033308 1 + G A rs11589479 155033308 - 155033288 155033328 41 CTCTGGCATCCAGGACTCACCTTAGTGCCTCGTGCCAGCAG CTCTGGCATCCAGGACTCACTTTAGTGCCTCGTGCCAGCAG Direct Gain 0 0.767933130264282 Functional Gain 0.767933130264282 ADAM15 ENSG00000143537 CDS Human protein_coding chr1:155033308 chr1:155033308 synonymous SNV . 0 21 hm5U_associated_SNPs_182192 0 27182965 Chin dimples 5e-11 GWAS_Catalog TagSNP rs11589479 GCST003989 Detection and interpretation of shared genetic influences on 42 human traits.
210 chr1 156883493 156883493 1 + G A rs11264581 156883493 - 156883473 156883513 41 AGCTGTAGCTTCGGTCCAGGCGGCTGCTCCCTGAGGAGGAG AGCTGTAGCTTCGGTCCAGGTGGCTGCTCCCTGAGGAGGAG Direct Gain 0 0.736301183700562 Functional Gain 0.736301183700562 PEAR1 ENSG00000187800 CDS Human protein_coding chr1:156883493 chr1:156883493 nonsynonymous SNV 0.273 1 21 hm5U_associated_SNPs_182324 0 30072576 Blood protein levels 7e-09 GWAS_Catalog TagSNP rs11264581 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
211 chr1 159409533 159409533 1 + G A rs10908721 159409533 - 159409513 159409553 41 AGCATAAAAGTCACATAGTCCCAGTAAAGCAGTAGAAGCAC AGCATAAAAGTCACATAGTCTCAGTAAAGCAGTAGAAGCAC Direct Gain 0 0.661188364028931 Functional Gain 0.661188364028931 OR10J1 ENSG00000228560 ncRNA_intronic Human antisense chr1:159409533 chr1:159409533 . . 0 21 hm5U_associated_SNPs_182354 0 17554300 Multiple complex diseases 0.000809631 Johnson and O'Donnell TagSNP rs10908721 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
212 chr1 161642985 161642985 1 + G A rs182968886 161642985 - 161642965 161643005 41 GTCACAGGCTTGGATGAGTACAGCGTGTAGCCTATGTTTCC GTCACAGGCTTGGATGAGTATAGCGTGTAGCCTATGTTTCC Direct Gain 0 0.90392655134201 Functional Gain 0.90392655134201 FCGR2B ENSG00000072694 CDS Human protein_coding chr1:161642985 chr1:161642985 synonymous SNV . 0 21 hm5U_associated_SNPs_182453 0 27863252 Monocyte percentage of white cells 7e-11 GWAS_Catalog TagSNP rs182968886 GCST004609 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
213 chr1 181745701 181745701 1 + C A rs71632123 181745701 - 181745681 181745721 41 AAACCCTTGTCAAACCCCCTGATAACTCAAAGGAGTCCACT AAACCCTTGTCAAACCCCCTTATAACTCAAAGGAGTCCACT Direct Gain 0 0.566104352474213 Functional Gain 0.566104352474213 CACNA1E ENSG00000198216 intronic Human protein_coding chr1:181745701 chr1:181745701 . . 0 21 hm5U_associated_SNPs_182675 0 27098658 Presence of antiphospholipid antibodies 1e-06 GWAS_Catalog TagSNP rs71632123 GCST003563 Antiphospholipid antibodies in a large population-based cohort: genome-wide associations and effects on monocyte gene expression.
214 chr1 183155482 183155482 1 + C A rs684527 183155482 - 183155462 183155502 41 CCAGAGCGCAGGCATGGCGGGGCCGGGCCGCTCAGTCTCTG CCAGAGCGCAGGCATGGCGGTGCCGGGCCGCTCAGTCTCTG Direct Gain 0 0.942671597003937 Functional Gain 0.942671597003937 LAMC2 ENSG00000058085 UTR5 Human protein_coding chr1:183155482 chr1:183155482 . . 0 21 hm5U_associated_SNPs_182691 1 30048462 Heel bone mineral density 2e-11 GWAS_Catalog TagSNP rs684527 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
215 chr1 184020945 184020945 1 + G A rs2274432 184020945 - 184020925 184020965 41 CGCCAAAGCCGCGAACACCGCCCGGACCCAGGCCGCTGCAG CGCCAAAGCCGCGAACACCGTCCGGACCCAGGCCGCTGCAG Direct Gain 0 0.90727961063385 Functional Gain 0.90727961063385 TSEN15 ENSG00000198860 CDS Human protein_coding chr1:184020945 chr1:184020945 nonsynonymous SNV 0.094 0 21 hm5U_associated_SNPs_182700 0 18391951 Height 8e-09 GWAS_Catalog TagSNP rs2274432 GCST000175 Many sequence variants affecting diversity of adult human height.
216 chr1 203667409 203667409 1 + T A rs2228445 203667409 - 203667389 203667429 41 GCTGCAATCTCCAGGATGATAAGCGTGACATCTTGAAGAGC GCTGCAATCTCCAGGATGATTAGCGTGACATCTTGAAGAGC Direct Gain 0 0.959150433540344 Functional Gain 0.959150433540344 ATP2B4 ENSG00000058668 CDS Human protein_coding chr1:203667409 chr1:203667409 synonymous SNV . 0 21 hm5U_associated_SNPs_182898 0 30595370 Red blood cell count 1e-27 GWAS_Catalog TagSNP rs2228445 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
217 chr1 204989911 204989911 1 + C A rs3795559 204989911 - 204989891 204989931 41 CACTGAGAAGGGATTCTCTGGCACTAGCCCCAGCCGACGGA CACTGAGAAGGGATTCTCTGTCACTAGCCCCAGCCGACGGA Direct Gain 0 0.623430609703064 Functional Gain 0.623430609703064 NFASC ENSG00000163531 UTR3 Human protein_coding chr1:204989911 chr1:204989911 . . 0 21 hm5U_associated_SNPs_182951 0 28240269 Blood protein levels 8e-13 GWAS_Catalog TagSNP rs3795559 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
218 chr1 205041158 205041158 1 + C A rs2229868 205041158 - 205041138 205041178 41 TTGGTGTTGGGATGCAGGCCGCTGACTCGGGCACTGGTGTC TTGGTGTTGGGATGCAGGCCTCTGACTCGGGCACTGGTGTC Direct Gain 0 0.763063371181488 Functional Gain 0.763063371181488 CNTN2 ENSG00000184144 CDS Human protein_coding chr1:205041158 chr1:205041158 nonsynonymous SNV 0.993 0 21 hm5U_associated_SNPs_182965 0 30643258 Adventurousness 5e-10 GWAS_Catalog TagSNP rs2229868 GCST007324 Genome-wide association analyses of risk tolerance and risky behaviors in over 1 million individuals identify hundreds of loci and shared genetic influences.
219 chr1 231859181 231859181 1 + G A rs11122324 231859181 - 231859161 231859201 41 CACAAAGAGTAAGGTCGTAGCCAGTGCACCTGATCTCACAG CACAAAGAGTAAGGTCGTAGTCAGTGCACCTGATCTCACAG Direct Gain 0 0.674272239208221 Functional Gain 0.674272239208221 TSNAX-DISC1 ENSG00000162946 UTR3 Human protein_coding chr1:231859181 chr1:231859181 . . 0 21 hm5U_associated_SNPs_183450 0 17554300 Multiple complex diseases 0.000186842 Johnson and O'Donnell TagSNP rs11122324 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
220 chr2 3392075 3392075 1 + T A rs10865541 3392075 - 3392055 3392095 41 GAAATGAAGGCGGAGGTAGTAAAGGAGTCGAAGAAGTCCGA GAAATGAAGGCGGAGGTAGTTAAGGAGTCGAAGAAGTCCGA Direct Gain 0 0.503909289836884 Functional Gain 0.503909289836884 TRAPPC12 ENSG00000171853 CDS Human protein_coding chr2:3392075 chr2:3392075 nonsynonymous SNV 0.794 4 21 hm5U_associated_SNPs_183673 0 23251661 Obesity-related traits 6e-06 GWAS_Catalog TagSNP rs10865541 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
221 chr2 11738091 11738091 1 + T A rs1435547 11738091 - 11738071 11738111 41 CCCATACCTGAATGCCACACATGGAGCAGAGTCTGCTGGTA CCCATACCTGAATGCCACACTTGGAGCAGAGTCTGCTGGTA Direct Gain 0 0.850571990013123 Functional Gain 0.850571990013123 GREB1 ENSG00000196208 CDS Human protein_coding chr2:11738091 chr2:11738091 nonsynonymous SNV 0.785 2 21 hm5U_associated_SNPs_183777 0 25918132 Diisocyanate-induced asthma 1e-06 GWAS_Catalog TagSNP rs1435547 GCST002875 Genome-Wide Association Study Identifies Novel Loci Associated With Diisocyanate-Induced Occupational Asthma.
222 chr2 11758431 11758431 1 + G A rs73175262 11758431 - 11758411 11758451 41 TGTGGGCTGAGCCGAGGACTCGCCACCGAGCGCTGAACCTG TGTGGGCTGAGCCGAGGACTTGCCACCGAGCGCTGAACCTG Direct Gain 0 0.639204859733582 Functional Gain 0.639204859733582 GREB1 ENSG00000196208 CDS Human protein_coding chr2:11758431 chr2:11758431 nonsynonymous SNV 0.007 1 21 hm5U_associated_SNPs_183781 0 23251661 Obesity-related traits 9e-06 GWAS_Catalog TagSNP rs73175262 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
223 chr2 26929096 26929096 1 + G A rs74887298 26929096 - 26929076 26929116 41 TCTTGGCCACCTGGCTCACCCCAGGAGCTTTGGCTCGAGGA TCTTGGCCACCTGGCTCACCTCAGGAGCTTTGGCTCGAGGA Direct Gain 0 0.572976648807526 Functional Gain 0.572976648807526 KCNK3 ENSG00000171303 intronic Human protein_coding chr2:26929096 chr2:26929096 . . 0 21 hm5U_associated_SNPs_183890 0 30177863 Diverticular disease 8e-07 GWAS_Catalog TagSNP rs74887298 GCST006479 Genome-wide association analyses identify 39 new susceptibility loci for diverticular disease.
224 chr2 27315252 27315252 1 + G A rs2304681 27315252 - 27315232 27315272 41 GGCTCCGAGCAGGGAGAGAACGGTGCAGGAGTTGGACGCGT GGCTCCGAGCAGGGAGAGAATGGTGCAGGAGTTGGACGCGT Direct Gain 0 0.874012649059296 Functional Gain 0.874012649059296 KHK ENSG00000138030 CDS Human protein_coding chr2:27315252 chr2:27315252 nonsynonymous SNV 0.668 0 21 hm5U_associated_SNPs_183932 1 30181555 Self-reported risk-taking behaviour 1e-07 GWAS_Catalog TagSNP rs2304681 GCST006461 Genetics of self-reported risk-taking behaviour, trans-ethnic consistency and relevance to brain gene expression.
225 chr2 27801418 27801418 1 + C A rs1919126 27801418 - 27801398 27801438 41 TTTGCGGTGAGGTTAATTCTGCAGACTTCACTTGAGTACAT TTTGCGGTGAGGTTAATTCTTCAGACTTCACTTGAGTACAT Direct Gain 0 0.530901193618774 Functional Gain 0.530901193618774 C2orf16 ENSG00000221843 CDS Human protein_coding chr2:27801418 chr2:27801418 nonsynonymous SNV 0.551 0 21 hm5U_associated_SNPs_183974 0 27618448 Mean arterial pressure 9e-06 GWAS_Catalog TagSNP rs1919126 GCST006231 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
226 chr2 27844601 27844601 1 + T A rs1881396 27844601 - 27844581 27844621 41 TTAGTTTTGTACAGGGCAAGAGGAGCCTATAGTTGGCCTTG TTAGTTTTGTACAGGGCAAGTGGAGCCTATAGTTGGCCTTG Direct Gain 0 0.657431125640869 Functional Gain 0.657431125640869 ZNF512 ENSG00000259080 ncRNA_intronic Human processed_transcript chr2:27844601 chr2:27844601 . . 0 21 hm5U_associated_SNPs_183977 0 29385134 Nonalcoholic fatty liver disease 1e-06 GWAS_Catalog TagSNP rs1881396 GCST005308 Risk estimation model for nonalcoholic fatty liver disease in the Japanese using multiple genetic markers.
227 chr2 68962137 68962137 1 + G A rs10048745 68962137 - 68962117 68962157 41 TCTTAGATGAAAGGTCCATCCATCTGTCACTGGAGGATGGC TCTTAGATGAAAGGTCCATCTATCTGTCACTGGAGGATGGC Direct Gain 0 0.738660216331482 Functional Gain 0.738660216331482 ARHGAP25 ENSG00000163219 UTR5 Human protein_coding chr2:68962137 chr2:68962137 . . 0 21 hm5U_associated_SNPs_184244 0 27863252 Plateletcrit 5e-21 GWAS_Catalog TagSNP rs10048745 GCST004607 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
228 chr2 85046475 85046475 1 + G A rs7584208 85046475 - 85046455 85046495 41 GCAATCCAGTAGTCTTTGGACCGCTTGGAGGGTAACAGGAC GCAATCCAGTAGTCTTTGGATCGCTTGGAGGGTAACAGGAC Direct Gain 0 0.764773607254028 Functional Gain 0.764773607254028 DNAH6 ENSG00000115423 CDS Human protein_coding chr2:85046475 chr2:85046475 synonymous SNV . 0 21 hm5U_associated_SNPs_184412 0 17554300 Multiple complex diseases 0.000496122 Johnson and O'Donnell TagSNP rs7584208 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
229 chr2 102960210 102960210 1 + T A rs3771175 102960210 - 102960190 102960230 41 CAAAAGAACACGTTCAGTTTACGGTTGTTGGTGCATTTCCT CAAAAGAACACGTTCAGTTTTCGGTTGTTGGTGCATTTCCT Direct Gain 0 0.570277988910675 Functional Gain 0.570277988910675 IL1RL1 ENSG00000115602 UTR3 Human protein_coding chr2:102960210 chr2:102960210 . . 0 21 hm5U_associated_SNPs_184634 0 23817571 Allergic sensitization 5e-11 GWAS_Catalog TagSNP rs3771175 GCST002084 Meta-analysis of genome-wide association studies identifies ten loci influencing allergic sensitization.
230 chr2 113832333 113832333 1 + C A rs6743376 113832333 - 113832313 113832353 41 AAATGGGGACCTTGGTGCGGGCCAAGCCTCTGTTAGGAAGT AAATGGGGACCTTGGTGCGGTCCAAGCCTCTGTTAGGAAGT Direct Gain 0 0.852586030960083 Functional Gain 0.852586030960083 IL1F10 ENSG00000136697 CDS Human protein_coding chr2:113832333 chr2:113832333 nonsynonymous SNV 0.977 0 21 hm5U_associated_SNPs_184738 0 24182552 Inflammatory biomarkers 2e-26 GWAS_Catalog TagSNP rs6743376 GCST002255 Novel gene variants predict serum levels of the cytokines IL-18 and IL-1ra in older adults.
231 chr2 113965198 113965198 1 + T A rs7563124 113965198 - 113965178 113965218 41 ACTAAAAATACAAAAAAATTAGCCGGGCATGGTAGCGGGCG ACTAAAAATACAAAAAAATTTGCCGGGCATGGTAGCGGGCG Direct Gain 0 0.586909770965576 Functional Gain 0.586909770965576 PSD4;PAX8 ENSG00000125637 UTR3 Human protein_coding chr2:113965198 chr2:113965198 . . 0 21 hm5U_associated_SNPs_184755 0 27863252 Hematocrit 8e-20 GWAS_Catalog TagSNP rs7563124 GCST004604 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
232 chr2 190649316 190649316 1 + G A rs5742933 190649316 - 190649296 190649336 41 TAGTCACACCACACTACCTTCCTGCTAGCGCGAGGCAGGCA TAGTCACACCACACTACCTTTCTGCTAGCGCGAGGCAGGCA Direct Gain 0 0.669382095336914 Functional Gain 0.669382095336914 PMS1 ENSG00000064933 UTR5 Human protein_coding chr2:190649316 chr2:190649316 . . 0 21 hm5U_associated_SNPs_185247 0 25162662 Ferritin levels 2e-10 GWAS_Catalog TagSNP rs5742933 GCST002578 Genome-wide association study identifies variants in PMS1 associated with serum ferritin in a Chinese population.
233 chr2 219755011 219755011 1 + T A rs121908120 219755011 - 219754991 219755031 41 AGGCTCCCGGGAGTCCAGAAAGTCCTTAGAAAAGCGCTCCC AGGCTCCCGGGAGTCCAGAATGTCCTTAGAAAAGCGCTCCC Direct Gain 0 0.519622087478638 Functional Gain 0.519622087478638 WNT10A ENSG00000135925 CDS Human protein_coding chr2:219755011 chr2:219755011 nonsynonymous SNV 0.999 5 21 hm5U_associated_SNPs_185450 6 29364747 Tooth agenesis 2e-40 GWAS_Catalog TagSNP rs121908120 GCST005389 Rare and Common Variants Conferring Risk of Tooth Agenesis.
234 chr2 223917983 223917983 1 + T A rs12621643 223917983 - 223917963 223918003 41 TCCGAGGTCTCCTCCAGCTCATCGTCTGCCCCCTCCTCCTG TCCGAGGTCTCCTCCAGCTCTTCGTCTGCCCCCTCCTCCTG Direct Gain 0 0.700902104377747 Functional Gain 0.700902104377747 KCNE4 ENSG00000152049 CDS Human protein_coding chr2:223917983 chr2:223917983 nonsynonymous SNV 0.961 0 21 hm5U_associated_SNPs_185577 0 19684603 Acute lymphoblastic leukemia (childhood) 3e-06 GWAS_Catalog TagSNP rs12621643 GCST000464 Germline genomic variants associated with childhood acute lymphoblastic leukemia.
235 chr2 234113301 234113301 1 + C A rs9247 234113301 - 234113281 234113321 41 CGGCCGGTGCTTGCCGTGATGCGGGAGCTCGGTGTTGTCGC CGGCCGGTGCTTGCCGTGATTCGGGAGCTCGGTGTTGTCGC Direct Gain 0 0.934638023376465 Functional Gain 0.934638023376465 INPP5D ENSG00000168918 CDS Human protein_coding chr2:234113301 chr2:234113301 nonsynonymous SNV 0.126 4 21 hm5U_associated_SNPs_185744 0 30595370 Eczema 1e-14 GWAS_Catalog TagSNP rs9247 GCST007075 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
236 chr2 234627608 234627608 1 + T A rs2011425 234627608 - 234627588 234627628 41 TCTGGCATGGAGCTCCCGCAAGGCCTCCCGCATGCTGAGCC TCTGGCATGGAGCTCCCGCATGGCCTCCCGCATGCTGAGCC Direct Gain 0 0.627753853797913 Functional Gain 0.627753853797913 UGT1A4 ENSG00000244474 CDS Human protein_coding chr2:234627608 chr2:234627608 nonsynonymous SNV 0.012 1 21 hm5U_associated_SNPs_185759 0 30922102 Plasma norclozapine levels in treatment-resistant schizophrenia 8e-09 GWAS_Catalog TagSNP rs2011425 GCST007686 Pharmacogenomic Variants and Drug Interactions Identified Through the Genetic Analysis of Clozapine Metabolism.
237 chr2 242012729 242012729 1 + G A rs6721345 242012729 - 242012709 242012749 41 GCTGGAGGGCCAGGCTGACCCGCTTGGGGGCTTCCTCCATG GCTGGAGGGCCAGGCTGACCTGCTTGGGGGCTTCCTCCATG Direct Gain 0 0.630164623260498 Functional Gain 0.630164623260498 SNED1 ENSG00000162804 CDS Human protein_coding chr2:242012729 chr2:242012729 nonsynonymous SNV 0.091 1 21 hm5U_associated_SNPs_185992 0 22675492 Sex hormone-binding globulin levels 3e-06 GWAS_Catalog TagSNP rs6721345 GCST001554 Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women.
238 chr3 21447336 21447336 1 + G A rs409974 21447336 - 21447316 21447356 41 CCGGGGGAGACGTCGGCAGGCCTGGGGGTGTGGGTCGACCC CCGGGGGAGACGTCGGCAGGTCTGGGGGTGTGGGTCGACCC Direct Gain 0 0.871033310890198 Functional Gain 0.871033310890198 VENTXP7 ENSG00000236380 ncRNA_exonic Human processed_pseudogene chr3:21447336 chr3:21447336 . . 0 21 hm5U_associated_SNPs_186269 0 24324551 QRS duration in Tripanosoma cruzi seropositivity 9e-06 GWAS_Catalog TagSNP rs409974 GCST002284 Genome wide association study (GWAS) of Chagas cardiomyopathy in Trypanosoma cruzi seropositive subjects.
239 chr3 49737954 49737954 1 + G A rs35620248 49737954 - 49737934 49737974 41 TGGGTGAGAATCGGTACAGCCGAAGCAGAGACATCATCAAC TGGGTGAGAATCGGTACAGCTGAAGCAGAGACATCATCAAC Direct Gain 0 0.521997034549713 Functional Gain 0.521997034549713 RNF123 ENSG00000164068 CDS Human protein_coding chr3:49737954 chr3:49737954 nonsynonymous SNV 0.992 3 21 hm5U_associated_SNPs_186615 0 29875488 Blood protein levels 8e-184 GWAS_Catalog TagSNP rs35620248 GCST005806 Genomic atlas of the human plasma proteome.
240 chr3 50222926 50222926 1 + T A rs1046956 50222926 - 50222906 50222946 41 CTCCAGCATGAGCTCCTCCAACTCCTGGTCATCCTTGGGCA CTCCAGCATGAGCTCCTCCATCTCCTGGTCATCCTTGGGCA Direct Gain 0 0.61608898639679 Functional Gain 0.61608898639679 SEMA3F ENSG00000001617 CDS Human protein_coding chr3:50222926 chr3:50222926 nonsynonymous SNV 0.961 0 21 hm5U_associated_SNPs_186623 0 30108127 Body mass index 2e-08 GWAS_Catalog TagSNP rs1046956 GCST006368 A Large Multi-ethnic Genome-Wide Association Study of Adult Body Mass Index Identifies Novel Loci.
241 chr3 52833805 52833805 1 + C A rs3617 52833805 - 52833785 52833825 41 ATTCAGATAGTCTTCCTCTTGCATATCTTCCAGGATTCTGA ATTCAGATAGTCTTCCTCTTTCATATCTTCCAGGATTCTGA Direct Gain 0 0.536426842212677 Functional Gain 0.536426842212677 ITIH3 ENSG00000162267 CDS Human protein_coding chr3:52833805 chr3:52833805 nonsynonymous SNV 0.611 1 21 hm5U_associated_SNPs_186770 0 27618447 Pulse pressure 3e-06 GWAS_Catalog TagSNP rs3617 GCST006022 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
242 chr3 57994398 57994398 1 + G A rs142568031 57994398 - 57994378 57994418 41 CGGTCTGCAGGTTGCCGATGCGTTTGTTCACGCACTTGAGG CGGTCTGCAGGTTGCCGATGTGTTTGTTCACGCACTTGAGG Direct Gain 0 0.516815841197968 Functional Gain 0.516815841197968 FLNB ENSG00000136068 CDS Human protein_coding chr3:57994398 chr3:57994398 nonsynonymous SNV 0.999 5 21 hm5U_associated_SNPs_186787 0 31217584 Height 5e-11 GWAS_Catalog TagSNP rs142568031 GCST008053 Genetic analyses of diverse populations improves discovery for complex traits.
243 chr3 58292131 58292131 1 + C A rs17059150 58292131 - 58292111 58292151 41 CACCTACCCACTCTTCGTCGGACTAGCCTGACGCCTGACCA CACCTACCCACTCTTCGTCGTACTAGCCTGACGCCTGACCA Direct Gain 0 0.823115646839142 Functional Gain 0.823115646839142 HTD2;RPP14 ENSG00000163684 UTR5 Human protein_coding chr3:58292131 chr3:58292131 . . 0 21 hm5U_associated_SNPs_186798 0 17554300 Multiple complex diseases 0.000735845 Johnson and O'Donnell TagSNP rs17059150 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
244 chr3 111732608 111732608 1 + G A rs8070 111732608 - 111732588 111732628 41 GCCCGAGGAGCTCAGGAAAACGGAAGCGGAGTCTTTGCATA GCCCGAGGAGCTCAGGAAAATGGAAGCGGAGTCTTTGCATA Direct Gain 0 0.668401479721069 Functional Gain 0.668401479721069 TAGLN3 ENSG00000144834 UTR3 Human protein_coding chr3:111732608 chr3:111732608 . . 0 21 hm5U_associated_SNPs_186922 0 17463246 Multiple continuous traits in DGI samples 0.0004057 Johnson and O'Donnell TagSNP rs8070 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
245 chr3 122003045 122003045 1 + G A rs2036400 122003045 - 122003025 122003065 41 TCCTGGTTGCGGTAGCTTGACGGGGGCGCGGTGTAGAGCCA TCCTGGTTGCGGTAGCTTGATGGGGGCGCGGTGTAGAGCCA Direct Gain 0 0.870903551578522 Functional Gain 0.870903551578522 CASR ENSG00000036828 CDS Human protein_coding chr3:122003045 chr3:122003045 synonymous SNV . 0 21 hm5U_associated_SNPs_186996 0 17554300 Multiple complex diseases 6.42429e-05 Johnson and O'Donnell TagSNP rs2036400 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
246 chr3 124351316 124351316 1 + G A rs1708303 124351316 - 124351296 124351336 41 GGCTGGGCCTGCAGGTTGGCCACGGACTCGGACTTGCCTCC GGCTGGGCCTGCAGGTTGGCTACGGACTCGGACTTGCCTCC Direct Gain 0 0.932333052158356 Functional Gain 0.932333052158356 KALRN ENSG00000160145 CDS Human protein_coding chr3:124351316 chr3:124351316 synonymous SNV . 0 21 hm5U_associated_SNPs_187021 0 17554300 Multiple complex diseases 9.3848e-05 Johnson and O'Donnell TagSNP rs1708303 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
247 chr3 124467247 124467247 1 + C A rs689449 124467247 - 124467227 124467267 41 TGCGGCCTTCCTTTGGAAGGGTTATGGGGAAAACAAAGGGA TGCGGCCTTCCTTTGGAAGGTTTATGGGGAAAACAAAGGGA Direct Gain 0 0.584224998950958 Functional Gain 0.584224998950958 UMPS ENSG00000272947 upstream Human other chr3:124467247 chr3:124467247 . . 0 21 hm5U_associated_SNPs_187027 1 27863252 Mean platelet volume 1e-19 GWAS_Catalog TagSNP rs689449 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
248 chr3 126261202 126261202 1 + G A rs1056524 126261202 - 126261182 126261222 41 AAGGCCGCGTCCTCCGCCAGCGTCTCGAACTTGCCCACGAC AAGGCCGCGTCCTCCGCCAGTGTCTCGAACTTGCCCACGAC Direct Gain 0 0.881815910339355 Functional Gain 0.881815910339355 CHST13 ENSG00000180767 CDS Human protein_coding chr3:126261202 chr3:126261202 synonymous SNV 0.284 0 21 hm5U_associated_SNPs_187049 0 29875488 Blood protein levels 8e-26 GWAS_Catalog TagSNP rs1056524 GCST005806 Genomic atlas of the human plasma proteome.
249 chr3 133475812 133475812 1 + G A rs1799899 133475812 - 133475792 133475832 41 CCAGATCAAGTCCTCCTTGCCGCCCATACTTCGGGCCACGA CCAGATCAAGTCCTCCTTGCTGCCCATACTTCGGGCCACGA Direct Gain 0 0.929534316062927 Functional Gain 0.929534316062927 TF ENSG00000091513 CDS Human protein_coding chr3:133475812 chr3:133475812 nonsynonymous SNV 0.613 3 21 hm5U_associated_SNPs_187219 2 21665994 Alcohol consumption (transferrin glycosylation) 1e-09 GWAS_Catalog TagSNP rs1799899 GCST001103 Genome-wide association study identifies two loci strongly affecting transferrin glycosylation.
250 chr3 150128392 150128392 1 + G A rs879634 150128392 - 150128372 150128412 41 CTGCGCGCCCACCGAGGAAGCATTCTGGCCGGTGCCCACGG CTGCGCGCCCACCGAGGAAGTATTCTGGCCGGTGCCCACGG Direct Gain 0 0.940509378910065 Functional Gain 0.940509378910065 TSC22D2 ENSG00000196428 CDS Human protein_coding chr3:150128392 chr3:150128392 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_187333 0 27618447 Systolic blood pressure 8e-06 GWAS_Catalog TagSNP rs879634 GCST006021 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
251 chr3 186364046 186364046 1 + G A rs6785067 186364046 - 186364026 186364066 41 TTCCACAAAGTAAGAAGGGCCGACCACCCACTGTTATGAGA TTCCACAAAGTAAGAAGGGCTGACCACCCACTGTTATGAGA Direct Gain 0 0.628270447254181 Functional Gain 0.628270447254181 FETUB ENSG00000090512 CDS Human protein_coding chr3:186364046 chr3:186364046 nonsynonymous SNV 0.708 1 21 hm5U_associated_SNPs_187531 0 17554300 Multiple complex diseases 1.55237e-05 Johnson and O'Donnell TagSNP rs6785067 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
252 chr3 186395436 186395436 1 + C A rs1042445 186395436 - 186395416 186395456 41 TTGTCTGCAATGGAAGGGACGGGGTCCTTTACCTGGGCCTC TTGTCTGCAATGGAAGGGACTGGGTCCTTTACCTGGGCCTC Direct Gain 0 0.596067786216736 Functional Gain 0.596067786216736 HRG ENSG00000113905 CDS Human protein_coding chr3:186395436 chr3:186395436 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_187535 0 28240269 Blood protein levels 8e-78 GWAS_Catalog TagSNP rs1042445 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
253 chr4 994414 994414 1 + G A rs3755955 994414 - 994394 994434 41 TGAAGTTGTAGCTCAGGCCCCGTCCAGTGGACCCCCTGCAG TGAAGTTGTAGCTCAGGCCCTGTCCAGTGGACCCCCTGCAG Direct Gain 0 0.600099802017212 Functional Gain 0.600099802017212 IDUA ENSG00000127415 CDS Human protein_coding chr4:994414 chr4:994414 nonsynonymous SNV 0.000 1 21 hm5U_associated_SNPs_187723 2 22504420 Lumbar spine bone mineral density 5e-15 GWAS_Catalog TagSNP rs3755955 GCST001482 Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture.
254 chr4 996165 996165 1 + G A rs6831280 996165 - 996145 996185 41 CGCGGTGAGCGTGCGCTGCGCGAAGGGGTGCGGGTGGTAGC CGCGGTGAGCGTGCGCTGCGTGAAGGGGTGCGGGTGGTAGC Direct Gain 0 0.878735661506653 Functional Gain 0.878735661506653 IDUA ENSG00000127415 CDS Human protein_coding chr4:996165 chr4:996165 nonsynonymous SNV 0.019 1 21 hm5U_associated_SNPs_187728 2 29304378 Total body bone mineral density 8e-19 GWAS_Catalog TagSNP rs6831280 GCST005348 Life-Course Genome-wide Association Study Meta-analysis of Total Body BMD and Assessment of Age-Specific Effects.
255 chr4 1244218 1244218 1 + G A rs79407053 1244218 - 1244198 1244238 41 TGCCCCTCCCCCTACAAGGGCTCCACACGTGTTCCCTCCTT TGCCCCTCCCCCTACAAGGGTTCCACACGTGTTCCCTCCTT Direct Gain 0 0.821352958679199 Functional Gain 0.821352958679199 CTBP1-AS2 ENSG00000196810 ncRNA_exonic Human antisense chr4:1244218 chr4:1244218 . . 0 21 hm5U_associated_SNPs_187838 0 30718926 Type 2 diabetes 1e-24 GWAS_Catalog TagSNP rs79407053 GCST007847 Identification of 28 new susceptibility loci for type 2 diabetes in the Japanese population.
256 chr4 3234980 3234980 1 + G A rs362272 3234980 - 3234960 3235000 41 GCACTCCAGCACATAGAGGACGCCGTGCAGGGCTCCAACCC GCACTCCAGCACATAGAGGATGCCGTGCAGGGCTCCAACCC Direct Gain 0 0.594150185585022 Functional Gain 0.594150185585022 HTT ENSG00000197386 CDS Human protein_coding chr4:3234980 chr4:3234980 nonsynonymous SNV 0.003 0 21 hm5U_associated_SNPs_187994 0 27412988 Serum sulfate level 3e-07 GWAS_Catalog TagSNP rs362272 GCST003723 From Genotype to Phenotype: Nonsense Variants in SLC13A1 Are Associated with Decreased Serum Sulfate and Increased Serum Aminotransferases.
257 chr4 3444503 3444503 1 + G A rs2073505 3444503 - 3444483 3444523 41 GTCACCAGGATAGTGGGGATCGCAGGGGTCGCTGTGGCATT GTCACCAGGATAGTGGGGATTGCAGGGGTCGCTGTGGCATT Direct Gain 0 0.907721400260925 Functional Gain 0.907721400260925 HGFAC ENSG00000109758 CDS Human protein_coding chr4:3444503 chr4:3444503 synonymous SNV . 0 21 hm5U_associated_SNPs_188028 0 26192919 Inflammatory bowel disease 1e-07 GWAS_Catalog TagSNP rs2073505 GCST003043 Association analyses identify 38 susceptibility loci for inflammatory bowel disease and highlight shared genetic risk across populations.
258 chr4 3449652 3449652 1 + G A rs16844401 3449652 - 3449632 3449672 41 ACTGCGAGCGTGTGGCACAGCGGTCCCCTTTCTTCTTCAGC ACTGCGAGCGTGTGGCACAGTGGTCCCCTTTCTTCTTCAGC Direct Gain 0 0.829110503196716 Functional Gain 0.829110503196716 HGFAC ENSG00000109758 CDS Human protein_coding chr4:3449652 chr4:3449652 nonsynonymous SNV 0.996 2 21 hm5U_associated_SNPs_188037 0 23969696 Fibrinogen 2e-08 GWAS_Catalog TagSNP rs16844401 GCST002147 Multiethnic meta-analysis of genome-wide association studies in >100 000 subjects identifies 23 fibrinogen-associated Loci but no strong evidence of a causal association between circulating fibrinogen and cardiovascular disease.
259 chr4 6303022 6303022 1 + C A rs1801214 6303022 - 6303002 6303042 41 AGCAGGCACGGGACGCTGACGTTGAGGACGACCAGGTGGCC AGCAGGCACGGGACGCTGACTTTGAGGACGACCAGGTGGCC Direct Gain 0 0.88223135471344 Functional Gain 0.88223135471344 WFS1 ENSG00000109501 CDS Human protein_coding chr4:6303022 chr4:6303022 nonsynonymous SNV 0.009 2 21 hm5U_associated_SNPs_188124 0 22885922 Type 2 diabetes 3e-12 GWAS_Catalog TagSNP rs1801214 GCST005047 Large-scale association analysis provides insights into the genetic architecture and pathophysiology of type 2 diabetes.
260 chr4 15709192 15709192 1 + G A rs2302465 15709192 - 15709172 15709212 41 CATCGCTCAGGGGCATAAAACGACGGGTGTTGTCTGCAAAG CATCGCTCAGGGGCATAAAATGACGGGTGTTGTCTGCAAAG Direct Gain 0 0.721821188926697 Functional Gain 0.721821188926697 BST1 ENSG00000109743 CDS Human protein_coding chr4:15709192 chr4:15709192 nonsynonymous SNV 0.086 3 21 hm5U_associated_SNPs_188363 0 28240269 Blood protein levels 1e-108 GWAS_Catalog TagSNP rs2302465 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
261 chr4 79697870 79697870 1 + C A rs149914551 79697870 - 79697850 79697890 41 CCCGGGCGCCCGTACCTTCGGCCAGCGACTCTTCCAGGGTG CCCGGGCGCCCGTACCTTCGTCCAGCGACTCTTCCAGGGTG Direct Gain 0 0.818818032741547 Functional Gain 0.818818032741547 BMP2K ENSG00000138756 CDS Human protein_coding chr4:79697870 chr4:79697870 nonsynonymous SNV 0.993 3 21 hm5U_associated_SNPs_188607 0 30038396 Educational attainment (MTAG) 7e-09 GWAS_Catalog TagSNP rs149914551 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
262 chr4 145567471 145567471 1 + T A rs12507427 145567471 - 145567451 145567491 41 AAAGGAGAGGACAGCCACAGATGTTCACTTGTCCGTGTAAC AAAGGAGAGGACAGCCACAGTTGTTCACTTGTCCGTGTAAC Direct Gain 0 0.809460401535034 Functional Gain 0.809460401535034 HHIP ENSG00000248890 ncRNA_intronic Human antisense chr4:145567471 chr4:145567471 . . 0 21 hm5U_associated_SNPs_188860 0 31053729 Hip bone size 5e-09 GWAS_Catalog TagSNP rs12507427 GCST008281 GWAS of bone size yields twelve loci that also affect height, BMD, osteoarthritis or fractures.
263 chr5 72112421 72112421 1 + T A rs34648 72112421 - 72112401 72112441 41 GCGGAGCCCGCGGCGGGAACATTCGGCGGCGGTCGCCTTGG GCGGAGCCCGCGGCGGGAACTTTCGGCGGCGGTCGCCTTGG Direct Gain 0 0.961888670921326 Functional Gain 0.961888670921326 TNPO1 ENSG00000083312 UTR5 Human protein_coding chr5:72112421 chr5:72112421 . . 0 21 hm5U_associated_SNPs_189481 0 30595370 White blood cell count 4e-08 GWAS_Catalog TagSNP rs34648 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
264 chr5 79616059 79616059 1 + G A rs56226654 79616059 - 79616039 79616079 41 TTTGGAGATGGTGGGCATCTCAGCTGACTTAGCAGAGCTGG TTTGGAGATGGTGGGCATCTTAGCTGACTTAGCAGAGCTGG Direct Gain 0 0.61233115196228 Functional Gain 0.61233115196228 SPZ1 ENSG00000164299 CDS Human protein_coding chr5:79616059 chr5:79616059 nonsynonymous SNV 0.024 1 21 hm5U_associated_SNPs_189552 0 28584286 Cognitive empathy 5e-06 GWAS_Catalog TagSNP rs56226654 GCST005755 Genome-wide meta-analysis of cognitive empathy: heritability, and correlates with sex, neuropsychiatric conditions and cognition.
265 chr5 133451683 133451683 1 + C A rs5742913 133451683 - 133451663 133451703 41 GTGCTGCCCTGCTCCCGAGGGGGGTGGGTAATGCATGAGCA GTGCTGCCCTGCTCCCGAGGTGGGTGGGTAATGCATGAGCA Direct Gain 0 0.531294703483582 Functional Gain 0.531294703483582 TCF7 ENSG00000081059 CDS Human protein_coding chr5:133451683 chr5:133451683 nonsynonymous SNV 0.258 1 21 hm5U_associated_SNPs_189788 0 30595370 Eosinophil counts 1e-16 GWAS_Catalog TagSNP rs5742913 GCST007065 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
266 chr5 148787469 148787469 1 + G A rs368510 148787469 - 148787449 148787489 41 GCTCAACCTCCAAAAGCTCCCACAGGACTTCATCTGCTTGG GCTCAACCTCCAAAAGCTCCTACAGGACTTCATCTGCTTGG Direct Gain 0 0.668241620063782 Functional Gain 0.668241620063782 CARMN ENSG00000253864 ncRNA_exonic Human other chr5:148787469 chr5:148787469 . . 0 21 hm5U_associated_SNPs_190258 0 28869591 Heel bone mineral density 9e-09 GWAS_Catalog TagSNP rs368510 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
267 chr6 7231843 7231843 1 + G A rs9379084 7231843 - 7231823 7231863 41 CTCCCCGCTGGAGTCCAGGTCCACCCCGCCGCTGTTGGCGC CTCCCCGCTGGAGTCCAGGTTCACCCCGCCGCTGTTGGCGC Direct Gain 0 0.709656000137329 Functional Gain 0.709656000137329 RREB1 ENSG00000124782 CDS Human protein_coding chr6:7231843 chr6:7231843 nonsynonymous SNV 0.974 4 21 hm5U_associated_SNPs_190858 0 28869591 Heel bone mineral density 6e-09 GWAS_Catalog TagSNP rs9379084 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
268 chr6 25776949 25776949 1 + G A rs11754288 25776949 - 25776929 25776969 41 AGTCTCTCCCTTACCAATGGCAGTGAAGAGTTTCCTGATGG AGTCTCTCCCTTACCAATGGTAGTGAAGAGTTTCCTGATGG Direct Gain 0 0.533719301223755 Functional Gain 0.533719301223755 SLC17A4 ENSG00000146039 CDS Human protein_coding chr6:25776949 chr6:25776949 nonsynonymous SNV 0.804 0 21 hm5U_associated_SNPs_190983 0 21943158 Cardiovascular disease risk factors 4e-09 GWAS_Catalog TagSNP rs11754288 GCST001247 Genetic variants in LPL, OASL and TOMM40/APOE-C1-C2-C4 genes are associated with multiple cardiovascular-related traits.
269 chr6 26272548 26272548 1 + G A rs61747867 26272548 - 26272528 26272568 41 AGACAAGAAGACCCGCGTCACCCCCCGACGCCTGCAGCTCG AGACAAGAAGACCCGCGTCATCCCCCGACGCCTGCAGCTCG Direct Gain 0 0.684254050254822 Functional Gain 0.684254050254822 HIST1H2BI;HIST1H3G ENSG00000218690 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr6:26272548 chr6:26272548 . . 0 21 hm5U_associated_SNPs_191006 0 28540026 Autism spectrum disorder or schizophrenia 2e-09 GWAS_Catalog TagSNP rs61747867 GCST004521 Meta-analysis of GWAS of over 16,000 individuals with autism spectrum disorder highlights a novel locus at 10q24.32 and a significant overlap with schizophrenia.
270 chr6 26468326 26468326 1 + G A rs3734542 26468326 - 26468306 26468346 41 TCCCTGAAGCGAAGCTCTCCCGGCCTAGGACACAAGGCTGA TCCCTGAAGCGAAGCTCTCCTGGCCTAGGACACAAGGCTGA Direct Gain 0 0.557724237442017 Functional Gain 0.557724237442017 BTN2A1 ENSG00000112763 CDS Human protein_coding chr6:26468326 chr6:26468326 nonsynonymous SNV 0.049 0 21 hm5U_associated_SNPs_191037 0 28604730 Lung cancer in ever smokers 3e-07 GWAS_Catalog TagSNP rs3734542 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
271 chr6 28227604 28227604 1 + C A rs1635 28227604 - 28227584 28227624 41 CTTCTTCATCCTCAACTGGGGTATGTTCGTCAGAATCTAGC CTTCTTCATCCTCAACTGGGTTATGTTCGTCAGAATCTAGC Direct Gain 0 0.768831253051758 Functional Gain 0.768831253051758 NKAPL ENSG00000189134 CDS Human protein_coding chr6:28227604 chr6:28227604 nonsynonymous SNV 0.011 0 21 hm5U_associated_SNPs_191094 0 22037552 Schizophrenia 7e-12 GWAS_Catalog TagSNP rs1635 GCST001299 Genome-wide association study identifies a susceptibility locus for schizophrenia in Han Chinese at 11p11.2.
272 chr6 29364951 29364951 1 + G A rs2073151 29364951 - 29364931 29364971 41 GTTCAAGCGAGAAGTCATTACGGAGTGCAGCAGGGCATGGA GTTCAAGCGAGAAGTCATTATGGAGTGCAGCAGGGCATGGA Direct Gain 0 0.58216404914856 Functional Gain 0.58216404914856 OR12D2 ENSG00000168787 CDS Human other chr6:29364951 chr6:29364951 nonsynonymous SNV 0.000 0 21 hm5U_associated_SNPs_191123 0 17554300 Multiple complex diseases 1.3e-11 Johnson and O'Donnell TagSNP rs2073151 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
273 chr6 29910759 29910759 1 + T A rs1071742 29910759 - 29910739 29910779 41 CGCGCAGGGTCCCCAGGTCCACTCGGTCAGTCTGTGACTGG CGCGCAGGGTCCCCAGGTCCTCTCGGTCAGTCTGTGACTGG Direct Gain 0 0.932652592658997 Functional Gain 0.932652592658997 HLA-A ENSG00000206503 CDS Human protein_coding chr6:29910759 chr6:29910759 nonsynonymous SNV 0.000 0 21 hm5U_associated_SNPs_191233 0 30048462 Heel bone mineral density 2e-17 GWAS_Catalog TagSNP rs1071742 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
274 chr6 31024601 31024601 1 + C A rs9262631 31024601 - 31024581 31024621 41 AATTCCCATGGGTGTCAGGAGCCTGGTGGGTTTCACTGCTG AATTCCCATGGGTGTCAGGATCCTGGTGGGTTTCACTGCTG Direct Gain 0 0.744376301765442 Functional Gain 0.744376301765442 HCG22 ENSG00000228789 ncRNA_exonic Human lincRNA chr6:31024601 chr6:31024601 . . 0 21 hm5U_associated_SNPs_191376 0 26151496 Thionamide-induced agranulocytosis in Graves' disease 6e-19 GWAS_Catalog TagSNP rs9262631 GCST003018 Genetic determinants of antithyroid drug-induced agranulocytosis by human leukocyte antigen genotyping and genome-wide association study.
275 chr6 31093482 31093482 1 + G A rs3131003 31093482 - 31093462 31093502 41 AGGCAAGAAGTCAGGGCTCACGGACTGTAGATTCCACCCTT AGGCAAGAAGTCAGGGCTCATGGACTGTAGATTCCACCCTT Direct Gain 0 0.843894302845001 Functional Gain 0.843894302845001 PSORS1C1 ENSG00000204540 UTR5 Human protein_coding chr6:31093482 chr6:31093482 . . 0 21 hm5U_associated_SNPs_191379 0 17641165 HIV-1 disease progression 1.38e-05 Johnson and O'Donnell TagSNP rs3131003 . A whole-genome association study of major determinants for host control of HIV-1.
276 chr6 31093587 31093587 1 + G A rs3815087 31093587 - 31093567 31093607 41 GCCCACTGGCATGGAGCCCACGGTCCGGGGGTGATGGTTTC GCCCACTGGCATGGAGCCCATGGTCCGGGGGTGATGGTTTC Direct Gain 0 0.683278143405914 Functional Gain 0.683278143405914 PSORS1C1 ENSG00000204540 UTR5 Human protein_coding chr6:31093587 chr6:31093587 . . 0 21 hm5U_associated_SNPs_191380 0 21801394 Drug-induced Stevens-Johnson syndrome or toxic epidermal necrolysis (SJS/TEN) 3e-07 GWAS_Catalog TagSNP rs3815087 GCST001181 Genome-wide association study of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis in Europe.
277 chr6 31106459 31106459 1 + C A rs1265097 31106459 - 31106439 31106479 41 ATCTGTGTTAAGGAGCTGGGGTCCTTGTAAAGCTGGGGTCT ATCTGTGTTAAGGAGCTGGGTTCCTTGTAAAGCTGGGGTCT Direct Gain 0 0.908315539360046 Functional Gain 0.908315539360046 PSORS1C1 ENSG00000204540 CDS Human protein_coding chr6:31106459 chr6:31106459 nonsynonymous SNV 0.000 1 21 hm5U_associated_SNPs_191382 0 28552196 Height 1e-10 GWAS_Catalog TagSNP rs1265097 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
278 chr6 31138107 31138107 1 + G A rs1062630 31138107 - 31138087 31138127 41 GAGACCTCTCAGCCTGAGGGCGAAGCAGGAGTCGGGGTGGA GAGACCTCTCAGCCTGAGGGTGAAGCAGGAGTCGGGGTGGA Direct Gain 0 0.859765887260437 Functional Gain 0.859765887260437 POU5F1 ENSG00000204531 CDS Human protein_coding chr6:31138107 chr6:31138107 synonymous SNV . 0 21 hm5U_associated_SNPs_191387 0 28654678 Epstein-Barr virus copy number in lymphoblastoid cell lines 1e-06 GWAS_Catalog TagSNP rs1062630 GCST004735 Genetic factors affecting EBV copy number in lymphoblastoid cell lines derived from the 1000 Genome Project samples.
279 chr6 31367865 31367865 1 + G A rs2523454 31367865 - 31367845 31367885 41 GCGTGATCTGGAATCCGGCTCTCTTGAAACAGCACCGCGGA GCGTGATCTGGAATCCGGCTTTCTTGAAACAGCACCGCGGA Direct Gain 0 0.868010997772217 Functional Gain 0.868010997772217 MICA ENSG00000206337 upstream Human sense_overlapping chr6:31367865 chr6:31367865 . . 0 21 hm5U_associated_SNPs_191392 0 17632545 Type I Diabetes 3.33e-16 Johnson and O'Donnell TagSNP rs2523454 . A genome-wide association study identifies KIAA0350 as a type 1 diabetes gene.
280 chr6 31379931 31379931 1 + G A rs1063635 31379931 - 31379911 31379951 41 TGAACCTCTGCTCCTCTCCTCGGCAAATCCTGGTGGCCACC TGAACCTCTGCTCCTCTCCTTGGCAAATCCTGGTGGCCACC Direct Gain 0 0.760779976844788 Functional Gain 0.760779976844788 MICA ENSG00000204520 CDS Human protein_coding chr6:31379931 chr6:31379931 nonsynonymous SNV 0.042 0 21 hm5U_associated_SNPs_191403 1 17554300 Multiple complex diseases 9.16e-13 Johnson and O'Donnell TagSNP rs1063635 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
281 chr6 31496915 31496915 1 + G A rs2259435 31496915 - 31496895 31496935 41 TCCTCTGGAGCTGGTCTGCTCTTCCATGCTTGCTTTGGGGT TCCTCTGGAGCTGGTCTGCTTTTCCATGCTTGCTTTGGGGT Direct Gain 0 0.835440993309021 Functional Gain 0.835440993309021 MCCD1 ENSG00000204511 CDS Human protein_coding chr6:31496915 chr6:31496915 nonsynonymous SNV 0.273 0 21 hm5U_associated_SNPs_191415 0 17804836 Rheumatoid Arthritis 2.79e-06 Johnson and O'Donnell TagSNP rs2259435 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
282 chr6 31497835 31497835 1 + G A rs3115537 31497835 - 31497815 31497855 41 CTGCCTGCCAATTGCCTGCGCTTTGTGGTCTCTTCCACTTT CTGCCTGCCAATTGCCTGCGTTTTGTGGTCTCTTCCACTTT Direct Gain 0 0.677440702915192 Functional Gain 0.677440702915192 MCCD1 ENSG00000204511 UTR3 Human protein_coding chr6:31497835 chr6:31497835 . . 0 21 hm5U_associated_SNPs_191417 0 17554300 Multiple complex diseases 1.34e-06 Johnson and O'Donnell TagSNP rs3115537 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
283 chr6 31540071 31540071 1 + G A rs1800683 31540071 - 31540051 31540091 41 GGAGAGCCTCACCTGCTGTGCGGAGCCCCTGGGCCCGGACG GGAGAGCCTCACCTGCTGTGTGGAGCCCCTGGGCCCGGACG Direct Gain 0 0.599443733692169 Functional Gain 0.599443733692169 LTA ENSG00000226979 UTR5 Human protein_coding chr6:31540071 chr6:31540071 . . 0 21 hm5U_associated_SNPs_191422 0 12426569 Myocardial infarction 3.3e-06 Johnson and O'Donnell TagSNP rs1800683 . Functional SNPs in the lymphotoxin-alpha gene that are associated with susceptibility to myocardial infarction.
284 chr6 31602967 31602967 1 + G A rs1046089 31602967 - 31602947 31602987 41 GCTCTGTGCCTCGGTCTGTACGCTGTGATCGTTCTGTGCCA GCTCTGTGCCTCGGTCTGTATGCTGTGATCGTTCTGTGCCA Direct Gain 0 0.78151798248291 Functional Gain 0.78151798248291 PRRC2A ENSG00000204469 CDS Human protein_coding chr6:31602967 chr6:31602967 nonsynonymous SNV 1.000 1 21 hm5U_associated_SNPs_191435 0 22267201 Menopause (age at onset) 2e-16 GWAS_Catalog TagSNP rs1046089 GCST001381 Meta-analyses identify 13 loci associated with age at menopause and highlight DNA repair and immune pathways.
285 chr6 31914180 31914180 1 + G A rs641153 31914180 - 31914160 31914200 41 GAGAGCAGGATCCCTGGGGCCGGGCCAAAGACCATGGAGTG GAGAGCAGGATCCCTGGGGCTGGGCCAAAGACCATGGAGTG Direct Gain 0 0.789123237133026 Functional Gain 0.789123237133026 CFB ENSG00000243649;ENSG00000244255 CDS Human other chr6:31914180 chr6:31914180 nonsynonymous SNV 0.000 0 21 hm5U_associated_SNPs_191466 7 22705344 Age-related macular degeneration (choroidal neovascularisation) 1e-17 GWAS_Catalog TagSNP rs641153 GCST001579 Heritability and genome-wide association study to assess genetic differences between advanced age-related macular degeneration subtypes.
286 chr6 31996524 31996524 1 + C A rs406658 31996524 - 31996504 31996544 41 TCCTGCAGTTTCTCAGGCGAGCCTCCTACCTGCTCCTGGGC TCCTGCAGTTTCTCAGGCGATCCTCCTACCTGCTCCTGGGC Direct Gain 0 0.701105356216431 Functional Gain 0.701105356216431 C4B;C4B_2 ENSG00000224389 CDS Human protein_coding chr6:31996524 chr6:31996524 synonymous SNV . 0 21 hm5U_associated_SNPs_191491 0 29875488 Blood protein levels 3e-52 GWAS_Catalog TagSNP rs406658 GCST005806 Genomic atlas of the human plasma proteome.
287 chr6 32122472 32122472 1 + C A rs3096696 32122472 - 32122452 32122492 41 CGATGACCGGCTTGTAGGACGCGCGGTGGGGCGCGGGGGCT CGATGACCGGCTTGTAGGACTCGCGGTGGGGCGCGGGGGCT Direct Gain 0 0.831031441688538 Functional Gain 0.831031441688538 PPT2 ENSG00000221988;ENSG00000258388 CDS Human other chr6:32122472 chr6:32122472 nonsynonymous SNV 0.852 1 21 hm5U_associated_SNPs_191494 0 25987655 Asparaginase hypersensitivity in acute lymphoblastic leukemia 4e-06 GWAS_Catalog TagSNP rs3096696 GCST002915 Genome-wide analysis links NFATC2 with asparaginase hypersensitivity.
288 chr6 32134510 32134510 1 + G A rs3096697 32134510 - 32134490 32134530 41 GGGTCTGCTGAACCTCCCGCCTCACCTCCCGCCACATAACG GGGTCTGCTGAACCTCCCGCTTCACCTCCCGCCACATAACG Direct Gain 0 0.869958877563477 Functional Gain 0.869958877563477 EGFL8 ENSG00000241404 CDS Human protein_coding chr6:32134510 chr6:32134510 nonsynonymous SNV 0.994 0 21 hm5U_associated_SNPs_191495 0 21323541 Idiopathic membranous nephropathy 1e-41 GWAS_Catalog TagSNP rs3096697 GCST000984 Risk HLA-DQA1 and PLA(2)R1 alleles in idiopathic membranous nephropathy.
289 chr6 32611951 32611951 1 + C A rs9273039 32611951 - 32611931 32611971 41 CCTCGGAGATGGCGAATCCAGTGGAGGACACAGCACCCACT CCTCGGAGATGGCGAATCCATTGGAGGACACAGCACCCACT Direct Gain 0 0.635104179382324 Functional Gain 0.635104179382324 HLA-DQA1 ENSG00000196735 downstream Human protein_coding chr6:32611951 chr6:32611951 . . 0 21 hm5U_associated_SNPs_191517 0 27863252 Hematocrit 1e-25 GWAS_Catalog TagSNP rs9273039 GCST004604 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
290 chr6 33408542 33408542 1 + G A rs411136 33408542 - 33408522 33408562 41 TCTGCGCAGCGCAGCCGCCACGAAGCAAACACCTCCTTCAG TCTGCGCAGCGCAGCCGCCATGAAGCAAACACCTCCTTCAG Direct Gain 0 0.874733328819275 Functional Gain 0.874733328819275 SYNGAP1 ENSG00000197283 CDS Human protein_coding chr6:33408542 chr6:33408542 synonymous SNV . 0 21 hm5U_associated_SNPs_191594 1 17554300 Multiple complex diseases 5.31e-06 Johnson and O'Donnell TagSNP rs411136 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
291 chr6 33643558 33643558 1 + G A rs2229637 33643558 - 33643538 33643578 41 TGCAGGGCACCCGAGACCAGCGGCGCATAGTCGTGCATGGT TGCAGGGCACCCGAGACCAGTGGCGCATAGTCGTGCATGGT Direct Gain 0 0.72238165140152 Functional Gain 0.72238165140152 ITPR3 ENSG00000096433 CDS Human protein_coding chr6:33643558 chr6:33643558 synonymous SNV . 0 21 hm5U_associated_SNPs_191601 0 28203683 Venous thromboembolism adjusted for sickle cell variant rs77121243-T 5e-07 GWAS_Catalog TagSNP rs2229637 GCST004068 Identification of unique venous thromboembolism-susceptibility variants in African-Americans.
292 chr6 35389999 35389999 1 + G A rs2076168 35389999 - 35389979 35390019 41 TTCCCTTCTGGGCCAGAATGCGTAAACCTCAGGTATAGGGA TTCCCTTCTGGGCCAGAATGTGTAAACCTCAGGTATAGGGA Direct Gain 0 0.673780679702759 Functional Gain 0.673780679702759 PPARD ENSG00000112033 intronic Human protein_coding chr6:35389999 chr6:35389999 . . 0 21 hm5U_associated_SNPs_191680 0 30048462 Heel bone mineral density 4e-10 GWAS_Catalog TagSNP rs2076168 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
293 chr6 43153787 43153787 1 + G A rs61743561 43153787 - 43153767 43153807 41 CACATGGGGAGCTTTGGTCTCCAGCTCCCAGCTCTGGACTG CACATGGGGAGCTTTGGTCTTCAGCTCCCAGCTCTGGACTG Direct Gain 0 0.974977195262909 Functional Gain 0.974977195262909 CUL9 ENSG00000112659 CDS Human protein_coding chr6:43153787 chr6:43153787 nonsynonymous SNV 0.989 0 21 hm5U_associated_SNPs_191892 0 23251661 Obesity-related traits 9e-06 GWAS_Catalog TagSNP rs61743561 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
294 chr6 43970827 43970827 1 + G A rs2295334 43970827 - 43970807 43970847 41 GGCCCAGCGCCGCGGAGCGCCGCGGATGACAGCGGCGGTGG GGCCCAGCGCCGCGGAGCGCTGCGGATGACAGCGGCGGTGG Direct Gain 0 0.972284913063049 Functional Gain 0.972284913063049 C6orf223 ENSG00000181577 CDS Human protein_coding chr6:43970827 chr6:43970827 synonymous SNV . 0 21 hm5U_associated_SNPs_191965 0 25629512 Exudative age-related macular degeneration 6e-18 GWAS_Catalog TagSNP rs2295334 GCST002766 New loci and coding variants confer risk for age-related macular degeneration in East Asians.
295 chr6 144081609 144081609 1 + C A rs2073214 144081609 - 144081589 144081629 41 TTTTTTGGGTTTAGGTTTGGGTCTAGGCTTAGGAGGAGCAG TTTTTTGGGTTTAGGTTTGGTTCTAGGCTTAGGAGGAGCAG Direct Gain 0 0.602225422859192 Functional Gain 0.602225422859192 PHACTR2 ENSG00000112419 CDS Human protein_coding chr6:144081609 chr6:144081609 nonsynonymous SNV 0.998 1 21 hm5U_associated_SNPs_192348 0 25886283 Magnesium levels 8e-06 GWAS_Catalog TagSNP rs2073214 GCST002860 Genome-wide association study of serum minerals levels in children of different ethnic background.
296 chr6 158910698 158910698 1 + G A rs12206717 158910698 - 158910678 158910718 41 TCTTGGCAGCCCAGTCATCACTCAGCTCAATGTCACTGGAG TCTTGGCAGCCCAGTCATCATTCAGCTCAATGTCACTGGAG Direct Gain 0 0.794049024581909 Functional Gain 0.794049024581909 TULP4 ENSG00000130338 CDS Human protein_coding chr6:158910698 chr6:158910698 nonsynonymous SNV 1.000 1 21 hm5U_associated_SNPs_192506 0 30598549 Heel bone mineral density 1e-13 GWAS_Catalog TagSNP rs12206717 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
297 chr6 160551204 160551204 1 + G A rs683369 160551204 - 160551184 160551224 41 CCAACACCGAGAGAGCCAAACAAGAAGCCCGCATTCAAACA CCAACACCGAGAGAGCCAAATAAGAAGCCCGCATTCAAACA Direct Gain 0 0.60863596200943 Functional Gain 0.60863596200943 SLC22A1 ENSG00000175003 CDS Human protein_coding chr6:160551204 chr6:160551204 synonymous SNV . 0 21 hm5U_associated_SNPs_192566 0 22179738 Gout 1e-07 GWAS_Catalog TagSNP rs683369 GCST001356 Gout and type 2 diabetes have a mutual inter-dependent effect on genetic risk factors and higher incidences.
298 chr6 161132830 161132830 1 + G A rs1830519 161132830 - 161132810 161132850 41 CATGTGATGAGAGTTCTAACCTGATATGCTTACTTCAGTCC CATGTGATGAGAGTTCTAACTTGATATGCTTACTTCAGTCC Direct Gain 0 0.536962985992432 Functional Gain 0.536962985992432 PLG ENSG00000122194 UTR3 Human protein_coding chr6:161132830 chr6:161132830 . . 0 21 hm5U_associated_SNPs_192575 0 17554300 Multiple complex diseases 1.79089e-07 Johnson and O'Donnell TagSNP rs1830519 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
299 chr7 23306141 23306141 1 + G A rs75801644 23306141 - 23306121 23306161 41 CTCCAGGGGGTTGTCACCAGCAGGTCCTGGGGTGTTTGAAT CTCCAGGGGGTTGTCACCAGTAGGTCCTGGGGTGTTTGAAT Direct Gain 0 0.702011823654175 Functional Gain 0.702011823654175 GPNMB ENSG00000136235 CDS Human protein_coding chr7:23306141 chr7:23306141 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_193240 0 28881265 Endometriosis 8e-10 GWAS_Catalog TagSNP rs75801644 GCST004873 New variants near RHOJ and C2, HLA-DRA region and susceptibility to endometriosis in the Polish population-The genome-wide association study.
300 chr7 44622286 44622286 1 + G A rs217358 44622286 - 44622266 44622306 41 TTACGAGTCAGATAGGTGGACACGCAAAGCAAAACATCACA TTACGAGTCAGATAGGTGGATACGCAAAGCAAAACATCACA Direct Gain 0 0.82979679107666 Functional Gain 0.82979679107666 TMED4 ENSG00000158604 upstream Human protein_coding chr7:44622286 chr7:44622286 . . 0 21 hm5U_associated_SNPs_193521 0 17554300 Multiple complex diseases 0.000165477 Johnson and O'Donnell TagSNP rs217358 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
301 chr7 44808017 44808017 1 + G A rs1050327 44808017 - 44807997 44808037 41 GAGAGCCCACCCACCCACCTCGGCCAGGCCGAAGCTCACTG GAGAGCCCACCCACCCACCTTGGCCAGGCCGAAGCTCACTG Direct Gain 0 0.556692183017731 Functional Gain 0.556692183017731 ZMIZ2 ENSG00000122515 UTR3 Human protein_coding chr7:44808017 chr7:44808017 . . 0 21 hm5U_associated_SNPs_193536 0 29326435 Intelligence (MTAG) 2e-09 GWAS_Catalog TagSNP rs1050327 GCST005316 A combined analysis of genetically correlated traits identifies 187 loci and a role for neurogenesis and myelination in intelligence.
302 chr7 99047978 99047978 1 + T A rs883403 99047978 - 99047958 99047998 41 CTACCGTGCTTGCAGAAGCCACGGTCATACCAAGGACAGTC CTACCGTGCTTGCAGAAGCCTCGGTCATACCAAGGACAGTC Direct Gain 0 0.557563900947571 Functional Gain 0.557563900947571 CPSF4 ENSG00000160917 CDS Human protein_coding chr7:99047978 chr7:99047978 synonymous SNV . 0 21 hm5U_associated_SNPs_194037 0 30643258 Smoking status (ever vs never smokers) 3e-10 GWAS_Catalog TagSNP rs883403 GCST007327 Genome-wide association analyses of risk tolerance and risky behaviors in over 1 million individuals identify hundreds of loci and shared genetic influences.
303 chr7 99956436 99956436 1 + T A rs11771799 99956436 - 99956416 99956456 41 ATATTCTCACGTTGGGAACTATGGCTAACTCCCAGGGGTAA ATATTCTCACGTTGGGAACTTTGGCTAACTCCCAGGGGTAA Direct Gain 0 0.521265268325806 Functional Gain 0.521265268325806 PILRB ENSG00000121716 CDS Human protein_coding chr7:99956436 chr7:99956436 nonsynonymous SNV 0.000 0 21 hm5U_associated_SNPs_194095 0 29875488 Blood protein levels 5e-31 GWAS_Catalog TagSNP rs11771799 GCST005806 Genomic atlas of the human plasma proteome.
304 chr7 105658451 105658451 1 + G A rs6967330 105658451 - 105658431 105658471 41 TATAGATGGGGGTTGTTTCACAGTCCACTTTAGTTACCAGC TATAGATGGGGGTTGTTTCATAGTCCACTTTAGTTACCAGC Direct Gain 0 0.756291031837463 Functional Gain 0.756291031837463 CDHR3 ENSG00000128536 CDS Human protein_coding chr7:105658451 chr7:105658451 nonsynonymous SNV 0.470 0 21 hm5U_associated_SNPs_194407 0 24241537 Asthma (childhood onset) 3e-14 GWAS_Catalog TagSNP rs6967330 GCST002275 A genome-wide association study identifies CDHR3 as a susceptibility locus for early childhood asthma with severe exacerbations.
305 chr7 105658460 105658460 1 + C A rs73195662 105658460 - 105658440 105658480 41 TTCTGAGAATATAGATGGGGGTTGTTTCACAGTCCACTTTA TTCTGAGAATATAGATGGGGTTTGTTTCACAGTCCACTTTA Direct Gain 0 0.750664174556732 Functional Gain 0.750664174556732 CDHR3 ENSG00000128536 CDS Human protein_coding chr7:105658460 chr7:105658460 nonsynonymous SNV 0.438 0 21 hm5U_associated_SNPs_194408 0 30450575 PEG-asparaginase hypersensitivity without enzyme activity in childhood acute lymphoblastic leukaemia 1e-06 GWAS_Catalog TagSNP rs73195662 GCST007540 Genetic predisposition to PEG-asparaginase hypersensitivity in children treated according to NOPHO ALL2008.
306 chr7 130025713 130025713 1 + G A rs77792157 130025713 - 130025693 130025733 41 CTTGGTCCCGTAGAGAGAGGCCAGGGCTGTCACAGCAGCCT CTTGGTCCCGTAGAGAGAGGTCAGGGCTGTCACAGCAGCCT Direct Gain 0 0.826379716396332 Functional Gain 0.826379716396332 CPA1 ENSG00000091704 CDS Human protein_coding chr7:130025713 chr7:130025713 nonsynonymous SNV 0.363 0 21 hm5U_associated_SNPs_194606 0 30718926 Type 2 diabetes 3e-09 GWAS_Catalog TagSNP rs77792157 GCST007847 Identification of 28 new susceptibility loci for type 2 diabetes in the Japanese population.
307 chr7 150440040 150440040 1 + G A rs61751050 150440040 - 150440020 150440060 41 AAGTGTTTGACTCTGAGGAGCGCCTTGTATGCCCAGTTACT AAGTGTTTGACTCTGAGGAGTGCCTTGTATGCCCAGTTACT Direct Gain 0 0.848061144351959 Functional Gain 0.848061144351959 GIMAP1-GIMAP5;GIMAP5 ENSG00000196329 CDS Human protein_coding chr7:150440040 chr7:150440040 synonymous SNV . 0 21 hm5U_associated_SNPs_194962 0 29221444 Coronary artery calcified atherosclerotic plaque (130 HU threshold) in type 2 diabetes 4e-06 GWAS_Catalog TagSNP rs61751050 GCST005173 Genome-wide association study of coronary artery calcified atherosclerotic plaque in African Americans with type 2 diabetes.
308 chr7 150696111 150696111 1 + T A rs1799983 150696111 - 150696091 150696131 41 AGAAGGAAGAGTTCTGGGGGATCATCTGGGGCCTGCAGCAG AGAAGGAAGAGTTCTGGGGGTTCATCTGGGGCCTGCAGCAG Direct Gain 0 0.657037377357483 Functional Gain 0.657037377357483 NOS3 ENSG00000164867 CDS Human protein_coding chr7:150696111 chr7:150696111 nonsynonymous SNV 0.954 0 21 hm5U_associated_SNPs_194981 0 30383316 Stroke 2e-08 GWAS_Catalog TagSNP rs1799983 GCST007248 Genome-Wide Meta-analysis identifies three novel loci associated with stroke.
309 chr7 150761314 150761314 1 + G A rs2303929 150761314 - 150761294 150761334 41 GCTCGGGGAACCCAGGCGTCCCAGGGCCCAAGCTCTCTGGC GCTCGGGGAACCCAGGCGTCTCAGGGCCCAAGCTCTCTGGC Direct Gain 0 0.95502120256424 Functional Gain 0.95502120256424 SLC4A2 ENSG00000164889 CDS Human protein_coding chr7:150761314 chr7:150761314 nonsynonymous SNV 0.043 1 21 hm5U_associated_SNPs_195010 0 30038396 Educational attainment (years of education) 4e-08 GWAS_Catalog TagSNP rs2303929 GCST006442 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
310 chr8 8092025 8092025 1 + G A rs2980436 8092025 - 8092005 8092045 41 TCGTACAGCTCATCCAAAGGCTCCGTGTGGACAGCCTCGTG TCGTACAGCTCATCCAAAGGTTCCGTGTGGACAGCCTCGTG Direct Gain 0 0.906506896018982 Functional Gain 0.906506896018982 FAM86B3P ENSG00000173295 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr8:8092025 chr8:8092025 . . 0 21 hm5U_associated_SNPs_195294 0 28991256 Schizophrenia 2e-08 GWAS_Catalog TagSNP rs2980436 GCST004946 Genome-wide association analysis identifies 30 new susceptibility loci for schizophrenia.
311 chr8 29648854 29648854 1 + G A rs9693533 29648854 - 29648834 29648874 41 CATCAAGCTGGTGGGTCTCTCAGGTCTGTTGTGGTTGTGAT CATCAAGCTGGTGGGTCTCTTAGGTCTGTTGTGGTTGTGAT Direct Gain 0 0.611195623874664 Functional Gain 0.611195623874664 LINC02099 ENSG00000253490 ncRNA_exonic Human lincRNA chr8:29648854 chr8:29648854 . . 0 21 hm5U_associated_SNPs_195704 0 30573740 Male-pattern baldness 7e-18 GWAS_Catalog TagSNP rs9693533 GCST007020 Dissection of genetic variation and evidence for pleiotropy in male pattern baldness.
312 chr8 32405979 32405979 1 + T A rs7820838 32405979 - 32405959 32405999 41 GGAAGTCGTCGATGGGTCCCACCGCTGGCGGCTCGCGTCCT GGAAGTCGTCGATGGGTCCCTCCGCTGGCGGCTCGCGTCCT Direct Gain 0 0.981984376907349 Functional Gain 0.981984376907349 NRG1 ENSG00000157168 UTR5 Human protein_coding chr8:32405979 chr8:32405979 . . 0 21 hm5U_associated_SNPs_195716 0 28604730 Lung cancer 4e-06 GWAS_Catalog TagSNP rs7820838 GCST004748 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
313 chr8 121061879 121061879 1 + G A rs4871827 121061879 - 121061859 121061899 41 GGCCCGTCAGAATCAGATTGCTCACGGTCCGGTAGTCTACA GGCCCGTCAGAATCAGATTGTTCACGGTCCGGTAGTCTACA Direct Gain 0 0.786739706993103 Functional Gain 0.786739706993103 DEPTOR ENSG00000155792 CDS Human protein_coding chr8:121061879 chr8:121061879 nonsynonymous SNV 1.000 1 21 hm5U_associated_SNPs_196123 0 30598549 Heel bone mineral density 1e-09 GWAS_Catalog TagSNP rs4871827 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
314 chr8 128428795 128428795 1 + G A rs6998254 128428795 - 128428775 128428815 41 GTTCGCTTTCTCTTTCGGGCCTGCATGAGGGTTTCTGCTTT GTTCGCTTTCTCTTTCGGGCTTGCATGAGGGTTTCTGCTTT Direct Gain 0 0.570781946182251 Functional Gain 0.570781946182251 POU5F1B ENSG00000212993 CDS Human protein_coding chr8:128428795 chr8:128428795 synonymous SNV . 0 21 hm5U_associated_SNPs_196184 0 17618284 Colorectal cancer 0.0085 Johnson and O'Donnell TagSNP rs6998254 . A genome-wide association scan of tag SNPs identifies a susceptibility variant for colorectal cancer at 8q24.21.
315 chr8 142200467 142200467 1 + G A rs1045303 142200467 - 142200447 142200487 41 ATGGACGTCAGGCCACCTCGCGGCAGCTGGAAGCGGCTGGT ATGGACGTCAGGCCACCTCGTGGCAGCTGGAAGCGGCTGGT Direct Gain 0 0.714935481548309 Functional Gain 0.714935481548309 DENND3 ENSG00000105339 CDS Human protein_coding chr8:142200467 chr8:142200467 synonymous SNV . 0 21 hm5U_associated_SNPs_196224 0 30595370 White blood cell count 5e-10 GWAS_Catalog TagSNP rs1045303 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
316 chr9 35841783 35841783 1 + G A rs2236293 35841783 - 35841763 35841803 41 AGGGGTTCTGACCTTGCAACCGCACACACAGCTGGAAGCGG AGGGGTTCTGACCTTGCAACTGCACACACAGCTGGAAGCGG Direct Gain 0 0.559736907482147 Functional Gain 0.559736907482147 TMEM8B ENSG00000137103 UTR5 Human protein_coding chr9:35841783 chr9:35841783 . . 0 21 hm5U_associated_SNPs_196799 0 28240269 Blood protein levels 5e-14 GWAS_Catalog TagSNP rs2236293 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
317 chr9 35909518 35909518 1 + G A rs748802 35909518 - 35909498 35909538 41 GGTGGCCGTCCCAGGGACCACGGCGTTCCTCCCTGGGTGCT GGTGGCCGTCCCAGGGACCATGGCGTTCCTCCCTGGGTGCT Direct Gain 0 0.915279567241669 Functional Gain 0.915279567241669 SPAAR ENSG00000235387 ncRNA_exonic Human protein_coding chr9:35909518 chr9:35909518 . . 0 21 hm5U_associated_SNPs_196808 0 27798624 Resting heart rate 1e-08 GWAS_Catalog TagSNP rs748802 GCST003818 Identification of genomic loci associated with resting heart rate and shared genetic predictors with all-cause mortality.
318 chr9 71789104 71789104 1 + G A rs62567129 71789104 - 71789084 71789124 41 GCGGCGGCGTCAGCCCGCCCCCGACCCGAGCGTGGCGCCTC GCGGCGGCGTCAGCCCGCCCTCGACCCGAGCGTGGCGCCTC Direct Gain 0 0.962446808815002 Functional Gain 0.962446808815002 TJP2 ENSG00000119139 UTR5 Human protein_coding chr9:71789104 chr9:71789104 . . 0 21 hm5U_associated_SNPs_196922 0 30535121 Macular thickness 3e-08 GWAS_Catalog TagSNP rs62567129 GCST006976 Genome-wide association analyses identify 139 loci associated with macular thickness in the UK Biobank cohort.
319 chr9 91616843 91616843 1 + G A rs34075341 91616843 - 91616823 91616863 41 TCACCACAATCACCACGGTCCGCAGCAGTGCCATGGACCGC TCACCACAATCACCACGGTCTGCAGCAGTGCCATGGACCGC Direct Gain 0 0.793656826019287 Functional Gain 0.793656826019287 S1PR3 ENSG00000213694 CDS Human protein_coding chr9:91616843 chr9:91616843 nonsynonymous SNV 0.997 3 21 hm5U_associated_SNPs_197056 0 27863252 Monocyte percentage of white cells 9e-10 GWAS_Catalog TagSNP rs34075341 GCST004609 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
320 chr9 102732237 102732237 1 + T A rs9556 102732237 - 102732217 102732257 41 GCGGTTTGAGATAGACATGCAGTTGGGCTGGGCCATGCTTG GCGGTTTGAGATAGACATGCTGTTGGGCTGGGCCATGCTTG Direct Gain 0 0.621508121490479 Functional Gain 0.621508121490479 STX17 ENSG00000136874 UTR3 Human protein_coding chr9:102732237 chr9:102732237 . . 0 21 hm5U_associated_SNPs_197224 0 30595370 Hair color 7e-09 GWAS_Catalog TagSNP rs9556 GCST007082 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
321 chr9 124521260 124521260 1 + G A rs3747851 124521260 - 124521240 124521280 41 CTTACCTTGTTGGGATGCACCGCTCGCCGGAGGTTCTCCAT CTTACCTTGTTGGGATGCACTGCTCGCCGGAGGTTCTCCAT Direct Gain 0 0.704423546791077 Functional Gain 0.704423546791077 DAB2IP ENSG00000136848 CDS Human protein_coding chr9:124521260 chr9:124521260 synonymous SNV . 0 21 hm5U_associated_SNPs_197410 0 23648065 Adverse response to chemotherapy (neutropenia/leucopenia) (docetaxel) 6e-07 GWAS_Catalog TagSNP rs3747851 GCST001995 Genome-wide association study of chemotherapeutic agent-induced severe neutropenia/leucopenia for patients in Biobank Japan.
322 chr9 124535526 124535526 1 + C A rs56200518 124535526 - 124535506 124535546 41 GGGGCCAGCACTGTTCTGCCGTGGCACCGTGGGCTGCCCGC GGGGCCAGCACTGTTCTGCCTTGGCACCGTGGGCTGCCCGC Direct Gain 0 0.592569351196289 Functional Gain 0.592569351196289 DAB2IP ENSG00000136848 CDS Human protein_coding chr9:124535526 chr9:124535526 synonymous SNV . 0 21 hm5U_associated_SNPs_197417 0 30048462 Heel bone mineral density 8e-10 GWAS_Catalog TagSNP rs56200518 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
323 chr9 131572027 131572027 1 + G A rs15676 131572027 - 131572007 131572047 41 CCGCTCAGCCAGGACCTGCTCGAAAACCAGGCAGTTCCTAG CCGCTCAGCCAGGACCTGCTTGAAAACCAGGCAGTTCCTAG Direct Gain 0 0.678701341152191 Functional Gain 0.678701341152191 TBC1D13 ENSG00000107021 UTR3 Human protein_coding chr9:131572027 chr9:131572027 . . 0 21 hm5U_associated_SNPs_197737 0 24816252 Blood metabolite levels 1e-12 GWAS_Catalog TagSNP rs15676 GCST002443 An atlas of genetic influences on human blood metabolites.
324 chr9 133284310 133284310 1 + G A rs10793975 133284310 - 133284290 133284330 41 CCCGCCTTGCCTCAGTCCTGCGGATGGTCAGCGAGCCATTC CCCGCCTTGCCTCAGTCCTGTGGATGGTCAGCGAGCCATTC Direct Gain 0 0.85411274433136 Functional Gain 0.85411274433136 HMCN2 ENSG00000215428;ENSG00000148357 intergenic Human other chr9:133284310 chr9:133284310 . 0.110 0 21 hm5U_associated_SNPs_197853 0 17641165 HIV-1 disease progression 1.24e-05 Johnson and O'Donnell TagSNP rs10793975 . A whole-genome association study of major determinants for host control of HIV-1.
325 chr9 137779251 137779251 1 + G A rs76267164 137779251 - 137779231 137779271 41 CCGGCCTGGGCTAGGCAGGTCGCACCTTCATCTCTGACACC CCGGCCTGGGCTAGGCAGGTTGCACCTTCATCTCTGACACC Direct Gain 0 0.794049203395844 Functional Gain 0.794049203395844 FCN2 ENSG00000160339 CDS Human protein_coding chr9:137779251 chr9:137779251 nonsynonymous SNV 0.584 3 21 hm5U_associated_SNPs_198151 0 29875488 Blood protein levels 7e-19 GWAS_Catalog TagSNP rs76267164 GCST005806 Genomic atlas of the human plasma proteome.
326 chr9 138012412 138012412 1 + G A rs11834 138012412 - 138012392 138012432 41 TGGCTCTCAAAGAGCCTGGACGCCACATTCCTCGGAGCTGA TGGCTCTCAAAGAGCCTGGATGCCACATTCCTCGGAGCTGA Direct Gain 0 0.620924770832062 Functional Gain 0.620924770832062 OLFM1 ENSG00000130558 UTR3 Human protein_coding chr9:138012412 chr9:138012412 . . 0 21 hm5U_associated_SNPs_198165 0 26148204 6-month creatinine clearance change response to tenofovir treatment in HIV infection (treatment arm interaction) 3e-06 GWAS_Catalog TagSNP rs11834 GCST006072 Genomewide association study of tenofovir pharmacokinetics and creatinine clearance in AIDS Clinical Trials Group protocol A5202.
327 chr9 139316916 139316916 1 + G A rs10870166 139316916 - 139316896 139316936 41 CAGGTTTTAAGCCTGTCCCCCAGAAGAGTCCGATGCACATA CAGGTTTTAAGCCTGTCCCCTAGAAGAGTCCGATGCACATA Direct Gain 0 0.542504906654358 Functional Gain 0.542504906654358 PMPCA ENSG00000165688 UTR3 Human protein_coding chr9:139316916 chr9:139316916 . . 0 21 hm5U_associated_SNPs_198284 0 17554300 Multiple complex diseases 4.4528e-05 Johnson and O'Donnell TagSNP rs10870166 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
328 chr10 21463740 21463740 1 + C A rs145215398 21463740 - 21463720 21463760 41 AAGCGCGGGGTCTGGGAGCCGGTGAGAGAAGGCTCTTTCTC AAGCGCGGGGTCTGGGAGCCTGTGAGAGAAGGCTCTTTCTC Direct Gain 0 0.62212735414505 Functional Gain 0.62212735414505 NEBL-AS1 ENSG00000231920 ncRNA_exonic Human antisense chr10:21463740 chr10:21463740 . . 0 21 hm5U_associated_SNPs_198837 0 30348214 DNA methylation variation (age effect) 1e-08 GWAS_Catalog TagSNP rs145215398 GCST006660 Genotype effects contribute to variation in longitudinal methylome patterns in older people.
329 chr10 43606856 43606856 1 + G A rs9282834 43606856 - 43606836 43606876 41 CTGCCTAGAGGTCTGCTGGTCGGTGGCCACCACCATGTAGT CTGCCTAGAGGTCTGCTGGTTGGTGGCCACCACCATGTAGT Direct Gain 0 0.53834342956543 Functional Gain 0.53834342956543 RET ENSG00000165731 CDS Human protein_coding chr10:43606856 chr10:43606856 nonsynonymous SNV 0.000 0 21 hm5U_associated_SNPs_198971 4 27702942 Hirschsprung disease 4e-14 GWAS_Catalog TagSNP rs9282834 GCST003764 Trans-ethnic meta-analysis of genome-wide association studies for Hirschsprung disease.
330 chr10 50824117 50824117 1 + G A rs1880676 50824117 - 50824097 50824137 41 TACTGTGCTCAGTGCTTCATCTCTGCATTCCGGCCACATCT TACTGTGCTCAGTGCTTCATTTCTGCATTCCGGCCACATCT Direct Gain 0 0.775725305080414 Functional Gain 0.775725305080414 CHAT ENSG00000070748 CDS Human protein_coding chr10:50824117 chr10:50824117 nonsynonymous SNV 0.007 2 21 hm5U_associated_SNPs_199060 1 17463246 Multiple continuous traits in DGI samples 0.00042 Johnson and O'Donnell TagSNP rs1880676 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
331 chr10 73115942 73115942 1 + G A rs2252996 73115942 - 73115922 73115962 41 CATGCAGAGCACGAGGAAGACAGTGGCCGTCAGGAAGAAGG CATGCAGAGCACGAGGAAGATAGTGGCCGTCAGGAAGAAGG Direct Gain 0 0.617617070674896 Functional Gain 0.617617070674896 SLC29A3 ENSG00000198246 CDS Human protein_coding chr10:73115942 chr10:73115942 nonsynonymous SNV 0.000 0 21 hm5U_associated_SNPs_199220 2 23273568 Systemic lupus erythematosus 3e-06 GWAS_Catalog TagSNP rs2252996 GCST001795 Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians.
332 chr10 114154752 114154752 1 + G A rs146605626 114154752 - 114154732 114154772 41 AATGTCAGGATGCAGATCAACGCCGGGGTCGGAAGTGGGGA AATGTCAGGATGCAGATCAATGCCGGGGTCGGAAGTGGGGA Direct Gain 0 0.704353332519531 Functional Gain 0.704353332519531 ACSL5 ENSG00000197142 CDS Human protein_coding chr10:114154752 chr10:114154752 synonymous SNV . 0 21 hm5U_associated_SNPs_199859 0 27863252 Mean platelet volume 1e-11 GWAS_Catalog TagSNP rs146605626 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
333 chr10 115348046 115348046 1 + G A rs7080536 115348046 - 115348026 115348066 41 TGTAGACCCCTGGCCTCTTCCCACACTCCAGGCCCCAGCTC TGTAGACCCCTGGCCTCTTCTCACACTCCAGGCCCCAGCTC Direct Gain 0 0.844183206558228 Functional Gain 0.844183206558228 HABP2 ENSG00000148702 CDS Human protein_coding chr10:115348046 chr10:115348046 nonsynonymous SNV 0.976 5 21 hm5U_associated_SNPs_199878 4 27863252 Eosinophil counts 7e-09 GWAS_Catalog TagSNP rs7080536 GCST004606 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
334 chr10 133957761 133957761 1 + G A rs954820 133957761 - 133957741 133957781 41 CAGGAAAAGCCCTGGCGCTTCCCCCGTCCGCATCCTGGTTT CAGGAAAAGCCCTGGCGCTTTCCCCGTCCGCATCCTGGTTT Direct Gain 0 0.976059317588806 Functional Gain 0.976059317588806 JAKMIP3 ENSG00000188385 intronic Human protein_coding chr10:133957761 chr10:133957761 . . 0 21 hm5U_associated_SNPs_200108 0 23144326 Chronic obstructive pulmonary disease-related biomarkers 4e-06 GWAS_Catalog TagSNP rs954820 GCST001737 Genome-wide association analysis of blood biomarkers in chronic obstructive pulmonary disease.
335 chr10 134884595 134884595 1 + G A rs4271313 134884595 - 134884575 134884615 41 GGGCCGGTACGTCCATCTGCCCCGGGTGTGGCCCCCAGCGG GGGCCGGTACGTCCATCTGCTCCGGGTGTGGCCCCCAGCGG Direct Gain 0 0.955456852912903 Functional Gain 0.955456852912903 LINC01168;ADGRA1-AS1 ENSG00000197177 CDS Human protein_coding chr10:134884595 chr10:134884595 nonsynonymous SNV 0.000 0 21 hm5U_associated_SNPs_200194 0 17804836 Rheumatoid Arthritis 5.84e-06 Johnson and O'Donnell TagSNP rs4271313 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
336 chr11 193863 193863 1 + T A rs2294081 193863 - 193843 193883 41 ATTGGCTGCAGGCCATCTATACAGGACTTGAGTTCAGTCAT ATTGGCTGCAGGCCATCTATTCAGGACTTGAGTTCAGTCAT Direct Gain 0 0.740433037281036 Functional Gain 0.740433037281036 SCGB1C1;SCGB1C2 ENSG00000188076 CDS Human protein_coding chr11:193863 chr11:193863 stopgain 0.800 1 21 hm5U_associated_SNPs_200321 0 27863252 Mean platelet volume 9e-106 GWAS_Catalog TagSNP rs2294081 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
337 chr11 199492 199492 1 + G A rs72878024 199492 - 199472 199512 41 GACCTTCTCAGGGCTGTGGGCGCCTGGTCCTGGCTTGAGGG GACCTTCTCAGGGCTGTGGGTGCCTGGTCCTGGCTTGAGGG Direct Gain 0 0.874688148498535 Functional Gain 0.874688148498535 ODF3 ENSG00000177947 CDS Human protein_coding chr11:199492 chr11:199492 nonsynonymous SNV 0.995 4 21 hm5U_associated_SNPs_200332 0 30410027 Benign prostatic hyperplasia and lower urinary tract symptoms 1e-12 GWAS_Catalog TagSNP rs72878024 GCST007507 Genome-wide associations for benign prostatic hyperplasia reveal a genetic correlation with serum levels of PSA.
338 chr11 831818 831818 1 + G A rs34391416 831818 - 831798 831838 41 ATGTCTTCAGTCAGGCGAGCCTGGGGCCCACTGGGGAGAGC ATGTCTTCAGTCAGGCGAGCTTGGGGCCCACTGGGGAGAGC Direct Gain 0 0.892699718475342 Functional Gain 0.892699718475342 CRACR2B ENSG00000255108 ncRNA_intronic Human antisense chr11:831818 chr11:831818 . . 0 21 hm5U_associated_SNPs_200518 0 25241909 Chronic bronchitis and chronic obstructive pulmonary disease 5e-08 GWAS_Catalog TagSNP rs34391416 GCST002625 Genetic susceptibility for chronic bronchitis in chronic obstructive pulmonary disease.
339 chr11 831883 831883 1 + G A rs35694355 831883 - 831863 831903 41 GCAGAGGGCACACACGGGACCCTGGCCACTCCCGGGACCCT GCAGAGGGCACACACGGGACTCTGGCCACTCCCGGGACCCT Direct Gain 0 0.847791433334351 Functional Gain 0.847791433334351 CRACR2B ENSG00000255108 ncRNA_intronic Human antisense chr11:831883 chr11:831883 . . 0 21 hm5U_associated_SNPs_200519 0 23251661 Obesity-related traits 3e-06 GWAS_Catalog TagSNP rs35694355 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
340 chr11 1995223 1995223 1 + G A rs217719 1995223 - 1995203 1995243 41 ACCACAGAACAGCATCTGGGCACCTACCTGTTGGCCATGGG ACCACAGAACAGCATCTGGGTACCTACCTGTTGGCCATGGG Direct Gain 0 0.842392802238464 Functional Gain 0.842392802238464 MRPL23;MRPL23-AS1 ENSG00000214026 intronic Human protein_coding chr11:1995223 chr11:1995223 . . 0 21 hm5U_associated_SNPs_200806 0 29912962 Systolic blood pressure x alcohol consumption interaction (2df test) 3e-18 GWAS_Catalog TagSNP rs217719 GCST006434 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
341 chr11 2169884 2169884 1 + C A rs3741205 2169884 - 2169864 2169904 41 GCCCGAGATTCTGGCGCAGAGATTTTATTTATACATATATA GCCCGAGATTCTGGCGCAGATATTTTATTTATACATATATA Direct Gain 0 0.809935510158539 Functional Gain 0.809935510158539 IGF2-AS ENSG00000099869 ncRNA_exonic Human antisense chr11:2169884 chr11:2169884 . . 0 21 hm5U_associated_SNPs_200830 0 31015462 Estimated glomerular filtration rate 3e-12 GWAS_Catalog TagSNP rs3741205 GCST007876 Sex-specific and pleiotropic effects underlying kidney function identified from GWAS meta-analysis.
342 chr11 6415463 6415463 1 + G A rs1050239 6415463 - 6415443 6415483 41 CAGGACCACGTGAGAGCTCCCGGAGTAGTTTCCATCTATTT CAGGACCACGTGAGAGCTCCTGGAGTAGTTTCCATCTATTT Direct Gain 0 0.658912301063538 Functional Gain 0.658912301063538 SMPD1 ENSG00000166311 CDS Human protein_coding chr11:6415463 chr11:6415463 nonsynonymous SNV 0.183 2 21 hm5U_associated_SNPs_200965 2 30072576 Blood protein levels 2e-31 GWAS_Catalog TagSNP rs1050239 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
343 chr11 15247307 15247307 1 + C A rs61748861 15247307 - 15247287 15247327 41 CTTCCAGGAGAACACGGATGGCATTCAACTGCAGGAGCATC CTTCCAGGAGAACACGGATGTCATTCAACTGCAGGAGCATC Direct Gain 0 0.833428025245667 Functional Gain 0.833428025245667 INSC ENSG00000188487 CDS Human protein_coding chr11:15247307 chr11:15247307 nonsynonymous SNV 0.973 4 21 hm5U_associated_SNPs_201113 0 30598549 Heel bone mineral density 1e-16 GWAS_Catalog TagSNP rs61748861 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
344 chr11 43877934 43877934 1 + C A rs1061810 43877934 - 43877914 43877954 41 AATACAAATCTACTGGTGCTGAAAACTCAGAGCTTAGGAAA AATACAAATCTACTGGTGCTTAAAACTCAGAGCTTAGGAAA Direct Gain 0 0.607389569282532 Functional Gain 0.607389569282532 HSD17B12 ENSG00000246250 ncRNA_intronic Human antisense chr11:43877934 chr11:43877934 . . 0 21 hm5U_associated_SNPs_201312 0 28566273 Type 2 diabetes 4e-10 GWAS_Catalog TagSNP rs1061810 GCST004773 An Expanded Genome-Wide Association Study of Type 2 Diabetes in Europeans.
345 chr11 45251860 45251860 1 + C A rs10769130 45251860 - 45251840 45251880 41 GAAGCATGTGTGCAACTGGGGTGGGAGGTGGGGTGGATGTC GAAGCATGTGTGCAACTGGGTTGGGAGGTGGGGTGGATGTC Direct Gain 0 0.914349436759949 Functional Gain 0.914349436759949 PRDM11 ENSG00000254664 ncRNA_intronic Human antisense chr11:45251860 chr11:45251860 . . 0 21 hm5U_associated_SNPs_201362 0 30595370 Height 2e-16 GWAS_Catalog TagSNP rs10769130 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
346 chr11 46695483 46695483 1 + G A rs56349329 46695483 - 46695463 46695503 41 GGTCCCCGCCAGAGCCTGCTCCAATCCTCAGAAGTCAGCCT GGTCCCCGCCAGAGCCTGCTTCAATCCTCAGAAGTCAGCCT Direct Gain 0 0.915190815925598 Functional Gain 0.915190815925598 ATG13 ENSG00000175224 UTR3 Human protein_coding chr11:46695483 chr11:46695483 . . 0 21 hm5U_associated_SNPs_201429 0 29397368 Headache 4e-08 GWAS_Catalog TagSNP rs56349329 GCST005337 A Genome-Wide Association Study Finds Genetic Associations with Broadly-Defined Headache in UK Biobank (N=223,773).
347 chr11 60617834 60617834 1 + C A rs530963 60617834 - 60617814 60617854 41 GAGGTGCTGTGTCTGACATGGTTGTTGGCCATGGAAGGCCT GAGGTGCTGTGTCTGACATGTTTGTTGGCCATGGAAGGCCT Direct Gain 0 0.540497422218323 Functional Gain 0.540497422218323 CCDC86 ENSG00000256813 ncRNA_intronic Human antisense chr11:60617834 chr11:60617834 . . 0 21 hm5U_associated_SNPs_201568 0 17052657 Parkinson's disease 0.000813507 Johnson and O'Donnell TagSNP rs530963 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
348 chr11 61722645 61722645 1 + C A rs1109748 61722645 - 61722625 61722665 41 AAGGAAATGGGGATGAGCTGGATGTAGCTGTCGCAATACAG AAGGAAATGGGGATGAGCTGTATGTAGCTGTCGCAATACAG Direct Gain 0 0.774420857429504 Functional Gain 0.774420857429504 BEST1 ENSG00000167995 CDS Human protein_coding chr11:61722645 chr11:61722645 synonymous SNV . 0 21 hm5U_associated_SNPs_201676 5 21829377 Plasma omega-3 polyunsaturated fatty acid level (eicosapentaenoic acid) 5e-09 GWAS_Catalog TagSNP rs1109748 GCST001178 Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium.
349 chr11 62381808 62381808 1 + G A rs1801144 62381808 - 62381788 62381828 41 AGACGGTTTTGCAGGCAAGGCCGGGGTGAGTGGGGGTTGCA AGACGGTTTTGCAGGCAAGGTCGGGGTGAGTGGGGGTTGCA Direct Gain 0 0.827221691608429 Functional Gain 0.827221691608429 ROM1 ENSG00000149489 CDS Human protein_coding chr11:62381808 chr11:62381808 nonsynonymous SNV 0.996 0 21 hm5U_associated_SNPs_201707 0 30595370 Lung function (FVC) 4e-30 GWAS_Catalog TagSNP rs1801144 GCST007081 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
350 chr11 63988045 63988045 1 + G A rs3802932 63988045 - 63988025 63988065 41 GGGCCGTGGGGGTGGTTGCCCGGGCCCCCACTGCCCGTGCG GGGCCGTGGGGGTGGTTGCCTGGGCCCCCACTGCCCGTGCG Direct Gain 0 0.520610451698303 Functional Gain 0.520610451698303 FERMT3 ENSG00000149781 CDS Human protein_coding chr11:63988045 chr11:63988045 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_201762 0 31015401 Medication use (agents acting on the renin-angiotensin system) 6e-10 GWAS_Catalog TagSNP rs3802932 GCST007930 Genome-wide association study of medication-use and associated disease in the UK Biobank.
351 chr11 64023971 64023971 1 + G A rs7943988 64023971 - 64023951 64023991 41 GGCTCATACTTTTCGATGAGCAGCCGGGCCTGGGAGGGCCG GGCTCATACTTTTCGATGAGTAGCCGGGCCTGGGAGGGCCG Direct Gain 0 0.908266603946686 Functional Gain 0.908266603946686 PLCB3 ENSG00000149782 CDS Human protein_coding chr11:64023971 chr11:64023971 synonymous SNV . 0 21 hm5U_associated_SNPs_201783 0 17554300 Multiple complex diseases 0.0003931 Johnson and O'Donnell TagSNP rs7943988 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
352 chr11 65349063 65349063 1 + G A rs3741380 65349063 - 65349043 65349083 41 GGAGGGCATCAGAGCCTTTCCGGAGCCGAGGGGCTGGGGTG GGAGGGCATCAGAGCCTTTCTGGAGCCGAGGGGCTGGGGTG Direct Gain 0 0.538422226905823 Functional Gain 0.538422226905823 EHBP1L1 ENSG00000173442 CDS Human protein_coding chr11:65349063 chr11:65349063 nonsynonymous SNV 0.599 0 21 hm5U_associated_SNPs_201981 0 29212778 Coronary artery disease 3e-10 GWAS_Catalog TagSNP rs3741380 GCST005194 Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease.
353 chr11 65561369 65561369 1 + G A rs12797706 65561369 - 65561349 65561389 41 ATCGCAGGCATGCAGCAGAGCGGGGCTGCCCCGACCACCAC ATCGCAGGCATGCAGCAGAGTGGGGCTGCCCCGACCACCAC Direct Gain 0 0.548940122127533 Functional Gain 0.548940122127533 OVOL1 ENSG00000172818 UTR5 Human protein_coding chr11:65561369 chr11:65561369 . . 0 21 hm5U_associated_SNPs_202019 0 30595370 Hair color 1e-21 GWAS_Catalog TagSNP rs12797706 GCST007082 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
354 chr11 67184725 67184725 1 + G A rs61734601 67184725 - 67184705 67184745 41 GGAAAGGCTTGTGTTGGGGGCGAAGGCTTGTTAATGGGAAC GGAAAGGCTTGTGTTGGGGGTGAAGGCTTGTTAATGGGAAC Direct Gain 0 0.679146111011505 Functional Gain 0.679146111011505 CARNS1 ENSG00000172508;ENSG00000172531 intronic Human other chr11:67184725 chr11:67184725 . . 0 21 hm5U_associated_SNPs_202202 0 28552196 Height 2e-10 GWAS_Catalog TagSNP rs61734601 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
355 chr11 71187294 71187294 1 + G A rs4944062 71187294 - 71187274 71187314 41 GCTTTAATGCCCATTCCCAACAAGAGCAGAGTGGAAGGCCG GCTTTAATGCCCATTCCCAATAAGAGCAGAGTGGAAGGCCG Direct Gain 0 0.53490674495697 Functional Gain 0.53490674495697 NADSYN1 ENSG00000172890 UTR3 Human protein_coding chr11:71187294 chr11:71187294 . . 0 21 hm5U_associated_SNPs_202398 0 29343764 Vitamin D levels (dietary vitamin D intake interaction) 2e-31 GWAS_Catalog TagSNP rs4944062 GCST005366 Genome-wide association study in 79,366 European-ancestry individuals informs the genetic architecture of 25-hydroxyvitamin D levels.
356 chr11 72947934 72947934 1 + G A rs11235688 72947934 - 72947914 72947954 41 TCCCTTTCCAAAGGCTAGGGCGGGGCCCTGTCCAGCTGAGC TCCCTTTCCAAAGGCTAGGGTGGGGCCCTGTCCAGCTGAGC Direct Gain 0 0.604259967803955 Functional Gain 0.604259967803955 P2RY2 ENSG00000175591 downstream Human protein_coding chr11:72947934 chr11:72947934 . . 0 21 hm5U_associated_SNPs_202467 0 27863252 Mean platelet volume 5e-11 GWAS_Catalog TagSNP rs11235688 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
357 chr11 73020846 73020846 1 + G A rs3741151 73020846 - 73020826 73020866 41 TGGAATAACGGCTGCTACCGCGGGAGCCTGCGGGGCTGGCC TGGAATAACGGCTGCTACCGTGGGAGCCTGCGGGGCTGGCC Direct Gain 0 0.772092342376709 Functional Gain 0.772092342376709 ARHGEF17 ENSG00000110237 CDS Human protein_coding chr11:73020846 chr11:73020846 nonsynonymous SNV 0.928 1 21 hm5U_associated_SNPs_202487 0 29093273 GIP levels in response to oral glucose tolerance test (120 minutes) 1e-06 GWAS_Catalog TagSNP rs3741151 GCST005166 Genetic determinants of circulating GIP and GLP-1 concentrations.
358 chr11 88911696 88911696 1 + C A rs1042602 88911696 - 88911676 88911716 41 CAATGTCTCTCCAGATTTCAGATCCCCCAAGCAGTGCATCC CAATGTCTCTCCAGATTTCATATCCCCCAAGCAGTGCATCC Direct Gain 0 0.589682579040527 Functional Gain 0.589682579040527 TYR ENSG00000077498 CDS Human protein_coding chr11:88911696 chr11:88911696 nonsynonymous SNV 0.925 5 21 hm5U_associated_SNPs_202674 5 17999355 Skin pigmentation 4e-10 GWAS_Catalog TagSNP rs1042602 GCST000114 A genomewide association study of skin pigmentation in a South Asian population.
359 chr11 89017961 89017961 1 + G A rs1126809 89017961 - 89017941 89017981 41 CTTGAAGAGGACGGTGCCTTCGGAGCCACTGCTCAAAAATA CTTGAAGAGGACGGTGCCTTTGGAGCCACTGCTCAAAAATA Direct Gain 0 0.595450401306152 Functional Gain 0.595450401306152 TYR ENSG00000077498 CDS Human protein_coding chr11:89017961 chr11:89017961 nonsynonymous SNV 0.999 5 21 hm5U_associated_SNPs_202675 10 27723757 Vitiligo 1e-43 GWAS_Catalog TagSNP rs1126809 GCST004785 Genome-wide association studies of autoimmune vitiligo identify 23 new risk loci and highlight key pathways and regulatory variants.
360 chr11 111411608 111411608 1 + G A rs11213935 111411608 - 111411588 111411628 41 CCGCAGCCCCACCAGCAGCACGGCCAGCAGCACGGCCTGTA CCGCAGCCCCACCAGCAGCATGGCCAGCAGCACGGCCTGTA Direct Gain 0 0.793168783187866 Functional Gain 0.793168783187866 LAYN ENSG00000204381 CDS Human protein_coding chr11:111411608 chr11:111411608 nonsynonymous SNV 0.020 0 21 hm5U_associated_SNPs_202784 0 23251661 Obesity-related traits 4e-06 GWAS_Catalog TagSNP rs11213935 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
361 chr11 121016724 121016724 1 + G A rs148619105 121016724 - 121016704 121016744 41 AGGCGGTCTGCACCGCGCCCCCATCGATGCAAGAGTCAAAC AGGCGGTCTGCACCGCGCCCTCATCGATGCAAGAGTCAAAC Direct Gain 0 0.698221325874329 Functional Gain 0.698221325874329 TECTA ENSG00000109927 CDS Human protein_coding chr11:121016724 chr11:121016724 nonsynonymous SNV 1.000 2 21 hm5U_associated_SNPs_203008 1 28714976 Alzheimer's disease (late onset) 1e-07 GWAS_Catalog TagSNP rs148619105 GCST005549 Rare coding variants in PLCG2, ABI3, and TREM2 implicate microglial-mediated innate immunity in Alzheimer's disease.
362 chr12 6954864 6954864 1 + G A rs5442 6954864 - 6954844 6954884 41 GAAGGCCACGGACGTGATGCCGCAGATGATGCTCTCGTGGG GAAGGCCACGGACGTGATGCTGCAGATGATGCTCTCGTGGG Direct Gain 0 0.892599523067474 Functional Gain 0.892599523067474 GNB3 ENSG00000111664 CDS Human protein_coding chr12:6954864 chr12:6954864 nonsynonymous SNV 0.966 4 21 hm5U_associated_SNPs_203469 0 27182965 Myopia 2e-14 GWAS_Catalog TagSNP rs5442 GCST003997 Detection and interpretation of shared genetic influences on 42 human traits.
363 chr12 7170336 7170336 1 + G A rs12146727 7170336 - 7170316 7170356 41 ATGCAGCAAACCCCGTAAAACGCTCTTCATTGGAAAAGTCT ATGCAGCAAACCCCGTAAAATGCTCTTCATTGGAAAAGTCT Direct Gain 0 0.540432333946228 Functional Gain 0.540432333946228 C1S ENSG00000182326 CDS Human protein_coding chr12:7170336 chr12:7170336 nonsynonymous SNV 0.896 0 21 hm5U_associated_SNPs_203507 0 28240269 Blood protein levels 2e-15 GWAS_Catalog TagSNP rs12146727 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
364 chr12 29542777 29542777 1 + G A rs117154046 29542777 - 29542757 29542797 41 ACTTCACTCACCTTCCAGGCCCCTGAAGGCCTTTGTCCGTT ACTTCACTCACCTTCCAGGCTCCTGAAGGCCTTTGTCCGTT Direct Gain 0 0.942192792892456 Functional Gain 0.942192792892456 OVCH1-AS1 ENSG00000257599 CDS Human antisense chr12:29542777 chr12:29542777 synonymous SNV . 0 21 hm5U_associated_SNPs_203666 0 26830138 Alzheimer disease and age of onset 6e-07 GWAS_Catalog TagSNP rs117154046 GCST003427 Family-based association analyses of imputed genotypes reveal genome-wide significant association of Alzheimer's disease with OSBPL6, PTPRG, and PDCL3.
365 chr12 50366300 50366300 1 + G A rs2849266 50366300 - 50366280 50366320 41 ACAGAATGCAGATGTGAATACAGTCGACTTTACCAAGGACG ACAGAATGCAGATGTGAATATAGTCGACTTTACCAAGGACG Direct Gain 0 0.623624444007874 Functional Gain 0.623624444007874 AQP6 ENSG00000086159 UTR5 Human protein_coding chr12:50366300 chr12:50366300 . . 0 21 hm5U_associated_SNPs_203815 0 17554300 Multiple complex diseases 0.000167267 Johnson and O'Donnell TagSNP rs2849266 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
366 chr12 52381026 52381026 1 + C A rs2252518 52381026 - 52381006 52381046 41 CTGCATGAATCCCGTGCTATGCGCACCGGGGCACTCCCCGC CTGCATGAATCCCGTGCTATTCGCACCGGGGCACTCCCCGC Direct Gain 0 0.894023776054382 Functional Gain 0.894023776054382 ACVR1B ENSG00000135503 UTR3 Human protein_coding chr12:52381026 chr12:52381026 . . 0 21 hm5U_associated_SNPs_203869 0 24939585 Age-related hearing impairment 5e-07 GWAS_Catalog TagSNP rs2252518 GCST002491 Genome-wide association analysis demonstrates the highly polygenic character of age-related hearing impairment.
367 chr12 53442956 53442956 1 + G A rs12369033 53442956 - 53442936 53442976 41 GACTGGACAGGAGGTCCCCCCTCCCAACACATACTCCACCC GACTGGACAGGAGGTCCCCCTTCCCAACACATACTCCACCC Direct Gain 0 0.799254655838013 Functional Gain 0.799254655838013 TNS2 ENSG00000111077 CDS Human protein_coding chr12:53442956 chr12:53442956 nonsynonymous SNV 0.944 1 21 hm5U_associated_SNPs_203914 0 30595370 Systolic blood pressure 7e-17 GWAS_Catalog TagSNP rs12369033 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
368 chr12 56435929 56435929 1 + C A rs1131017 56435929 - 56435909 56435949 41 TTGGAGGCACGGACCGGAGAGAGGAGACGGTGCCTGGCAGG TTGGAGGCACGGACCGGAGATAGGAGACGGTGCCTGGCAGG Direct Gain 0 0.901208400726318 Functional Gain 0.901208400726318 RPS26 ENSG00000197728 UTR5 Human protein_coding chr12:56435929 chr12:56435929 . . 0 21 hm5U_associated_SNPs_204036 0 30038396 Cognitive performance 4e-09 GWAS_Catalog TagSNP rs1131017 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
369 chr12 111884608 111884608 1 + T A rs3184504 111884608 - 111884588 111884628 41 CATCTCAAGCCGTGTGCACCACCGGACCTCCTGGATGCTGG CATCTCAAGCCGTGTGCACCTCCGGACCTCCTGGATGCTGG Direct Gain 0 0.526761889457703 Functional Gain 0.526761889457703 SH2B3 ENSG00000111252 CDS Human protein_coding chr12:111884608 chr12:111884608 nonsynonymous SNV 0.074 0 21 hm5U_associated_SNPs_204452 0 21909115 Diastolic blood pressure 4e-25 GWAS_Catalog TagSNP rs3184504 GCST001228 Genetic variants in novel pathways influence blood pressure and cardiovascular disease risk.
370 chr12 113357442 113357442 1 + G A rs2660 113357442 - 113357422 113357462 41 GCTCACTGAGGAGCTTTGTCCTCTCTGGATCAAGAGTCCCA GCTCACTGAGGAGCTTTGTCTTCTCTGGATCAAGAGTCCCA Direct Gain 0 0.585286498069763 Functional Gain 0.585286498069763 OAS1 ENSG00000089127 CDS Human protein_coding chr12:113357442 chr12:113357442 nonsynonymous SNV 0.004 0 21 hm5U_associated_SNPs_204479 0 17554300 Multiple complex diseases 0.000279785 Johnson and O'Donnell TagSNP rs2660 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
371 chr12 113448652 113448652 1 + C A rs13311 113448652 - 113448632 113448672 41 GTTGGAAGCACCGAGAGCAAGATCACAGAGTTATGAGAACC GTTGGAAGCACCGAGAGCAATATCACAGAGTTATGAGAACC Direct Gain 0 0.616631269454956 Functional Gain 0.616631269454956 OAS2 ENSG00000257452 ncRNA_intronic Human antisense chr12:113448652 chr12:113448652 . . 0 21 hm5U_associated_SNPs_204494 0 17463246 Multiple continuous traits in DGI samples 0.0009216 Johnson and O'Donnell TagSNP rs13311 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
372 chr12 124799642 124799642 1 + C A rs4765540 124799642 - 124799622 124799662 41 AACCTCCTGGCTCAACATCCGCCAGAGGTGGCTCAGCCACA AACCTCCTGGCTCAACATCCTCCAGAGGTGGCTCAGCCACA Direct Gain 0 0.563665330410004 Functional Gain 0.563665330410004 RFLNA ENSG00000178882 UTR3 Human protein_coding chr12:124799642 chr12:124799642 . . 0 21 hm5U_associated_SNPs_204785 0 30374069 Osteoarthritis (hip) 3e-09 GWAS_Catalog TagSNP rs4765540 GCST006926 Meta-analysis of Icelandic and UK data sets identifies missense variants in SMO, IL11, COL11A1 and 13 more new loci associated with osteoarthritis.
373 chr12 132325239 132325239 1 + G A rs6598163 132325239 - 132325219 132325259 41 GTCGATCTGGATGTCGGCGGCGCTGCCCGCCACCTCGTGGA GTCGATCTGGATGTCGGCGGTGCTGCCCGCCACCTCGTGGA Direct Gain 0 0.636876463890076 Functional Gain 0.636876463890076 MMP17 ENSG00000198598 CDS Human protein_coding chr12:132325239 chr12:132325239 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_204870 0 22683712 Migraine 5e-07 GWAS_Catalog TagSNP rs6598163 GCST001563 Genome-wide association analysis identifies susceptibility loci for migraine without aura.
374 chr12 133487774 133487774 1 + G A rs77927866 133487774 - 133487754 133487794 41 CGAGGTCAGGAGATCAAGACCAGCCTGGCCAACATGGTGAA CGAGGTCAGGAGATCAAGACTAGCCTGGCCAACATGGTGAA Direct Gain 0 0.734776616096497 Functional Gain 0.734776616096497 LOC101928530;ZNF605 ENSG00000072609 intronic Human protein_coding chr12:133487774 chr12:133487774 . . 0 21 hm5U_associated_SNPs_205013 0 30595370 Body mass index 3e-10 GWAS_Catalog TagSNP rs77927866 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
375 chr13 24553861 24553861 1 + G A rs9510982 24553861 - 24553841 24553881 41 GGCCCAGGACCGCAGCGAATCAGTCTCTGGCTCCCCGCCCA GGCCCAGGACCGCAGCGAATTAGTCTCTGGCTCCCCGCCCA Direct Gain 0 0.925491690635681 Functional Gain 0.925491690635681 SPATA13 ENSG00000273167 UTR5 Human protein_coding chr13:24553861 chr13:24553861 . . 0 21 hm5U_associated_SNPs_205050 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 3.1e-05 Johnson and O'Donnell TagSNP rs9510982 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
376 chr13 109793177 109793177 1 + G A rs150813880 109793177 - 109793157 109793197 41 GTCTCCAGGACTGGCAGCTTCTTCACCTCCAGGGGTGTCAG GTCTCCAGGACTGGCAGCTTTTTCACCTCCAGGGGTGTCAG Direct Gain 0 0.87736988067627 Functional Gain 0.87736988067627 MYO16 ENSG00000041515 CDS Human protein_coding chr13:109793177 chr13:109793177 synonymous SNV . 0 21 hm5U_associated_SNPs_205395 0 26830138 Alzheimer disease and age of onset 1e-06 GWAS_Catalog TagSNP rs150813880 GCST003427 Family-based association analyses of imputed genotypes reveal genome-wide significant association of Alzheimer's disease with OSBPL6, PTPRG, and PDCL3.
377 chr13 113773159 113773159 1 + G A rs6046 113773159 - 113773139 113773179 41 CCGTCAGGTACCACGTGCCCCGGTAGTGGGTGGCATGTGGG CCGTCAGGTACCACGTGCCCTGGTAGTGGGTGGCATGTGGG Direct Gain 0 0.644484281539917 Functional Gain 0.644484281539917 F7 ENSG00000057593 CDS Human protein_coding chr13:113773159 chr13:113773159 nonsynonymous SNV 0.139 1 21 hm5U_associated_SNPs_205502 4 17903294 Blood Phenotypes 4.5e-16 Johnson and O'Donnell TagSNP rs6046 . Genome-wide association and linkage analyses of hemostatic factors and hematological phenotypes in the Framingham Heart Study.
378 chr13 114623821 114623821 1 + G A rs41284486 114623821 - 114623801 114623841 41 CACAGGAGCGATGCAGTGGGCACAGGTCACCACGCATGGCC CACAGGAGCGATGCAGTGGGTACAGGTCACCACGCATGGCC Direct Gain 0 0.661940515041351 Functional Gain 0.661940515041351 LINC00452 ENSG00000229373 ncRNA_exonic Human lincRNA chr13:114623821 chr13:114623821 . . 0 21 hm5U_associated_SNPs_205551 0 30595370 Cardiovascular disease 1e-07 GWAS_Catalog TagSNP rs41284486 GCST007072 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
379 chr13 115090193 115090193 1 + G A rs3813133 115090193 - 115090173 115090213 41 TCTGGGGAGACAGCAGGGAACGGCTTCCAAGGTTCAGGAGA TCTGGGGAGACAGCAGGGAATGGCTTCCAAGGTTCAGGAGA Direct Gain 0 0.738844156265259 Functional Gain 0.738844156265259 CHAMP1 ENSG00000198824 CDS Human protein_coding chr13:115090193 chr13:115090193 synonymous SNV . 0 21 hm5U_associated_SNPs_205565 0 18057069 Amyotrophic Lateral Sclerosis (ALS) 1.67e-05 Johnson and O'Donnell TagSNP rs3813133 . A genome-wide association study of sporadic ALS in a homogenous Irish population.
380 chr14 23312594 23312594 1 + G A rs1042704 23312594 - 23312574 23312614 41 GATGCCCCGGCGGTCATCATCGGGCAGCACAAAATTCTCCG GATGCCCCGGCGGTCATCATTGGGCAGCACAAAATTCTCCG Direct Gain 0 0.648238599300385 Functional Gain 0.648238599300385 MMP14 ENSG00000157227 CDS Human protein_coding chr14:23312594 chr14:23312594 nonsynonymous SNV 0.696 1 21 hm5U_associated_SNPs_205651 0 28869591 Heel bone mineral density 6e-07 GWAS_Catalog TagSNP rs1042704 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
381 chr14 23777099 23777099 1 + G A rs2231301 23777099 - 23777079 23777119 41 GCCCGCATGGCTTGGTGCAGCGGGTCAGCTGCTGGGCCCTC GCCCGCATGGCTTGGTGCAGTGGGTCAGCTGCTGGGCCCTC Direct Gain 0 0.811215102672577 Functional Gain 0.811215102672577 BCL2L2;BCL2L2-PABPN1 ENSG00000129473;ENSG00000258643 CDS Human other chr14:23777099 chr14:23777099 synonymous SNV . 0 21 hm5U_associated_SNPs_205680 0 28552196 Height 3e-07 GWAS_Catalog TagSNP rs2231301 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
382 chr14 24883887 24883887 1 + G A rs8017377 24883887 - 24883867 24883907 41 CTCCAGGGGCCCAGAGTCAGCGTCATCACTCAGCTCAGTGA CTCCAGGGGCCCAGAGTCAGTGTCATCACTCAGCTCAGTGA Direct Gain 0 0.887766480445862 Functional Gain 0.887766480445862 NYNRIN ENSG00000205978 CDS Human protein_coding chr14:24883887 chr14:24883887 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_205792 0 20686565 LDL cholesterol 4e-11 GWAS_Catalog TagSNP rs8017377 GCST000759 Biological, clinical and population relevance of 95 loci for blood lipids.
383 chr14 60976537 60976537 1 + C A rs33912345 60976537 - 60976517 60976557 41 GTACCACTCGCGTAGCAGGTGCCGCGTGCGCTCCTTGAAGC GTACCACTCGCGTAGCAGGTTCCGCGTGCGCTCCTTGAAGC Direct Gain 0 0.981856226921082 Functional Gain 0.981856226921082 SIX6 ENSG00000184302 CDS Human protein_coding chr14:60976537 chr14:60976537 nonsynonymous SNV 0.961 2 21 hm5U_associated_SNPs_205960 2 26752265 Glaucoma (high intraocular pressure) 1e-09 GWAS_Catalog TagSNP rs33912345 GCST003344 Genome-wide association analysis identifies TXNRD2, ATXN2 and FOXC1 as susceptibility loci for primary open-angle glaucoma.
384 chr14 93118669 93118669 1 + G A rs3742716 93118669 - 93118649 93118689 41 TGCTCCGTGCTCTCCCGGGGCGTGTCCTCAGGGCCGTCTGA TGCTCCGTGCTCTCCCGGGGTGTGTCCTCAGGGCCGTCTGA Direct Gain 0 0.560331881046295 Functional Gain 0.560331881046295 RIN3 ENSG00000100599 CDS Human protein_coding chr14:93118669 chr14:93118669 synonymous SNV . 0 21 hm5U_associated_SNPs_206329 0 27863252 Sum basophil neutrophil counts 3e-12 GWAS_Catalog TagSNP rs3742716 GCST004620 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
385 chr14 93399050 93399050 1 + G A rs9658667 93399050 - 93399030 93399070 41 CGGCCCAGGGCCCCTGAAGCCGTAGGCCCGGGCCCGGAAGG CGGCCCAGGGCCCCTGAAGCTGTAGGCCCGGGCCCGGAAGG Direct Gain 0 0.89448493719101 Functional Gain 0.89448493719101 CHGA ENSG00000100604 CDS Human protein_coding chr14:93399050 chr14:93399050 nonsynonymous SNV 0.021 2 21 hm5U_associated_SNPs_206343 0 30072576 Blood protein levels 6e-14 GWAS_Catalog TagSNP rs9658667 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
386 chr14 94103602 94103602 1 + G A rs4905082 94103602 - 94103582 94103622 41 TCCAGGTCAGGGTTTAGGCACGTTGGCACGTTACACTGGCG TCCAGGTCAGGGTTTAGGCATGTTGGCACGTTACACTGGCG Direct Gain 0 0.568309485912323 Functional Gain 0.568309485912323 UNC79 ENSG00000133958 CDS Human protein_coding chr14:94103602 chr14:94103602 synonymous SNV . 0 21 hm5U_associated_SNPs_206363 0 17634449 Coronary Artery Disease 0.0009262 Johnson and O'Donnell TagSNP rs4905082 . Genomewide association analysis of coronary artery disease.
387 chr14 103377321 103377321 1 + G A rs10133111 103377321 - 103377301 103377341 41 TGTGCAGCGTCGACACTGCCCTCCACACTTCACAGACCTTC TGTGCAGCGTCGACACTGCCTTCCACACTTCACAGACCTTC Direct Gain 0 0.715113401412964 Functional Gain 0.715113401412964 TRAF3 ENSG00000131323 UTR3 Human protein_coding chr14:103377321 chr14:103377321 . . 0 21 hm5U_associated_SNPs_206607 0 19023125 Brain imaging in schizophrenia (dorsolateral prefrontal cortex interaction) 5e-06 GWAS_Catalog TagSNP rs10133111 GCST000271 A genome-wide association study of schizophrenia using brain activation as a quantitative phenotype.
388 chr15 22969232 22969232 1 + G A rs7170637 22969232 - 22969212 22969252 41 CCGGAACATGGCGTCGAAGCCGTCCAGCGTCAGGTACCGGC CCGGAACATGGCGTCGAAGCTGTCCAGCGTCAGGTACCGGC Direct Gain 0 0.84688127040863 Functional Gain 0.84688127040863 CYFIP1 ENSG00000068793 CDS Human other chr15:22969232 chr15:22969232 nonsynonymous SNV . 0 21 hm5U_associated_SNPs_206906 0 30598549 Heel bone mineral density 1e-12 GWAS_Catalog TagSNP rs7170637 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
389 chr15 29033909 29033909 1 + G A rs56166703 29033909 - 29033889 29033929 41 TGCAGGCCCAGCACCCATGGCTGCGGCCGCGGCGTCGCCCT TGCAGGCCCAGCACCCATGGTTGCGGCCGCGGCGTCGCCCT Direct Gain 0 0.798088073730469 Functional Gain 0.798088073730469 LOC100289656 ENSG00000232431 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr15:29033909 chr15:29033909 . . 0 21 hm5U_associated_SNPs_206996 0 30595370 Hair color 1e-245 GWAS_Catalog TagSNP rs56166703 GCST007082 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
390 chr15 58834741 58834741 1 + G A rs690 58834741 - 58834721 58834761 41 ACATGGCTTCGAGAGAGTTGCACAGATTCCTGGAAGACAGC ACATGGCTTCGAGAGAGTTGTACAGATTCCTGGAAGACAGC Direct Gain 0 0.641044557094574 Functional Gain 0.641044557094574 LIPC ENSG00000166035 CDS Human protein_coding chr15:58834741 chr15:58834741 synonymous SNV . 0 21 hm5U_associated_SNPs_207392 0 17463246 Multiple continuous traits in DGI samples 0.0001843 Johnson and O'Donnell TagSNP rs690 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
391 chr15 74219582 74219582 1 + G A rs3825942 74219582 - 74219562 74219602 41 CCGAGACCGAGGAGGCGGAGCCCCCGTGCCGTTGCTGGGAG CCGAGACCGAGGAGGCGGAGTCCCCGTGCCGTTGCTGGGAG Direct Gain 0 0.984211385250092 Functional Gain 0.984211385250092 LOXL1 ENSG00000129038 CDS Human protein_coding chr15:74219582 chr15:74219582 nonsynonymous SNV 0.982 1 21 hm5U_associated_SNPs_207625 1 17690259 Glaucoma (exfoliation) 3e-21 GWAS_Catalog TagSNP rs3825942 GCST000067 Common sequence variants in the LOXL1 gene confer susceptibility to exfoliation glaucoma.
392 chr15 74466271 74466271 1 + G A rs923118 74466271 - 74466251 74466291 41 CCTGAGAGTCTGCAGGGCCACGGGCGCCCAAGGGAGGACTT CCTGAGAGTCTGCAGGGCCATGGGCGCCCAAGGGAGGACTT Direct Gain 0 0.904200792312622 Functional Gain 0.904200792312622 ISLR ENSG00000261543 ncRNA_intronic Human antisense chr15:74466271 chr15:74466271 . . 0 21 hm5U_associated_SNPs_207645 0 30072576 Blood protein levels 2e-11 GWAS_Catalog TagSNP rs923118 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
393 chr15 78882925 78882925 1 + G A rs16969968 78882925 - 78882905 78882945 41 TGTAATGTAGCGAATAGAATCGAGCGCAGCTTCCAATGTGT TGTAATGTAGCGAATAGAATTGAGCGCAGCTTCCAATGTGT Direct Gain 0 0.758496284484863 Functional Gain 0.758496284484863 CHRNA5 ENSG00000169684 CDS Human protein_coding chr15:78882925 chr15:78882925 nonsynonymous SNV 0.039 0 21 hm5U_associated_SNPs_207792 2 26634245 Pre bronchodilator FEV1 2e-09 GWAS_Catalog TagSNP rs16969968 GCST003266 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
394 chr15 80472526 80472526 1 + C A rs11555096 80472526 - 80472506 80472546 41 AGCCAGGAGGTCCCCCGGCCGCAGGTTGCAGCCGTTGACAG AGCCAGGAGGTCCCCCGGCCTCAGGTTGCAGCCGTTGACAG Direct Gain 0 0.620896756649017 Functional Gain 0.620896756649017 FAH ENSG00000103876 CDS Human protein_coding chr15:80472526 chr15:80472526 synonymous SNV . 0 21 hm5U_associated_SNPs_207833 0 29875488 Blood protein levels 2e-121 GWAS_Catalog TagSNP rs11555096 GCST005806 Genomic atlas of the human plasma proteome.
395 chr15 89386652 89386652 1 + G A rs34949187 89386652 - 89386632 89386672 41 TGGCCAGCCGGGCACCCAGCCGCCGGCACTCATTGGCTGCT TGGCCAGCCGGGCACCCAGCTGCCGGCACTCATTGGCTGCT Direct Gain 0 0.848355174064636 Functional Gain 0.848355174064636 ACAN ENSG00000157766 CDS Human protein_coding chr15:89386652 chr15:89386652 nonsynonymous SNV 0.996 2 21 hm5U_associated_SNPs_208007 0 30595370 Lung function (FEV1/FVC) 4e-09 GWAS_Catalog TagSNP rs34949187 GCST007080 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
396 chr15 91045408 91045408 1 + G A rs3540 91045408 - 91045388 91045428 41 TATGTGCAGCAACAATCTGACGGGCAGTCCAAACTCTTGGG TATGTGCAGCAACAATCTGATGGGCAGTCCAAACTCTTGGG Direct Gain 0 0.58618950843811 Functional Gain 0.58618950843811 IQGAP1 ENSG00000140575 UTR3 Human protein_coding chr15:91045408 chr15:91045408 . . 0 21 hm5U_associated_SNPs_208089 0 27863252 Lymphocyte counts 1e-22 GWAS_Catalog TagSNP rs3540 GCST004627 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
397 chr15 91426560 91426560 1 + G A rs4702 91426560 - 91426540 91426580 41 ATCACTGTGCACCAACCCAGCATCTTACAAAACCAGCCGGG ATCACTGTGCACCAACCCAGTATCTTACAAAACCAGCCGGG Direct Gain 0 0.572867333889008 Functional Gain 0.572867333889008 FURIN ENSG00000140564 UTR3 Human protein_coding chr15:91426560 chr15:91426560 . . 0 21 hm5U_associated_SNPs_208111 0 29500382 Feeling hurt 2e-09 GWAS_Catalog TagSNP rs4702 GCST006951 Item-level analyses reveal genetic heterogeneity in neuroticism.
398 chr16 334580 334580 1 + G A rs432925 334580 - 334560 334600 41 CCCTCACCTGTGTACTCCTCCGGGTGCGTGCGGTTCCCATT CCCTCACCTGTGTACTCCTCTGGGTGCGTGCGGTTCCCATT Direct Gain 0 0.780596256256104 Functional Gain 0.780596256256104 PDIA2 ENSG00000185615 CDS Human protein_coding chr16:334580 chr16:334580 synonymous SNV . 0 21 hm5U_associated_SNPs_208355 0 26835600 Morning vs. evening chronotype 6e-06 GWAS_Catalog TagSNP rs432925 GCST003429 GWAS of 89,283 individuals identifies genetic variants associated with self-reporting of being a morning person.
399 chr16 1250559 1250559 1 + T A rs8044363 1250559 - 1250539 1250579 41 CCGCCCACCTGGAAGATGGCAATCCAGGCGTAGCCGATGTT CCGCCCACCTGGAAGATGGCTATCCAGGCGTAGCCGATGTT Direct Gain 0 0.862132430076599 Functional Gain 0.862132430076599 CACNA1H ENSG00000196557 CDS Human protein_coding chr16:1250559 chr16:1250559 synonymous SNV . 0 21 hm5U_associated_SNPs_208699 0 30038396 Self-reported math ability 8e-10 GWAS_Catalog TagSNP rs8044363 GCST006573 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
400 chr16 1252369 1252369 1 + C A rs61734410 1252369 - 1252349 1252389 41 CGTGCCCCCCGGTGCCTGGCGGTCCACCGGCCCACTTCCCC CGTGCCCCCCGGTGCCTGGCTGTCCACCGGCCCACTTCCCC Direct Gain 0 0.80089396238327 Functional Gain 0.80089396238327 CACNA1H ENSG00000196557 CDS Human protein_coding chr16:1252369 chr16:1252369 nonsynonymous SNV 0.001 1 21 hm5U_associated_SNPs_208705 0 30038396 Educational attainment (MTAG) 6e-21 GWAS_Catalog TagSNP rs61734410 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
401 chr16 1291597 1291597 1 + C A rs144979264 1291597 - 1291577 1291617 41 GTGTGGACGTGGCTGGAGACGTTCACCGGCTCCTCCAGCTC GTGTGGACGTGGCTGGAGACTTTCACCGGCTCCTCCAGCTC Direct Gain 0 0.909794807434082 Functional Gain 0.909794807434082 TPSAB1 ENSG00000172236 CDS Human protein_coding chr16:1291597 chr16:1291597 nonsynonymous SNV 0.004 1 21 hm5U_associated_SNPs_208749 0 29875488 Blood protein levels 0 GWAS_Catalog TagSNP rs144979264 GCST005806 Genomic atlas of the human plasma proteome.
402 chr16 1838836 1838836 1 + C A rs1065656 1838836 - 1838816 1838856 41 TGGTCGGGGAGAAGCTCTCCGGCTGACGCTGCCTGGGCCTG TGGTCGGGGAGAAGCTCTCCTGCTGACGCTGCCTGGGCCTG Direct Gain 0 0.780128121376038 Functional Gain 0.780128121376038 NUBP2 ENSG00000095906 UTR3 Human protein_coding chr16:1838836 chr16:1838836 . . 0 21 hm5U_associated_SNPs_208887 0 21216879 Insulin-like growth factors 1e-11 GWAS_Catalog TagSNP rs1065656 GCST000937 A genome-wide association study identifies novel loci associated with circulating IGF-I and IGFBP-3.
403 chr16 28333411 28333411 1 + G A rs2650492 28333411 - 28333391 28333431 41 CCTAGTCACACACTCGCCCCCTGGTGTCCACCGCCCCCATT CCTAGTCACACACTCGCCCCTTGGTGTCCACCGCCCCCATT Direct Gain 0 0.841610312461853 Functional Gain 0.841610312461853 SBK1 ENSG00000188322 UTR3 Human protein_coding chr16:28333411 chr16:28333411 . . 0 21 hm5U_associated_SNPs_209833 0 25673413 Body mass index 5e-06 GWAS_Catalog TagSNP rs2650492 GCST002783 Genetic studies of body mass index yield new insights for obesity biology.
404 chr16 28995757 28995757 1 + C A rs7140 28995757 - 28995737 28995777 41 CTCCTCCCCTGAGCTACCCAGGTAGTGTCTGGGAGCTGGCA CTCCTCCCCTGAGCTACCCATGTAGTGTCTGGGAGCTGGCA Direct Gain 0 0.68511974811554 Functional Gain 0.68511974811554 SPNS1 ENSG00000169682 CDS Human protein_coding chr16:28995757 chr16:28995757 nonsynonymous SNV 0.955 1 21 hm5U_associated_SNPs_209875 0 29942086 Intelligence 2e-09 GWAS_Catalog TagSNP rs7140 GCST006250 Genome-wide association meta-analysis in 269,867 individuals identifies new genetic and functional links to intelligence.
405 chr16 31088347 31088347 1 + G A rs749671 31088347 - 31088327 31088367 41 CATTTGTACCGCCGCTCCTCCTCAGCAGGAGGGGACTGGGT CATTTGTACCGCCGCTCCTCTTCAGCAGGAGGGGACTGGGT Direct Gain 0 0.856126666069031 Functional Gain 0.856126666069031 ZNF646 ENSG00000167395 CDS Human protein_coding chr16:31088347 chr16:31088347 synonymous SNV . 0 21 hm5U_associated_SNPs_210047 0 26265036 Warfarin maintenance dose 1e-33 GWAS_Catalog TagSNP rs749671 GCST003085 Genome-wide association study of warfarin maintenance dose in a Brazilian sample.
406 chr16 31276811 31276811 1 + G A rs1143679 31276811 - 31276791 31276831 41 GCAGTGACTCACCCTGCAGGCGGATGGGCTCGCATGAGCCT GCAGTGACTCACCCTGCAGGTGGATGGGCTCGCATGAGCCT Direct Gain 0 0.784944295883179 Functional Gain 0.784944295883179 ITGAM ENSG00000169896 CDS Human protein_coding chr16:31276811 chr16:31276811 nonsynonymous SNV 0.548 0 21 hm5U_associated_SNPs_210066 0 27399966 Systemic lupus erythematosus 5e-48 GWAS_Catalog TagSNP rs1143679 GCST003622 Genome-wide association meta-analysis in Chinese and European individuals identifies ten new loci associated with systemic lupus erythematosus.
407 chr16 50335074 50335074 1 + C A rs78534766 50335074 - 50335054 50335094 41 TTCATCTCCTTGAGGTAGGGGTCCCGCTGCTGCCCGTGCCC TTCATCTCCTTGAGGTAGGGTTCCCGCTGCTGCCCGTGCCC Direct Gain 0 0.898233890533447 Functional Gain 0.898233890533447 ADCY7 ENSG00000121281 CDS Human protein_coding chr16:50335074 chr16:50335074 nonsynonymous SNV 0.998 2 21 hm5U_associated_SNPs_210140 0 28067908 Ulcerative colitis 3e-13 GWAS_Catalog TagSNP rs78534766 GCST004133 Genome-wide association study implicates immune activation of multiple integrin genes in inflammatory bowel disease.
408 chr16 50745199 50745199 1 + C A rs2066843 50745199 - 50745179 50745219 41 GCCACCCCGGGCTCATGATGGCGCTTCCTCAGGTACAGCTC GCCACCCCGGGCTCATGATGTCGCTTCCTCAGGTACAGCTC Direct Gain 0 0.501245737075806 Functional Gain 0.501245737075806 NOD2 ENSG00000167207 CDS Human protein_coding chr16:50745199 chr16:50745199 synonymous SNV . 0 21 hm5U_associated_SNPs_210155 0 17068223 Crohn's disease 2.86e-09 Johnson and O'Donnell TagSNP rs2066843 . A genome-wide association study identifies IL23R as an inflammatory bowel disease gene.
409 chr16 56995935 56995935 1 + C A rs34065661 56995935 - 56995915 56995955 41 TGCCTTTGGAGCAGGCATGGGCATTGCCCAGCAGGGCCAGG TGCCTTTGGAGCAGGCATGGTCATTGCCCAGCAGGGCCAGG Direct Gain 0 0.766662955284119 Functional Gain 0.766662955284119 CETP ENSG00000087237 CDS Human protein_coding chr16:56995935 chr16:56995935 nonsynonymous SNV 0.836 1 21 hm5U_associated_SNPs_210248 0 29404214 HDL cholesterol 9e-10 GWAS_Catalog TagSNP rs34065661 GCST006306 Gene-based association study for lipid traits in diverse cohorts implicates BACE1 and SIDT2 regulation in triglyceride levels.
410 chr16 67418860 67418860 1 + G A rs8058996 67418860 - 67418840 67418880 41 CTCCCCAGATGATGACCCTTCTCAGGAGGCAGGAGCGCTTT CTCCCCAGATGATGACCCTTTTCAGGAGGCAGGAGCGCTTT Direct Gain 0 0.649200975894928 Functional Gain 0.649200975894928 LRRC36 ENSG00000159708 CDS Human protein_coding chr16:67418860 chr16:67418860 synonymous SNV . 0 21 hm5U_associated_SNPs_210474 0 30019117 Adolescent idiopathic scoliosis 2e-06 GWAS_Catalog TagSNP rs8058996 GCST006287 The coexistence of copy number variations (CNVs) and single nucleotide polymorphisms (SNPs) at a locus can result in distorted calculations of the significance in associating SNPs to disease.
411 chr16 69975360 69975360 1 + G A rs1052429 69975360 - 69975340 69975380 41 ACTGAAAGGGACAGAAGAGGCTGCGCTGTGGCAAGCTAAGC ACTGAAAGGGACAGAAGAGGTTGCGCTGTGGCAAGCTAAGC Direct Gain 0 0.690128207206726 Functional Gain 0.690128207206726 WWP2 ENSG00000198373 UTR3 Human protein_coding chr16:69975360 chr16:69975360 . . 0 21 hm5U_associated_SNPs_210578 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0003932 Johnson and O'Donnell TagSNP rs1052429 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
412 chr16 85319399 85319399 1 + C A rs12447206 85319399 - 85319379 85319419 41 CTCAGCCTTTACTGTGGACAGGGATCACAGATGTGGGGTTT CTCAGCCTTTACTGTGGACATGGATCACAGATGTGGGGTTT Direct Gain 0 0.601644098758698 Functional Gain 0.601644098758698 LINC00311 ENSG00000179219 ncRNA_exonic Human lincRNA chr16:85319399 chr16:85319399 . . 0 21 hm5U_associated_SNPs_210844 0 28196072 Male-pattern baldness 2e-08 GWAS_Catalog TagSNP rs12447206 GCST006661 Genetic prediction of male pattern baldness.
413 chr16 89986154 89986154 1 + G A rs885479 89986154 - 89986134 89986174 41 CCCAGATGGCCGCAACGGCTCGCCGCGCCCGCGGCAGGGTC CCCAGATGGCCGCAACGGCTTGCCGCGCCCGCGGCAGGGTC Direct Gain 0 0.826258897781372 Functional Gain 0.826258897781372 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89986154 chr16:89986154 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_211349 2 30531825 Blond vs. brown/black hair color 4e-08 GWAS_Catalog TagSNP rs885479 GCST006988 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
414 chr17 2883588 2883588 1 + C A rs17762452 2883588 - 2883568 2883608 41 CCGCTCATGTACCGTCTTCAGTTTGGACCTGCACAAGACGG CCGCTCATGTACCGTCTTCATTTTGGACCTGCACAAGACGG Direct Gain 0 0.831500291824341 Functional Gain 0.831500291824341 RAP1GAP2 ENSG00000132359 CDS Human protein_coding chr17:2883588 chr17:2883588 nonsynonymous SNV 0.998 1 21 hm5U_associated_SNPs_211573 0 27863252 Lymphocyte counts 8e-14 GWAS_Catalog TagSNP rs17762452 GCST004627 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
415 chr17 3214106 3214106 1 + C A rs9911226 3214106 - 3214086 3214126 41 GGGGCCACAGAAGTTAAGAGGAGACAGGGCAACAGTTTGGG GGGGCCACAGAAGTTAAGAGTAGACAGGGCAACAGTTTGGG Direct Gain 0 0.757333934307098 Functional Gain 0.757333934307098 OR3A4P ENSG00000180068 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr17:3214106 chr17:3214106 . . 0 21 hm5U_associated_SNPs_211596 0 17554300 Multiple complex diseases 0.000959449 Johnson and O'Donnell TagSNP rs9911226 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
416 chr17 4441309 4441309 1 + C A rs10521140 4441309 - 4441289 4441329 41 GCGCCCAGCTTCATTTGCCAGGTTGCGTCCAATATCCCCAA GCGCCCAGCTTCATTTGCCATGTTGCGTCCAATATCCCCAA Direct Gain 0 0.848988771438599 Functional Gain 0.848988771438599 SPNS2 ENSG00000183018 UTR3 Human protein_coding chr17:4441309 chr17:4441309 . . 0 21 hm5U_associated_SNPs_211646 0 17641165 HIV-1 disease progression 0.0006096 Johnson and O'Donnell TagSNP rs10521140 . A whole-genome association study of major determinants for host control of HIV-1.
417 chr17 7185062 7185062 1 + C A rs5417 7185062 - 7185042 7185082 41 AGTGGGGCTCCCGCGGATCTGGTGGAGCGGGGCTGGGGGAA AGTGGGGCTCCCGCGGATCTTGTGGAGCGGGGCTGGGGGAA Direct Gain 0 0.883610308170319 Functional Gain 0.883610308170319 SLC2A4 ENSG00000181856 UTR5 Human protein_coding chr17:7185062 chr17:7185062 . . 0 21 hm5U_associated_SNPs_211817 0 28135244 Diastolic blood pressure 1e-13 GWAS_Catalog TagSNP rs5417 GCST004280 Genome-wide association analysis identifies novel blood pressure loci and offers biological insights into cardiovascular risk.
418 chr17 7185092 7185092 1 + G A rs5418 7185092 - 7185072 7185112 41 CCACAGCCACAAGCCAAGGACCCGGAGAGCAGTGGGGCTCC CCACAGCCACAAGCCAAGGATCCGGAGAGCAGTGGGGCTCC Direct Gain 0 0.966086983680725 Functional Gain 0.966086983680725 SLC2A4 ENSG00000181856 UTR5 Human protein_coding chr17:7185092 chr17:7185092 . . 0 21 hm5U_associated_SNPs_211819 0 30595370 Systolic blood pressure 7e-19 GWAS_Catalog TagSNP rs5418 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
419 chr17 7484812 7484812 1 + G A rs9901675 7484812 - 7484792 7484832 41 TGCTCAGAGGGCCTGGTAGGCGGATGGGCGTCTCCGGATGA TGCTCAGAGGGCCTGGTAGGTGGATGGGCGTCTCCGGATGA Direct Gain 0 0.603170990943909 Functional Gain 0.603170990943909 CD68 ENSG00000129226 CDS Human protein_coding chr17:7484812 chr17:7484812 nonsynonymous SNV 0.009 0 21 hm5U_associated_SNPs_211911 0 22829776 Sex hormone-binding globulin levels 1e-07 GWAS_Catalog TagSNP rs9901675 GCST001612 A genome-wide association meta-analysis of circulating sex hormone-binding globulin reveals multiple Loci implicated in sex steroid hormone regulation.
420 chr17 7534678 7534678 1 + C A rs6258 7534678 - 7534658 7534698 41 ACCCCTGGGGTGTAGTTACCGGCAACCGAAGGTTGGAAGCG ACCCCTGGGGTGTAGTTACCTGCAACCGAAGGTTGGAAGCG Direct Gain 0 0.847370982170105 Functional Gain 0.847370982170105 SHBG ENSG00000129214 CDS Human protein_coding chr17:7534678 chr17:7534678 nonsynonymous SNV 0.984 3 21 hm5U_associated_SNPs_211920 0 21998597 Testosterone levels 2e-22 GWAS_Catalog TagSNP rs6258 GCST001264 Genetic determinants of serum testosterone concentrations in men.
421 chr17 7606722 7606722 1 + C A rs7640 7606722 - 7606702 7606742 41 CAGGGATGCTGGAGTCTGGCGCCCCCCCACACCACCAGAGC CAGGGATGCTGGAGTCTGGCTCCCCCCCACACCACCAGAGC Direct Gain 0 0.57707542181015 Functional Gain 0.57707542181015 WRAP53 ENSG00000141499 CDS Human protein_coding chr17:7606722 chr17:7606722 nonsynonymous SNV 0.009 1 21 hm5U_associated_SNPs_211935 0 28093568 Cognitive function 7e-07 GWAS_Catalog TagSNP rs7640 GCST004077 GWAS meta-analysis reveals novel loci and genetic correlates for general cognitive function: a report from the COGENT consortium.
422 chr17 7754993 7754993 1 + G A rs12939056 7754993 - 7754973 7755013 41 CGCATGAAGGCGGGCAGCTTCAGCAGCTCCTGCAGCTGGGG CGCATGAAGGCGGGCAGCTTTAGCAGCTCCTGCAGCTGGGG Direct Gain 0 0.531998336315155 Functional Gain 0.531998336315155 KDM6B ENSG00000132510 CDS Human protein_coding chr17:7754993 chr17:7754993 synonymous SNV . 0 21 hm5U_associated_SNPs_211971 0 29782485 Height 8e-07 GWAS_Catalog TagSNP rs12939056 GCST005908 Evaluation and application of summary statistic imputation to discover new height-associated loci.
423 chr17 13928401 13928401 1 + G A rs2286351 13928401 - 13928381 13928421 41 TTCAGTTCCAGGGTTAGGGCCAGTGGCTACAGTACGTGCCG TTCAGTTCCAGGGTTAGGGCTAGTGGCTACAGTACGTGCCG Direct Gain 0 0.973675429821014 Functional Gain 0.973675429821014 CDRT15P1 ENSG00000141028;ENSG00000236088 ncRNA_intronic Human other chr17:13928401 chr17:13928401 . . 0 21 hm5U_associated_SNPs_212113 0 29394082 Chronic obstructive pulmonary disease 2e-08 GWAS_Catalog TagSNP rs2286351 GCST005417 A Genome-wide Association Study in Hispanics/Latinos Identifies Novel Signals for Lung Function. The Hispanic Community Health Study/Study of Latinos.
424 chr17 17068182 17068182 1 + G A rs61744862 17068182 - 17068162 17068202 41 GTGCTCTGCGAGCCTGCGCACGCTGGCCTCTCGTGCCTCCA GTGCTCTGCGAGCCTGCGCATGCTGGCCTCTCGTGCCTCCA Direct Gain 0 0.729396998882294 Functional Gain 0.729396998882294 MPRIP ENSG00000133030 CDS Human protein_coding chr17:17068182 chr17:17068182 unknown . 0 21 hm5U_associated_SNPs_212167 0 23251661 Obesity-related traits 7e-08 GWAS_Catalog TagSNP rs61744862 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
425 chr17 17696755 17696755 1 + C A rs11649804 17696755 - 17696735 17696775 41 CAGGGAGTGAGTCCGAAAGGGCACCTGGGCGCCCTGCTCTG CAGGGAGTGAGTCCGAAAGGTCACCTGGGCGCCCTGCTCTG Direct Gain 0 0.738088250160217 Functional Gain 0.738088250160217 RAI1 ENSG00000108557 CDS Human protein_coding chr17:17696755 chr17:17696755 nonsynonymous SNV 0.996 4 21 hm5U_associated_SNPs_212194 1 28928442 Myringotomy 3e-07 GWAS_Catalog TagSNP rs11649804 GCST005015 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
426 chr17 37814080 37814080 1 + G A rs1877031 37814080 - 37814060 37814100 41 TCACCCACCAGTGCCGGAGCCGCAGCACGGCATAGCCTAGG TCACCCACCAGTGCCGGAGCTGCAGCACGGCATAGCCTAGG Direct Gain 0 0.528539001941681 Functional Gain 0.528539001941681 STARD3 ENSG00000131748 CDS Human protein_coding chr17:37814080 chr17:37814080 nonsynonymous SNV 0.635 2 21 hm5U_associated_SNPs_212702 0 28334899 HDL cholesterol levels 1e-21 GWAS_Catalog TagSNP rs1877031 GCST004232 Association analyses of East Asian individuals and trans-ancestry analyses with European individuals reveal new loci associated with cholesterol and triglyceride levels.
427 chr17 38173143 38173143 1 + G A rs25645 38173143 - 38173123 38173163 41 CTCTGCAGATGGGAGGCAACCAGGACCCCTCCTGCCCGGCG CTCTGCAGATGGGAGGCAACTAGGACCCCTCCTGCCCGGCG Direct Gain 0 0.828438222408295 Functional Gain 0.828438222408295 CSF3 ENSG00000108342 CDS Human protein_coding chr17:38173143 chr17:38173143 synonymous SNV . 0 21 hm5U_associated_SNPs_212736 0 27863252 Myeloid white cell count 6e-191 GWAS_Catalog TagSNP rs25645 GCST004626 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
428 chr17 40985648 40985648 1 + C A rs139945697 40985648 - 40985628 40985668 41 ACCTTCAGCAACGAGGCCATGGCCGGGCCGGGCCGTGTCCG ACCTTCAGCAACGAGGCCATTGCCGGGCCGGGCCGTGTCCG Direct Gain 0 0.914601266384125 Functional Gain 0.914601266384125 PSME3 ENSG00000131467 UTR5 Human protein_coding chr17:40985648 chr17:40985648 . . 0 21 hm5U_associated_SNPs_212856 0 30595370 Waist-hip ratio 4e-08 GWAS_Catalog TagSNP rs139945697 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
429 chr17 43714850 43714850 1 + G A rs2942168 43714850 - 43714830 43714870 41 GGGGCTCTGGGAAAGAGCTTCGGCCTCACACTGGGTCACCT GGGGCTCTGGGAAAGAGCTTTGGCCTCACACTGGGTCACCT Direct Gain 0 0.790655255317688 Functional Gain 0.790655255317688 LINC02210 ENSG00000204650 ncRNA_exonic Human transcribed_unitary_pseudogene chr17:43714850 chr17:43714850 . . 0 21 hm5U_associated_SNPs_213011 0 21292315 Parkinson's disease 1e-28 GWAS_Catalog TagSNP rs2942168 GCST000959 Imputation of sequence variants for identification of genetic risks for Parkinson's disease: a meta-analysis of genome-wide association studies.
430 chr17 48653130 48653130 1 + G A rs116920450 48653130 - 48653110 48653150 41 CAACCCGCACACCTGCTGCCCGAGAGACCTGAGCCAGCCTG CAACCCGCACACCTGCTGCCTGAGAGACCTGAGCCAGCCTG Direct Gain 0 0.882690906524658 Functional Gain 0.882690906524658 CACNA1G ENSG00000006283 CDS Human protein_coding chr17:48653130 chr17:48653130 nonsynonymous SNV 0.102 4 21 hm5U_associated_SNPs_213256 0 30643258 Adventurousness 4e-08 GWAS_Catalog TagSNP rs116920450 GCST007324 Genome-wide association analyses of risk tolerance and risky behaviors in over 1 million individuals identify hundreds of loci and shared genetic influences.
431 chr17 48944345 48944345 1 + C A rs12949115 48944345 - 48944325 48944365 41 CGGTTGGCCTAGGCCTTGGGGTGATTAATATTCAATTAATC CGGTTGGCCTAGGCCTTGGGTTGATTAATATTCAATTAATC Direct Gain 0 0.561749577522278 Functional Gain 0.561749577522278 TOB1-AS1 ENSG00000229980 ncRNA_exonic Human processed_transcript chr17:48944345 chr17:48944345 . . 0 21 hm5U_associated_SNPs_213289 0 30595370 Height 1e-10 GWAS_Catalog TagSNP rs12949115 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
432 chr17 54939737 54939737 1 + T A rs3826295 54939737 - 54939717 54939757 41 CCCACTCTAGCCGCTAGTGTACAGTGACCAGCTGCATGAGC CCCACTCTAGCCGCTAGTGTTCAGTGACCAGCTGCATGAGC Direct Gain 0 0.615045428276062 Functional Gain 0.615045428276062 DGKE ENSG00000153933 UTR3 Human protein_coding chr17:54939737 chr17:54939737 . . 0 21 hm5U_associated_SNPs_213328 0 17463246 Multiple continuous traits in DGI samples 0.0004797 Johnson and O'Donnell TagSNP rs3826295 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
433 chr17 58824617 58824617 1 + G A rs34431714 58824617 - 58824597 58824637 41 ACTGTGGAGCAGGCAAGATTCTAGCCGCTCGAATTGGGCCA ACTGTGGAGCAGGCAAGATTTTAGCCGCTCGAATTGGGCCA Direct Gain 0 0.54092276096344 Functional Gain 0.54092276096344 BCAS3 ENSG00000141376 CDS Human protein_coding chr17:58824617 chr17:58824617 nonsynonymous SNV 0.998 3 21 hm5U_associated_SNPs_213406 0 27989323 Interleukin-2 levels 6e-06 GWAS_Catalog TagSNP rs34431714 GCST004455 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
434 chr17 72469966 72469966 1 + G A rs2272111 72469966 - 72469946 72469986 41 CAACGGGATCATGAAAGTCTCGGAGCCATGGTGTATCCACC CAACGGGATCATGAAAGTCTTGGAGCCATGGTGTATCCACC Direct Gain 0 0.792182683944702 Functional Gain 0.792182683944702 CD300A ENSG00000167851 CDS Human protein_coding chr17:72469966 chr17:72469966 nonsynonymous SNV 0.000 0 21 hm5U_associated_SNPs_213667 0 30072576 Blood protein levels 1e-52 GWAS_Catalog TagSNP rs2272111 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
435 chr17 74381555 74381555 1 + G A rs2247856 74381555 - 74381535 74381575 41 CGTGGCTGCAGGAGCACCGGCGTCATTCCCTGCGGCGGCTG CGTGGCTGCAGGAGCACCGGTGTCATTCCCTGCGGCGGCTG Direct Gain 0 0.685843229293823 Functional Gain 0.685843229293823 SPHK1 ENSG00000176170 CDS Human protein_coding chr17:74381555 chr17:74381555 nonsynonymous SNV 0.294 1 21 hm5U_associated_SNPs_213886 0 27863252 Reticulocyte fraction of red cells 2e-27 GWAS_Catalog TagSNP rs2247856 GCST004619 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
436 chr17 79205421 79205421 1 + G A rs61745945 79205421 - 79205401 79205441 41 GGACTGTGACTCGGGGACCACGCGCCTTCCTGAGCCGCGAG GGACTGTGACTCGGGGACCATGCGCCTTCCTGAGCCGCGAG Direct Gain 0 0.885090291500092 Functional Gain 0.885090291500092 TEPSIN ENSG00000167302 CDS Human protein_coding chr17:79205421 chr17:79205421 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_214323 0 29875488 Blood protein levels 6e-19 GWAS_Catalog TagSNP rs61745945 GCST005806 Genomic atlas of the human plasma proteome.
437 chr17 79954544 79954544 1 + T A rs8074498 79954544 - 79954524 79954564 41 TGGGCCCAGGAGGGCCCCCCAGTCTCTGTCCCCCACCCGAG TGGGCCCAGGAGGGCCCCCCTGTCTCTGTCCCCCACCCGAG Direct Gain 0 0.516182959079742 Functional Gain 0.516182959079742 ASPSCR1 ENSG00000169696 CDS Human protein_coding chr17:79954544 chr17:79954544 nonsynonymous SNV 0.876 3 21 hm5U_associated_SNPs_214454 0 30595370 Red blood cell count 6e-10 GWAS_Catalog TagSNP rs8074498 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
438 chr18 42456653 42456653 1 + G A rs663651 42456653 - 42456633 42456673 41 AGTGAGAGAACCGGGTTTTGCGGGGAATGGGTTCCGGGGGC AGTGAGAGAACCGGGTTTTGTGGGGAATGGGTTCCGGGGGC Direct Gain 0 0.692717969417572 Functional Gain 0.692717969417572 SETBP1 ENSG00000152217 CDS Human protein_coding chr18:42456653 chr18:42456653 nonsynonymous SNV 0.008 1 21 hm5U_associated_SNPs_214828 1 30012220 QRS duration 4e-33 GWAS_Catalog TagSNP rs663651 GCST007104 Exome-chip meta-analysis identifies novel loci associated with cardiac conduction, including ADAMTS6.
439 chr18 44040559 44040559 1 + G A rs4290554 44040559 - 44040539 44040579 41 CATTCCACTCCCAGAAACAACGCCAAAATGAGGTAATAGGA CATTCCACTCCCAGAAACAATGCCAAAATGAGGTAATAGGA Direct Gain 0 0.541994392871857 Functional Gain 0.541994392871857 RNF165 ENSG00000141622 UTR3 Human protein_coding chr18:44040559 chr18:44040559 . . 0 21 hm5U_associated_SNPs_214859 0 29594489 Clostridium difficile infection in multiple myeloma 1e-06 GWAS_Catalog TagSNP rs4290554 GCST005686 Host genetic susceptibility to Clostridium difficile infections in patients undergoing autologous stem cell transplantation: a genome-wide association study.
440 chr18 77156171 77156171 1 + G A rs74183647 77156171 - 77156151 77156191 41 CGGAGGCACAGGAGAAGCGGCCGCCCCGCGCTGCCGGGGTC CGGAGGCACAGGAGAAGCGGTCGCCCCGCGCTGCCGGGGTC Direct Gain 0 0.971014618873596 Functional Gain 0.971014618873596 NFATC1 ENSG00000131196 UTR5 Human protein_coding chr18:77156171 chr18:77156171 . . 0 21 hm5U_associated_SNPs_215089 0 29779033 Estimated glomerular filtration rate 2e-11 GWAS_Catalog TagSNP rs74183647 GCST006392 Genome-Wide Association Study of Renal Function Traits: Results from the Japan Multi-Institutional Collaborative Cohort Study.
441 chr19 577782 577782 1 + G A rs144824657 577782 - 577762 577802 41 CTGGGACAGCGGCGCCTGGACGAAGCCGGCTGTGGGGAGAG CTGGGACAGCGGCGCCTGGATGAAGCCGGCTGTGGGGAGAG Direct Gain 0 0.864647328853607 Functional Gain 0.864647328853607 BSG ENSG00000172270 CDS Human protein_coding chr19:577782 chr19:577782 nonsynonymous SNV 0.000 0 21 hm5U_associated_SNPs_215174 0 28881265 Endometriosis 1e-06 GWAS_Catalog TagSNP rs144824657 GCST004873 New variants near RHOJ and C2, HLA-DRA region and susceptibility to endometriosis in the Polish population-The genome-wide association study.
442 chr19 844020 844020 1 + G A rs351111 844020 - 844000 844040 41 GCCCACCTGGATGAGGAGAACGTCGTTCAGTTTGTTCTCCG GCCCACCTGGATGAGGAGAATGTCGTTCAGTTTGTTCTCCG Direct Gain 0 0.811093688011169 Functional Gain 0.811093688011169 PRTN3 ENSG00000196415 CDS Human protein_coding chr19:844020 chr19:844020 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_215259 0 29875488 Blood protein levels 4e-66 GWAS_Catalog TagSNP rs351111 GCST005806 Genomic atlas of the human plasma proteome.
443 chr19 1079959 1079959 1 + G A rs36084354 1079959 - 1079939 1079979 41 ACGGGCAGCGGCGCCGTCTGCATATGCATCATCTGGTAGTA ACGGGCAGCGGCGCCGTCTGTATATGCATCATCTGGTAGTA Direct Gain 0 0.793271541595459 Functional Gain 0.793271541595459 ARHGAP45 ENSG00000180448 CDS Human protein_coding chr19:1079959 chr19:1079959 nonsynonymous SNV 0.999 0 21 hm5U_associated_SNPs_215354 0 27863252 Neutrophil percentage of white cells 2e-12 GWAS_Catalog TagSNP rs36084354 GCST004633 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
444 chr19 1104078 1104078 1 + G A rs4807542 1104078 - 1104058 1104098 41 AGAGCCCCACAGAGCAGCGCCGGCTTCAGTAGGCGGCAAAG AGAGCCCCACAGAGCAGCGCTGGCTTCAGTAGGCGGCAAAG Direct Gain 0 0.745682001113892 Functional Gain 0.745682001113892 GPX4 ENSG00000167468 CDS Human protein_coding chr19:1104078 chr19:1104078 unknown . 0 21 hm5U_associated_SNPs_215373 0 27863252 Eosinophil percentage of granulocytes 3e-11 GWAS_Catalog TagSNP rs4807542 GCST004617 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
445 chr19 3150418 3150418 1 + C A rs2302063 3150418 - 3150398 3150438 41 GAATTAGGGTCCCCCTGGAAGGACCTCATCCTGGAGCAGGA GAATTAGGGTCCCCCTGGAATGACCTCATCCTGGAGCAGGA Direct Gain 0 0.718462824821472 Functional Gain 0.718462824821472 LOC100996351 ENSG00000267551 ncRNA_intronic Human antisense chr19:3150418 chr19:3150418 . . 0 21 hm5U_associated_SNPs_215749 0 25524916 Glucose homeostasis traits 7e-08 GWAS_Catalog TagSNP rs2302063 GCST002726 Genetic Variants Associated With Quantitative Glucose Homeostasis Traits Translate to Type 2 Diabetes in Mexican Americans: The GUARDIAN (Genetics Underlying Diabetes in Hispanics) Consortium.
446 chr19 3927771 3927771 1 + G A rs10412199 3927771 - 3927751 3927791 41 CATCTGTGGACGGTGCAGGTCGTGGCCCAGCTGGGAACGGT CATCTGTGGACGGTGCAGGTTGTGGCCCAGCTGGGAACGGT Direct Gain 0 0.515623807907104 Functional Gain 0.515623807907104 MIR1268A ENSG00000167654 UTR3 Human protein_coding chr19:3927771 chr19:3927771 . . 0 21 hm5U_associated_SNPs_215874 1 21782286 Aging (time to event) 3e-06 GWAS_Catalog TagSNP rs10412199 GCST001166 A genome-wide association study of aging.
447 chr19 5823903 5823903 1 + G A rs3763046 5823903 - 5823883 5823923 41 AAGGTCCAGACTTGAATAAACGTAGGAGTTGGCCAGGCAGA AAGGTCCAGACTTGAATAAATGTAGGAGTTGGCCAGGCAGA Direct Gain 0 0.69753634929657 Functional Gain 0.69753634929657 NRTN ENSG00000171119 UTR5 Human protein_coding chr19:5823903 chr19:5823903 . . 0 21 hm5U_associated_SNPs_216009 0 18178869 Minor histocompatibility antigenicity 0.01 Johnson and O'Donnell TagSNP rs3763046 . Identification of human minor histocompatibility antigens based on genetic association with highly parallel genotyping of pooled DNA.
448 chr19 8121096 8121096 1 + G A rs74959615 8121096 - 8121076 8121116 41 GGATCCGGTAAGTCCAGGCGCGCCGGAGCACAGCCCACCCA GGATCCGGTAAGTCCAGGCGTGCCGGAGCACAGCCCACCCA Direct Gain 0 0.692710638046265 Functional Gain 0.692710638046265 CCL25 ENSG00000131142 CDS Human protein_coding chr19:8121096 chr19:8121096 nonsynonymous SNV 0.000 0 21 hm5U_associated_SNPs_216190 0 29875488 Blood protein levels 5e-114 GWAS_Catalog TagSNP rs74959615 GCST005806 Genomic atlas of the human plasma proteome.
449 chr19 8429323 8429323 1 + G A rs116843064 8429323 - 8429303 8429343 41 GTGCGCCAGGACATTCATCTCGTCCCAGGACGCAAAGCGCG GTGCGCCAGGACATTCATCTTGTCCCAGGACGCAAAGCGCG Direct Gain 0 0.709309637546539 Functional Gain 0.709309637546539 ANGPTL4 ENSG00000167772 CDS Human protein_coding chr19:8429323 chr19:8429323 nonsynonymous SNV 1.000 3 21 hm5U_associated_SNPs_216202 1 27036123 Triglycerides 4e-13 GWAS_Catalog TagSNP rs116843064 GCST003661 Meta-analysis of 49 549 individuals imputed with the 1000 Genomes Project reveals an exonic damaging variant in ANGPTL4 determining fasting TG levels.
450 chr19 10577843 10577843 1 + C A rs1051738 10577843 - 10577823 10577863 41 CGACTCCTGACAATCCCTGCGCAGTCAATGCCTCTTGGGCT CGACTCCTGACAATCCCTGCTCAGTCAATGCCTCTTGGGCT Direct Gain 0 0.808035790920258 Functional Gain 0.808035790920258 PDE4A ENSG00000065989 CDS Human protein_coding chr19:10577843 chr19:10577843 nonsynonymous SNV 0.000 1 21 hm5U_associated_SNPs_216306 0 28240269 Blood protein levels 5e-13 GWAS_Catalog TagSNP rs1051738 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
451 chr19 10801185 10801185 1 + G A rs8102380 10801185 - 10801165 10801205 41 GGCCACTGTTCTGGGCAGTACAGTATGCTTGACAGCATCCT GGCCACTGTTCTGGGCAGTATAGTATGCTTGACAGCATCCT Direct Gain 0 0.796639323234558 Functional Gain 0.796639323234558 ILF3 ENSG00000129351 UTR3 Human protein_coding chr19:10801185 chr19:10801185 . . 0 21 hm5U_associated_SNPs_216323 0 25282103 Height 8e-11 GWAS_Catalog TagSNP rs8102380 GCST002647 Defining the role of common variation in the genomic and biological architecture of adult human height.
452 chr19 11221357 11221357 1 + G A rs72658860 11221357 - 11221337 11221377 41 ATTGCAGACGTGGGAACAGCCGCCGTTGTTGTCCAAGCATT ATTGCAGACGTGGGAACAGCTGCCGTTGTTGTCCAAGCATT Direct Gain 0 0.642845690250397 Functional Gain 0.642845690250397 LDLR ENSG00000130164 CDS Human protein_coding chr19:11221357 chr19:11221357 nonsynonymous SNV 0.637 4 21 hm5U_associated_SNPs_216378 4 30275531 LDL cholesterol 3e-15 GWAS_Catalog TagSNP rs72658860 GCST006612 Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program.
453 chr19 17389704 17389704 1 + G A rs8170 17389704 - 17389684 17389724 41 CCAGCCAGTGCCACCTCATACTTGTAGCTGGTACCCTTGGT CCAGCCAGTGCCACCTCATATTTGTAGCTGGTACCCTTGGT Direct Gain 0 0.566551804542542 Functional Gain 0.566551804542542 BABAM1 ENSG00000105393 CDS Human protein_coding chr19:17389704 chr19:17389704 synonymous SNV . 0 21 hm5U_associated_SNPs_216768 0 20852631 Breast cancer 2e-09 GWAS_Catalog TagSNP rs8170 GCST000801 A locus on 19p13 modifies risk of breast cancer in BRCA1 mutation carriers and is associated with hormone receptor-negative breast cancer in the general population.
454 chr19 17392894 17392894 1 + G A rs8100241 17392894 - 17392874 17392914 41 TAGCACCAAATTAGGGTCCGCGCCGCAGCGCAGCAGCTCCT TAGCACCAAATTAGGGTCCGTGCCGCAGCGCAGCAGCTCCT Direct Gain 0 0.963502705097198 Functional Gain 0.963502705097198 ANKLE1 ENSG00000160117 CDS Human protein_coding chr19:17392894 chr19:17392894 nonsynonymous SNV 0.145 3 21 hm5U_associated_SNPs_216772 0 22976474 Breast cancer 4e-08 GWAS_Catalog TagSNP rs8100241 GCST001683 A meta-analysis of genome-wide association studies of breast cancer identifies two novel susceptibility loci at 6q14 and 20q11.
455 chr19 18285944 18285944 1 + G A rs11554159 18285944 - 18285924 18285964 41 GCTCCCGGATCAGGAAGGCTCGGCAGCCACCGCACAGTGCT GCTCCCGGATCAGGAAGGCTTGGCAGCCACCGCACAGTGCT Direct Gain 0 0.745796084403992 Functional Gain 0.745796084403992 IFI30 ENSG00000216490 CDS Human protein_coding chr19:18285944 chr19:18285944 nonsynonymous SNV 0.009 1 21 hm5U_associated_SNPs_216906 0 24076602 Multiple sclerosis 2e-24 GWAS_Catalog TagSNP rs11554159 GCST005531 Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis.
456 chr19 18497024 18497024 1 + G A rs1059519 18497024 - 18497004 18497044 41 GAGCATCTGAGAGCCATTCACCGTCCTGAGTTCTTGCCCGG GAGCATCTGAGAGCCATTCATCGTCCTGAGTTCTTGCCCGG Direct Gain 0 0.748283505439758 Functional Gain 0.748283505439758 GDF15 ENSG00000130513 CDS Human protein_coding chr19:18497024 chr19:18497024 nonsynonymous SNV 0.000 1 21 hm5U_associated_SNPs_216921 0 29628937 Growth differentiation factor-15 levels (conditioned on rs888663) 1e-22 GWAS_Catalog TagSNP rs1059519 GCST005712 A Meta-Analysis of Genome-Wide Association Studies of Growth Differentiation Factor-15 Concentration in Blood.
457 chr19 18497141 18497141 1 + T A rs1059369 18497141 - 18497121 18497161 41 TCGGAATCTGGAGTCTTCGGAGTGCAACTCTGAGGGTCCCG TCGGAATCTGGAGTCTTCGGTGTGCAACTCTGAGGGTCCCG Direct Gain 0 0.940520286560059 Functional Gain 0.940520286560059 GDF15 ENSG00000130513 CDS Human protein_coding chr19:18497141 chr19:18497141 nonsynonymous SNV 0.002 1 21 hm5U_associated_SNPs_216922 0 29628937 Growth differentiation factor-15 levels (conditioned on rs888663) 2e-10 GWAS_Catalog TagSNP rs1059369 GCST005712 A Meta-Analysis of Genome-Wide Association Studies of Growth Differentiation Factor-15 Concentration in Blood.
458 chr19 18530161 18530161 1 + T A rs28375303 18530161 - 18530141 18530181 41 CGCCCCCGCCCGCTGCCTCTACGCCGCCCGCGGGCGCAGCT CGCCCCCGCCCGCTGCCTCTTCGCCGCCCGCGGGCGCAGCT Direct Gain 0 0.618551731109619 Functional Gain 0.618551731109619 SSBP4 ENSG00000130511 UTR5 Human protein_coding chr19:18530161 chr19:18530161 . . 0 21 hm5U_associated_SNPs_216926 0 27863252 Monocyte count 2e-10 GWAS_Catalog TagSNP rs28375303 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
459 chr19 19329924 19329924 1 + C A rs2228603 19329924 - 19329904 19329944 41 GTCCTTGGCCACCAGGATGGGCAAGTCCTGTCGCTGGCCCG GTCCTTGGCCACCAGGATGGTCAAGTCCTGTCGCTGGCCCG Direct Gain 0 0.909503400325775 Functional Gain 0.909503400325775 NCAN ENSG00000130287 CDS Human protein_coding chr19:19329924 chr19:19329924 nonsynonymous SNV 0.998 2 21 hm5U_associated_SNPs_217009 0 27286809 C-reactive protein levels or total cholesterol levels (pleiotropy) 1e-35 GWAS_Catalog TagSNP rs2228603 GCST003678 Bivariate genome-wide association study identifies novel pleiotropic loci for lipids and inflammation.
460 chr19 19455750 19455750 1 + G A rs8102280 19455750 - 19455730 19455770 41 GGATTCTCCCGGGGTGTTGTCACAGGGTTACTCACCAGCAA GGATTCTCCCGGGGTGTTGTTACAGGGTTACTCACCAGCAA Direct Gain 0 0.521414935588837 Functional Gain 0.521414935588837 MAU2 ENSG00000129933 intronic Human protein_coding chr19:19455750 chr19:19455750 . . 0 21 hm5U_associated_SNPs_217021 0 26780889 Triglycerides 3e-18 GWAS_Catalog TagSNP rs8102280 GCST003301 Meta-analysis of lipid-traits in Hispanics identifies novel loci, population-specific effects, and tissue-specific enrichment of eQTLs.
461 chr19 34872382 34872382 1 + G A rs1864139 34872382 - 34872362 34872402 41 TGAGGGTCAATTCCAAACTCCTTCACTTTGGTCTACAAAAA TGAGGGTCAATTCCAAACTCTTTCACTTTGGTCTACAAAAA Direct Gain 0 0.570770502090454 Functional Gain 0.570770502090454 GPI ENSG00000105220 CDS Human protein_coding chr19:34872382 chr19:34872382 synonymous SNV . 0 21 hm5U_associated_SNPs_217223 0 17554300 Multiple complex diseases 0.000237768 Johnson and O'Donnell TagSNP rs1864139 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
462 chr19 36273534 36273534 1 + G A rs2291067 36273534 - 36273514 36273554 41 ATGACATCGTGCACCCGCACCAGACGCTCCTCCTCCCCAGG ATGACATCGTGCACCCGCACTAGACGCTCCTCCTCCCCAGG Direct Gain 0 0.592319548130035 Functional Gain 0.592319548130035 ARHGAP33 ENSG00000004777 CDS Human protein_coding chr19:36273534 chr19:36273534 synonymous SNV . 0 21 hm5U_associated_SNPs_217354 0 31005965 Umami taste perception in obesity with metabolic syndrome 8e-06 GWAS_Catalog TagSNP rs2291067 GCST008022 Association between taste perception and adiposity in overweight or obese older subjects with metabolic syndrome and identification of novel taste-related genes.
463 chr19 41257046 41257046 1 + G A rs1455434 41257046 - 41257026 41257066 41 CGACCCGGTGGGCGGAGCACCCTAAATGGCGATTCCCATTG CGACCCGGTGGGCGGAGCACTCTAAATGGCGATTCCCATTG Direct Gain 0 0.935843288898468 Functional Gain 0.935843288898468 SNRPA ENSG00000077312 UTR5 Human protein_coding chr19:41257046 chr19:41257046 . . 0 21 hm5U_associated_SNPs_217673 0 28240269 Blood protein levels 2e-28 GWAS_Catalog TagSNP rs1455434 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
464 chr19 43865320 43865320 1 + C A rs587670082 43865320 - 43865300 43865340 41 CCAACAGCGCTGCAGCTTTAGGTCGCCACCAGGGTTGATGT CCAACAGCGCTGCAGCTTTATGTCGCCACCAGGGTTGATGT Direct Gain 0 0.828196287155151 Functional Gain 0.828196287155151 CD177 ENSG00000204936 CDS Human protein_coding chr19:43865320 chr19:43865320 unknown . 0 21 hm5U_associated_SNPs_217812 0 29875488 Blood protein levels 2e-65 GWAS_Catalog TagSNP rs587670082 GCST005806 Genomic atlas of the human plasma proteome.
465 chr19 45405499 45405499 1 + G A rs141864196 45405499 - 45405479 45405519 41 CTGCTGCACTCTAGCCTGGGCGACAGAGGGAGACCAGTCTC CTGCTGCACTCTAGCCTGGGTGACAGAGGGAGACCAGTCTC Direct Gain 0 0.526031672954559 Functional Gain 0.526031672954559 TOMM40 ENSG00000130204 UTR3 Human protein_coding chr19:45405499 chr19:45405499 . . 0 21 hm5U_associated_SNPs_217915 0 29777097 Family history of Alzheimer's disease 2e-06 GWAS_Catalog TagSNP rs141864196 GCST005921 GWAS on family history of Alzheimer's disease.
466 chr19 45406673 45406673 1 + G A rs10119 45406673 - 45406653 45406693 41 TCCTGCGTGCCCCTCAATTCCGGAATCCCTCCCGGGACCCC TCCTGCGTGCCCCTCAATTCTGGAATCCCTCCCGGGACCCC Direct Gain 0 0.853990197181702 Functional Gain 0.853990197181702 TOMM40 ENSG00000130204 UTR3 Human protein_coding chr19:45406673 chr19:45406673 . . 0 21 hm5U_associated_SNPs_217917 0 29777097 Family history of Alzheimer's disease 1e-307 GWAS_Catalog TagSNP rs10119 GCST005921 GWAS on family history of Alzheimer's disease.
467 chr19 45448465 45448465 1 + T A rs5167 45448465 - 45448445 45448485 41 CGAGGAACCAGGCCTTGGTGAGCGGACCCAGGTCCCTCAGG CGAGGAACCAGGCCTTGGTGTGCGGACCCAGGTCCCTCAGG Direct Gain 0 0.945214807987213 Functional Gain 0.945214807987213 APOC4 ENSG00000224916;ENSG00000267467 CDS Human other chr19:45448465 chr19:45448465 nonsynonymous SNV 0.151 0 21 hm5U_associated_SNPs_217923 0 28240269 Blood protein levels 2e-69 GWAS_Catalog TagSNP rs5167 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
468 chr19 46206262 46206262 1 + G A rs17850756 46206262 - 46206242 46206282 41 AACACAGCGAGAATGCGGCACAAGTTGTGTACCGTGGGTGG AACACAGCGAGAATGCGGCATAAGTTGTGTACCGTGGGTGG Direct Gain 0 0.544452011585236 Functional Gain 0.544452011585236 QPCTL ENSG00000011478 CDS Human protein_coding chr19:46206262 chr19:46206262 synonymous SNV . 0 21 hm5U_associated_SNPs_218005 0 29875488 Blood protein levels 2e-28 GWAS_Catalog TagSNP rs17850756 GCST005806 Genomic atlas of the human plasma proteome.
469 chr19 46262286 46262286 1 + C A rs725660 46262286 - 46262266 46262306 41 AGGCCTGGGCCTCACCTTGGGTCAGGTACTCCATGTCATCC AGGCCTGGGCCTCACCTTGGTTCAGGTACTCCATGTCATCC Direct Gain 0 0.632085144519806 Functional Gain 0.632085144519806 BHMG1 ENSG00000237452 CDS Human protein_coding chr19:46262286 chr19:46262286 nonsynonymous SNV 0.150 2 21 hm5U_associated_SNPs_218010 0 27863252 Sum eosinophil basophil counts 3e-12 GWAS_Catalog TagSNP rs725660 GCST004624 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
470 chr19 47548678 47548678 1 + G A rs889169 47548678 - 47548658 47548698 41 GGCGGGGGGTCCCCGGGAGGCGCCAGGCCCCATGGCCGCAC GGCGGGGGGTCCCCGGGAGGTGCCAGGCCCCATGGCCGCAC Direct Gain 0 0.930026173591614 Functional Gain 0.930026173591614 NPAS1 ENSG00000130751 CDS Human protein_coding chr19:47548678 chr19:47548678 synonymous SNV . 0 21 hm5U_associated_SNPs_218075 0 30038396 Cognitive performance 6e-09 GWAS_Catalog TagSNP rs889169 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
471 chr19 49132867 49132867 1 + G A rs61751862 49132867 - 49132847 49132887 41 AGGCACGGGCCGCGGCGTAGCCCAGCTGCGGACAGCCCAGG AGGCACGGGCCGCGGCGTAGTCCAGCTGCGGACAGCCCAGG Direct Gain 0 0.878202199935913 Functional Gain 0.878202199935913 SPHK2 ENSG00000063176 CDS Human protein_coding chr19:49132867 chr19:49132867 nonsynonymous SNV 0.997 2 21 hm5U_associated_SNPs_218225 0 30595370 Red cell distribution width 1e-13 GWAS_Catalog TagSNP rs61751862 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
472 chr19 49206462 49206462 1 + C A rs681343 49206462 - 49206442 49206482 41 CCGTTCATCTTGGCCAGGGCGTACAGTGTGGCGTACTCGCC CCGTTCATCTTGGCCAGGGCTTACAGTGTGGCGTACTCGCC Direct Gain 0 0.718214511871338 Functional Gain 0.718214511871338 FUT2 ENSG00000176920 CDS Human protein_coding chr19:49206462 chr19:49206462 stopgain 0.010 0 21 hm5U_associated_SNPs_218238 0 27182965 Childhood ear infection 4e-30 GWAS_Catalog TagSNP rs681343 GCST003991 Detection and interpretation of shared genetic influences on 42 human traits.
473 chr19 49377424 49377424 1 + G A rs11541192 49377424 - 49377404 49377444 41 CCCCAAAGCCTTGACCTCACCCTCCTCTTCATCACTGGGTT CCCCAAAGCCTTGACCTCACTCTCCTCTTCATCACTGGGTT Direct Gain 0 0.713996529579163 Functional Gain 0.713996529579163 PPP1R15A ENSG00000087074 CDS Human protein_coding chr19:49377424 chr19:49377424 nonsynonymous SNV 0.002 0 21 hm5U_associated_SNPs_218255 0 28928442 Mumps 5e-06 GWAS_Catalog TagSNP rs11541192 GCST005003 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
474 chr19 49605705 49605705 1 + G A rs73046792 49605705 - 49605685 49605725 41 ACATCACGAAGCCGGGTCATCAGAGGCTGGGTGGAACCCAA ACATCACGAAGCCGGGTCATTAGAGGCTGGGTGGAACCCAA Direct Gain 0 0.911434054374695 Functional Gain 0.911434054374695 SNRNP70 ENSG00000104852 UTR3 Human protein_coding chr19:49605705 chr19:49605705 . . 0 21 hm5U_associated_SNPs_218292 0 30595370 Systolic blood pressure 1e-17 GWAS_Catalog TagSNP rs73046792 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
475 chr19 50099218 50099218 1 + G A rs143035740 50099218 - 50099198 50099238 41 CCCCAGCCACCCCCATGGCCCGAGAGCGCTGGGGAATGGCC CCCCAGCCACCCCCATGGCCTGAGAGCGCTGGGGAATGGCC Direct Gain 0 0.543749213218689 Functional Gain 0.543749213218689 PRR12 ENSG00000126464 CDS Human protein_coding chr19:50099218 chr19:50099218 synonymous SNV . 0 21 hm5U_associated_SNPs_218394 0 30595370 Lung function (FEV1/FVC) 2e-08 GWAS_Catalog TagSNP rs143035740 GCST007080 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
476 chr19 50168871 50168871 1 + G A rs2304206 50168871 - 50168851 50168891 41 GTAGGTAACGCGGAAGAGCCCGGGAGAGCGTTGGTGGCGTC GTAGGTAACGCGGAAGAGCCTGGGAGAGCGTTGGTGGCGTC Direct Gain 0 0.828544080257416 Functional Gain 0.828544080257416 BCL2L12 ENSG00000126453;ENSG00000126456 UTR5 Human other chr19:50168871 chr19:50168871 . . 0 21 hm5U_associated_SNPs_218417 0 27723757 Vitiligo 2e-09 GWAS_Catalog TagSNP rs2304206 GCST004785 Genome-wide association studies of autoimmune vitiligo identify 23 new risk loci and highlight key pathways and regulatory variants.
477 chr19 51361382 51361382 1 + G A rs61752561 51361382 - 51361362 51361402 41 ATTCTTCAGGAGGCTCATATCGTAGAGCGGGTGTGGGAAGC ATTCTTCAGGAGGCTCATATTGTAGAGCGGGTGTGGGAAGC Direct Gain 0 0.760982394218445 Functional Gain 0.760982394218445 KLK3 ENSG00000142515 CDS Human protein_coding chr19:51361382 chr19:51361382 nonsynonymous SNV 0.000 1 21 hm5U_associated_SNPs_218542 0 28139693 Prostate-specific antigen levels (conditioned on lead SNPs) 2e-25 GWAS_Catalog TagSNP rs61752561 GCST004094 Genome-wide association study of prostate-specific antigen levels identifies novel loci independent of prostate cancer.
478 chr19 55107308 55107308 1 + G A rs35534776 55107308 - 55107288 55107328 41 TGTACTGGCCCCCGTAGGAGCGGCTCACAGGGCCCAGGGTG TGTACTGGCCCCCGTAGGAGTGGCTCACAGGGCCCAGGGTG Direct Gain 0 0.925504684448242 Functional Gain 0.925504684448242 LILRA1 ENSG00000104974 CDS Human protein_coding chr19:55107308 chr19:55107308 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_218767 0 29875488 Blood protein levels 7e-107 GWAS_Catalog TagSNP rs35534776 GCST005806 Genomic atlas of the human plasma proteome.
479 chr19 55145093 55145093 1 + G A rs2114511 55145093 - 55145073 55145113 41 GGGGAGCTGGGGCCCCCAGACGGTCCTGGGTAAAAGAATGA GGGGAGCTGGGGCCCCCAGATGGTCCTGGGTAAAAGAATGA Direct Gain 0 0.55553412437439 Functional Gain 0.55553412437439 LILRB1 ENSG00000104972 CDS Human protein_coding chr19:55145093 chr19:55145093 synonymous SNV . 0 21 hm5U_associated_SNPs_218783 0 29875488 Blood protein levels 0 GWAS_Catalog TagSNP rs2114511 GCST005806 Genomic atlas of the human plasma proteome.
480 chr19 55147509 55147509 1 + C A rs113420280 55147509 - 55147489 55147529 41 AGCACGTTGCACTCCTGGACGCGGCACATTTATTTGCATTT AGCACGTTGCACTCCTGGACTCGGCACATTTATTTGCATTT Direct Gain 0 0.544377624988556 Functional Gain 0.544377624988556 LILRB1 ENSG00000224730 CDS Human antisense chr19:55147509 chr19:55147509 nonsynonymous SNV . 0 21 hm5U_associated_SNPs_218785 0 29875488 Blood protein levels 7e-28 GWAS_Catalog TagSNP rs113420280 GCST005806 Genomic atlas of the human plasma proteome.
481 chr19 56001665 56001665 1 + C A rs114976626 56001665 - 56001645 56001685 41 GGTTCCCAGCTGGGCGGGGGGCTGGGAGTGGAGACAGCCAG GGTTCCCAGCTGGGCGGGGGTCTGGGAGTGGAGACAGCCAG Direct Gain 0 0.834984064102173 Functional Gain 0.834984064102173 SSC5D ENSG00000179954 CDS Human protein_coding chr19:56001665 chr19:56001665 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_218923 0 28552196 Height 4e-07 GWAS_Catalog TagSNP rs114976626 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
482 chr19 56652592 56652592 1 + G A rs3745836 56652592 - 56652572 56652612 41 CCCCAATCCCATACTCCGAGCCGCTCGTTCAGCCCAACAAC CCCCAATCCCATACTCCGAGTCGCTCGTTCAGCCCAACAAC Direct Gain 0 0.970137476921082 Functional Gain 0.970137476921082 ZNF444 ENSG00000167685 UTR5 Human protein_coding chr19:56652592 chr19:56652592 . . 0 21 hm5U_associated_SNPs_218993 0 17554300 Multiple complex diseases 0.000864359 Johnson and O'Donnell TagSNP rs3745836 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
483 chr19 57760018 57760018 1 + G A rs2014572 57760018 - 57759998 57760038 41 TCCTGGTCCATGGCTCCTGCCCATGCTCTAGGTGGTAGATC TCCTGGTCCATGGCTCCTGCTCATGCTCTAGGTGGTAGATC Direct Gain 0 0.577083885669708 Functional Gain 0.577083885669708 ZNF805 ENSG00000204524 CDS Human protein_coding chr19:57760018 chr19:57760018 nonsynonymous SNV 0.001 0 21 hm5U_associated_SNPs_219039 0 18821565 Hyperactive-impulsive symptoms 7e-06 GWAS_Catalog TagSNP rs2014572 GCST000278 Genome-wide association scan of quantitative traits for attention deficit hyperactivity disorder identifies novel associations and confirms candidate gene associations.
484 chr19 58928302 58928302 1 + T A rs10423138 58928302 - 58928282 58928322 41 CAACTGGAACCAGGTGGGAAAGCTGCCCCATGCTCAGTGTG CAACTGGAACCAGGTGGGAATGCTGCCCCATGCTCAGTGTG Direct Gain 0 0.636352062225342 Functional Gain 0.636352062225342 ZNF584 ENSG00000171574 CDS Human protein_coding chr19:58928302 chr19:58928302 synonymous SNV . 0 21 hm5U_associated_SNPs_219146 0 28095793 Uric acid clearance 1e-06 GWAS_Catalog TagSNP rs10423138 GCST004058 Genetic variation underlying renal uric acid excretion in Hispanic children: the Viva La Familia Study.
485 chr20 19702049 19702049 1 + G A rs3828002 19702049 - 19702029 19702069 41 CTAGAATCTCAGTCACTGTTCAAAAATGGAGCTGGAAAAGT CTAGAATCTCAGTCACTGTTTAAAAATGGAGCTGGAAAAGT Direct Gain 0 0.776252746582031 Functional Gain 0.776252746582031 SLC24A3 ENSG00000185052 UTR3 Human protein_coding chr20:19702049 chr20:19702049 . . 0 21 hm5U_associated_SNPs_219435 0 30595370 Menarche (age at onset) 8e-11 GWAS_Catalog TagSNP rs3828002 GCST007078 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
486 chr20 23017082 23017082 1 + T A rs2567608 23017082 - 23017062 23017102 41 GGCAGAGAACCCGCTGGAAGAATCGGCGGAAGTTGTCGGAG GGCAGAGAACCCGCTGGAAGTATCGGCGGAAGTTGTCGGAG Direct Gain 0 0.698835551738739 Functional Gain 0.698835551738739 SSTR4 ENSG00000132671 CDS Human protein_coding chr20:23017082 chr20:23017082 nonsynonymous SNV 0.074 1 21 hm5U_associated_SNPs_219483 0 18282107 Schizophrenia 0.006979535 Johnson and O'Donnell TagSNP rs2567608 . Genome-wide association identifies a common variant in the reelin gene that increases the risk of schizophrenia only in women.
487 chr20 36977970 36977970 1 + G A rs1739654 36977970 - 36977950 36977990 41 AGCAGCTCACTCTGCAGAGCCAATAGCCCCTCCTGGGCCGC AGCAGCTCACTCTGCAGAGCTAATAGCCCCTCCTGGGCCGC Direct Gain 0 0.892396330833435 Functional Gain 0.892396330833435 LBP ENSG00000129988 CDS Human protein_coding chr20:36977970 chr20:36977970 synonymous SNV . 0 21 hm5U_associated_SNPs_219798 0 23382691 IgG glycosylation 5e-06 GWAS_Catalog TagSNP rs1739654 GCST001848 Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers.
488 chr20 44507536 44507536 1 + G A rs4812973 44507536 - 44507516 44507556 41 GGAAGAGGGTGACCTTGCAGCACGGAGATAACTTTGGCCTT GGAAGAGGGTGACCTTGCAGTACGGAGATAACTTTGGCCTT Direct Gain 0 0.736366510391235 Functional Gain 0.736366510391235 ZSWIM3 ENSG00000132801 UTR3 Human protein_coding chr20:44507536 chr20:44507536 . . 0 21 hm5U_associated_SNPs_219948 0 26053186 3-hydroxypropylmercapturic acid levels in smokers 8e-06 GWAS_Catalog TagSNP rs4812973 GCST002956 Mercapturic Acids Derived from the Toxicants Acrolein and Crotonaldehyde in the Urine of Cigarette Smokers from Five Ethnic Groups with Differing Risks for Lung Cancer.
489 chr20 48884124 48884124 1 + C A rs6125961 48884124 - 48884104 48884144 41 CCCGGGGCTTGGGCCTCCCCGCGGGGTCCTAAATTGGGTGC CCCGGGGCTTGGGCCTCCCCTCGGGGTCCTAAATTGGGTGC Direct Gain 0 0.707976639270782 Functional Gain 0.707976639270782 SMIM25 ENSG00000224397 ncRNA_exonic Human lincRNA chr20:48884124 chr20:48884124 . . 0 21 hm5U_associated_SNPs_220039 0 27863252 Monocyte count 2e-57 GWAS_Catalog TagSNP rs6125961 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
490 chr20 62321128 62321128 1 + G A rs35640778 62321128 - 62321108 62321148 41 CAGCCCTGGACGCCTGCTGCCGGTACCACTCCTGCCCAGAG CAGCCCTGGACGCCTGCTGCTGGTACCACTCCTGCCCAGAG Direct Gain 0 0.620922982692719 Functional Gain 0.620922982692719 RTEL1 ENSG00000026036;ENSG00000258366 CDS Human other chr20:62321128 chr20:62321128 nonsynonymous SNV 0.989 1 21 hm5U_associated_SNPs_220424 0 30595370 Mean corpuscular hemoglobin 3e-16 GWAS_Catalog TagSNP rs35640778 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
491 chr20 62327582 62327582 1 + G A rs2297441 62327582 - 62327562 62327602 41 GTCCTGGGCACTGCCAGCAGCTTTATTAGAGAGCCCTGTCC GTCCTGGGCACTGCCAGCAGTTTTATTAGAGAGCCCTGTCC Direct Gain 0 0.611122965812683 Functional Gain 0.611122965812683 RTEL1-TNFRSF6B ENSG00000258366 UTR3 Human protein_coding chr20:62327582 chr20:62327582 . . 0 21 hm5U_associated_SNPs_220442 0 21297633 Ulcerative colitis 2e-10 GWAS_Catalog TagSNP rs2297441 GCST000964 Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47.
492 chr20 62372706 62372706 1 + G A rs4809221 62372706 - 62372686 62372726 41 GGCTCTGGAGGAGATGGGGGCGGGGTGCGGGTGACCCAGCC GGCTCTGGAGGAGATGGGGGTGGGGTGCGGGTGACCCAGCC Direct Gain 0 0.872964024543762 Functional Gain 0.872964024543762 SLC2A4RG ENSG00000125520 intronic Human protein_coding chr20:62372706 chr20:62372706 . . 0 21 hm5U_associated_SNPs_220457 0 30595370 Lung function (FVC) 4e-36 GWAS_Catalog TagSNP rs4809221 GCST007081 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
493 chr21 45181446 45181446 1 + G A rs762407 45181446 - 45181426 45181466 41 CTTCACGGAGATGCTGGCTTCGCAGGCCGGTGGGCGAGGCG CTTCACGGAGATGCTGGCTTTGCAGGCCGGTGGGCGAGGCG Direct Gain 0 0.765031576156616 Functional Gain 0.765031576156616 PDXK ENSG00000160209 UTR3 Human protein_coding chr21:45181446 chr21:45181446 . . 0 21 hm5U_associated_SNPs_220856 0 27980656 Systolic blood pressure change trajectories 7e-07 GWAS_Catalog TagSNP rs762407 GCST003825 Genome-wide association of trajectories of systolic blood pressure change.
494 chr21 46930092 46930092 1 + G A rs144147445 46930092 - 46930072 46930112 41 CAGGCGCGAGGACAGGAAGGCGCGGAAGGTGCCCGCCAGCC CAGGCGCGAGGACAGGAAGGTGCGGAAGGTGCCCGCCAGCC Direct Gain 0 0.628715813159943 Functional Gain 0.628715813159943 COL18A1 ENSG00000182871 CDS Human protein_coding chr21:46930092 chr21:46930092 nonsynonymous SNV 0.982 3 21 hm5U_associated_SNPs_221042 1 29875488 Blood protein levels 6e-44 GWAS_Catalog TagSNP rs144147445 GCST005806 Genomic atlas of the human plasma proteome.
495 chr21 46931109 46931109 1 + G A rs12483377 46931109 - 46931089 46931129 41 CCTCAGGACGTCCTTGCCGTCAAAGGAGAAGATGCGTGCCC CCTCAGGACGTCCTTGCCGTTAAAGGAGAAGATGCGTGCCC Direct Gain 0 0.935719430446625 Functional Gain 0.935719430446625 COL18A1 ENSG00000182871 CDS Human protein_coding chr21:46931109 chr21:46931109 nonsynonymous SNV 0.595 3 21 hm5U_associated_SNPs_221046 2 29875488 Blood protein levels 0 GWAS_Catalog TagSNP rs12483377 GCST005806 Genomic atlas of the human plasma proteome.
496 chr21 46932614 46932614 1 + C A rs17255281 46932614 - 46932594 46932634 41 CCTGGAGAAATCGAGCCGTGGTCTGATCAGGCCAAGAGGTT CCTGGAGAAATCGAGCCGTGTTCTGATCAGGCCAAGAGGTT Direct Gain 0 0.9067143201828 Functional Gain 0.9067143201828 COL18A1 ENSG00000182871 UTR3 Human protein_coding chr21:46932614 chr21:46932614 . . 0 21 hm5U_associated_SNPs_221048 1 29064472 Pursuit maintenance gain 2e-06 GWAS_Catalog TagSNP rs17255281 GCST005024 Genome-wide association studies of smooth pursuit and antisaccade eye movements in psychotic disorders: findings from the B-SNIP study.
497 chr22 18518634 18518634 1 + G A rs4819660 18518634 - 18518614 18518654 41 CATAGTGTTGGCCAATCAGACGAGGACTGCAGAACAGGAGA CATAGTGTTGGCCAATCAGATGAGGACTGCAGAACAGGAGA Direct Gain 0 0.684175908565521 Functional Gain 0.684175908565521 LINC01634 ENSG00000235295 ncRNA_exonic Human lincRNA chr22:18518634 chr22:18518634 . . 0 21 hm5U_associated_SNPs_221235 0 17554300 Multiple complex diseases 2.5e-67 Johnson and O'Donnell TagSNP rs4819660 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
498 chr22 18520582 18520582 1 + G A rs975826 18520582 - 18520562 18520602 41 TCTCCTACCCAAGATAACCACTTCTTGAGTATTCTCAAAGA TCTCCTACCCAAGATAACCATTTCTTGAGTATTCTCAAAGA Direct Gain 0 0.50597482919693 Functional Gain 0.50597482919693 LINC01634 ENSG00000235295 ncRNA_exonic Human lincRNA chr22:18520582 chr22:18520582 . . 0 21 hm5U_associated_SNPs_221237 0 17463246 Multiple continuous traits in DGI samples 0.0005028 Johnson and O'Donnell TagSNP rs975826 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
499 chr22 20134350 20134350 1 + C A rs1974653 20134350 - 20134330 20134370 41 AGAGTTCCAGCAGGTTCAGCGGCCCCCACAGGGCCCTGAGC AGAGTTCCAGCAGGTTCAGCTGCCCCCACAGGGCCCTGAGC Direct Gain 0 0.893857002258301 Functional Gain 0.893857002258301 ZDHHC8 ENSG00000099904 UTR3 Human protein_coding chr22:20134350 chr22:20134350 . . 0 21 hm5U_associated_SNPs_221365 0 26198764 Schizophrenia 8e-06 GWAS_Catalog TagSNP rs1974653 GCST003048 Genome-wide association study of schizophrenia in Ashkenazi Jews.
500 chr22 22712467 22712467 1 + T A rs5757973 22712467 - 22712447 22712487 41 CCTGAGGGCCGCTGATTATTACTATAGATGAGGAGTTTGGG CCTGAGGGCCGCTGATTATTTCTATAGATGAGGAGTTTGGG Direct Gain 0 0.587296605110168 Functional Gain 0.587296605110168 BMS1P20;ZNF280B ENSG00000211648 CDS Human IG_V_gene chr22:22712467 chr22:22712467 nonsynonymous SNV . 0 21 hm5U_associated_SNPs_221564 0 29875488 Blood protein levels 2e-21 GWAS_Catalog TagSNP rs5757973 GCST005806 Genomic atlas of the human plasma proteome.
501 chr22 31286928 31286928 1 + G A rs41282553 31286928 - 31286908 31286948 41 GGAGCGCAGGCCCATGTCGTCGAGGCGGTCCAGCTCGAAGG GGAGCGCAGGCCCATGTCGTTGAGGCGGTCCAGCTCGAAGG Direct Gain 0 0.850528120994568 Functional Gain 0.850528120994568 OSBP2 ENSG00000184792 CDS Human protein_coding chr22:31286928 chr22:31286928 nonsynonymous SNV 0.710 0 21 hm5U_associated_SNPs_222040 0 30038396 Educational attainment (MTAG) 8e-12 GWAS_Catalog TagSNP rs41282553 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
502 chr22 32487700 32487700 1 + G A rs17683430 32487700 - 32487680 32487720 41 TGCTCTCTTGCGGACCTTGGCGTAGATGTCCATGGTGAAGA TGCTCTCTTGCGGACCTTGGTGTAGATGTCCATGGTGAAGA Direct Gain 0 0.672322809696198 Functional Gain 0.672322809696198 SLC5A1 ENSG00000100170 CDS Human protein_coding chr22:32487700 chr22:32487700 nonsynonymous SNV 0.989 1 21 hm5U_associated_SNPs_222112 2 29093273 GIP levels in response to oral glucose tolerance test (120 minutes) 3e-18 GWAS_Catalog TagSNP rs17683430 GCST005166 Genetic determinants of circulating GIP and GLP-1 concentrations.
503 chr22 37424991 37424991 1 + G A rs5756492 37424991 - 37424971 37425011 41 CTGAACTTTGAACCTAAGAACTGGGCCCCAAGGTTTCCTGA CTGAACTTTGAACCTAAGAATTGGGCCCCAAGGTTTCCTGA Direct Gain 0 0.908171057701111 Functional Gain 0.908171057701111 MPST ENSG00000128309 intronic Human protein_coding chr22:37424991 chr22:37424991 . . 0 21 hm5U_associated_SNPs_222205 0 30664655 Eye color (saturation) 5e-08 GWAS_Catalog TagSNP rs5756492 GCST007457 A GWAS in Latin Americans highlights the convergent evolution of lighter skin pigmentation in Eurasia.
504 chr22 39830586 39830586 1 + G A rs17001110 39830586 - 39830566 39830606 41 GTGGAATGCCAAGCGCCTGTCTCTGCTCGGGGCTGACATCA GTGGAATGCCAAGCGCCTGTTTCTGCTCGGGGCTGACATCA Direct Gain 0 0.900068163871765 Functional Gain 0.900068163871765 LOC100506472 ENSG00000100324 intronic Human protein_coding chr22:39830586 chr22:39830586 . . 0 21 hm5U_associated_SNPs_222382 0 28552196 Waist circumference 6e-06 GWAS_Catalog TagSNP rs17001110 GCST008151 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
505 chr22 40075400 40075400 1 + G A rs2294369 40075400 - 40075380 40075420 41 GCCGCCCTCGGTGTCGCCCCCGCCGCCCGCCCCTCCCGGCC GCCGCCCTCGGTGTCGCCCCTGCCGCCCGCCCCTCCCGGCC Direct Gain 0 0.743249714374542 Functional Gain 0.743249714374542 CACNA1I ENSG00000100346 CDS Human protein_coding chr22:40075400 chr22:40075400 nonsynonymous SNV 0.000 1 21 hm5U_associated_SNPs_222415 0 24709693 Response to methotrexate in juvenile idiopathic arthritis 9e-08 GWAS_Catalog TagSNP rs2294369 GCST002408 Genome-wide data reveal novel genes for methotrexate response in a large cohort of juvenile idiopathic arthritis cases.
506 chr22 41736090 41736090 1 + G A rs9607793 41736090 - 41736070 41736110 41 TCGTGTCGACCCAAAGCTGTCGAGTGCATCCAGCCGGGTCT TCGTGTCGACCCAAAGCTGTTGAGTGCATCCAGCCGGGTCT Direct Gain 0 0.947641015052795 Functional Gain 0.947641015052795 ZC3H7B ENSG00000100403 CDS Human protein_coding chr22:41736090 chr22:41736090 nonsynonymous SNV 0.701 1 21 hm5U_associated_SNPs_222471 0 30595370 Red cell distribution width 4e-08 GWAS_Catalog TagSNP rs9607793 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
507 chr22 41753603 41753603 1 + G A rs11090045 41753603 - 41753583 41753623 41 GCAGCACGTGCGCCTGGGTACGCACACCGGGGCGGTGGTGG GCAGCACGTGCGCCTGGGTATGCACACCGGGGCGGTGGTGG Direct Gain 0 0.758480310440063 Functional Gain 0.758480310440063 ZC3H7B ENSG00000100403 UTR3 Human protein_coding chr22:41753603 chr22:41753603 . . 0 21 hm5U_associated_SNPs_222474 0 30038396 Self-reported math ability 1e-32 GWAS_Catalog TagSNP rs11090045 GCST006573 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
508 chr22 42392811 42392811 1 + G A rs1062753 42392811 - 42392791 42392831 41 GGGAGGCTCAGATCATGGTTCAGGGGTGCCAGGCACCATTC GGGAGGCTCAGATCATGGTTTAGGGGTGCCAGGCACCATTC Direct Gain 0 0.711266458034515 Functional Gain 0.711266458034515 SEPT3 ENSG00000100167 UTR3 Human protein_coding chr22:42392811 chr22:42392811 . . 0 21 hm5U_associated_SNPs_222512 0 24528284 Response to serotonin reuptake inhibitors in major depressive disorder (plasma drug and metabolite levels) 2e-16 GWAS_Catalog TagSNP rs1062753 GCST002549 Citalopram and escitalopram plasma drug and metabolite concentrations: genome-wide associations.
509 chr22 45809698 45809698 1 + G A rs2272805 45809698 - 45809678 45809718 41 CGAAAATAAGGAAGCTGTAGCGCAGGCAAGGTCGGCTCCTT CGAAAATAAGGAAGCTGTAGTGCAGGCAAGGTCGGCTCCTT Direct Gain 0 0.603234589099884 Functional Gain 0.603234589099884 RIBC2 ENSG00000128408 UTR5 Human protein_coding chr22:45809698 chr22:45809698 . . 0 21 hm5U_associated_SNPs_222638 0 28552196 Waist circumference 8e-07 GWAS_Catalog TagSNP rs2272805 GCST008151 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
510 chr22 50357625 50357625 1 + G A rs117325373 50357625 - 50357605 50357645 41 AGAACCCCCATCTGCGATGCCTGCACACACCGCATTCACAC AGAACCCCCATCTGCGATGCTTGCACACACCGCATTCACAC Direct Gain 0 0.609637856483459 Functional Gain 0.609637856483459 PIM3 ENSG00000198355 UTR3 Human protein_coding chr22:50357625 chr22:50357625 . . 0 21 hm5U_associated_SNPs_222840 0 27846195 Response to paliperidone in schizophrenia (positive Marder score) 2e-06 GWAS_Catalog TagSNP rs117325373 GCST004040 Genome-wide association study of paliperidone efficacy.
511 chr22 51042336 51042336 1 + G A rs116947359 51042336 - 51042316 51042356 41 GGTTCCCTTCGCAGTCGCAACCCGGGCGCACTGGCGACTGC GGTTCCCTTCGCAGTCGCAATCCGGGCGCACTGGCGACTGC Direct Gain 0 0.807328104972839 Functional Gain 0.807328104972839 MAPK8IP2 ENSG00000008735 CDS Human protein_coding chr22:51042336 chr22:51042336 nonsynonymous SNV 0.498 0 21 hm5U_associated_SNPs_222953 0 30072576 Blood protein levels 1e-07 GWAS_Catalog TagSNP rs116947359 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
512 chrX 48436426 48436426 1 + G A rs3200611 48436426 - 48436406 48436446 41 CCCAGGCTGGAGTACAGTGGCGCGATCTTAGCTCACTGCAA CCCAGGCTGGAGTACAGTGGTGCGATCTTAGCTCACTGCAA Direct Gain 0 0.925592541694641 Functional Gain 0.925592541694641 RBM3 ENSG00000102317 UTR3 Human protein_coding chrX:48436426 chrX:48436426 . . 0 21 hm5U_associated_SNPs_223288 0 28928442 Hepatitis A 9e-06 GWAS_Catalog TagSNP rs3200611 GCST005017 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
513 chrX 153248248 153248248 1 + G A rs13397 153248248 - 153248228 153248268 41 CTTGGGTGAGTGTTGAAATGCGTCAGAAACAAAAACGCAAA CTTGGGTGAGTGTTGAAATGTGTCAGAAACAAAAACGCAAA Direct Gain 0 0.606487989425659 Functional Gain 0.606487989425659 TMEM187 ENSG00000177854 CDS Human protein_coding chrX:153248248 chrX:153248248 synonymous SNV . 0 21 hm5U_associated_SNPs_223844 0 22057235 Celiac disease 3e-08 GWAS_Catalog TagSNP rs13397 GCST005523 Dense genotyping identifies and localizes multiple common and rare variant association signals in celiac disease.