1 chr1 3651409 3651409 1 + G A rs10910018 3651409 + 3651389 3651429 41 CAGCAGGAACGGGGCTGTCGGCTCTCAGGGGATCTGGCTGC CAGCAGGAACGGGGCTGTCGACTCTCAGGGGATCTGGCTGC Direct Gain 0 0.938810169696808 Functional Gain 0.938810169696808 TP73 ENSG00000078900 UTR3 Human protein_coding chr1:3651409 chr1:3651409 . . 0 21 hm6Am_associated_SNPs_488 0 22589738 Visceral fat 2e-06 GWAS_Catalog TagSNP rs10910018 GCST001525 Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women.
2 chr1 3669356 3669356 1 + G A rs76597070 3669356 + 3669336 3669376 41 GACCATCAGCCGCTACTACAGGAAGACGGTATGGGGTCCCG GACCATCAGCCGCTACTACAAGAAGACGGTATGGGGTCCCG Direct Gain 0 0.860172152519226 Functional Gain 0.860172152519226 CCDC27 ENSG00000162592 CDS Human protein_coding chr1:3669356 chr1:3669356 nonsynonymous SNV 0.001 0 21 hm6Am_associated_SNPs_491 0 23251661 Obesity-related traits 3e-06 GWAS_Catalog TagSNP rs76597070 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
3 chr1 7723957 7723957 1 + G A rs12128526 7723957 + 7723937 7723977 41 TTTCCCACCACGGGCAGCTCGGAGAGCCTGTCCATGCTGCC TTTCCCACCACGGGCAGCTCAGAGAGCCTGTCCATGCTGCC Direct Gain 0 0.86526745557785 Functional Gain 0.86526745557785 CAMTA1 ENSG00000171735 CDS Human protein_coding chr1:7723957 chr1:7723957 synonymous SNV . 0 21 hm6Am_associated_SNPs_564 1 30595370 Body mass index 2e-10 GWAS_Catalog TagSNP rs12128526 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
4 chr1 8021740 8021740 1 + G A rs17523802 8021740 + 8021720 8021760 41 TGCGCAGTGTGGGGCTGAGGGAGGCCGGACGGCGCGCGTGC TGCGCAGTGTGGGGCTGAGGAAGGCCGGACGGCGCGCGTGC Direct Gain 0 0.962724804878235 Functional Gain 0.962724804878235 PARK7 ENSG00000116288 UTR5 Human protein_coding chr1:8021740 chr1:8021740 . . 0 21 hm6Am_associated_SNPs_582 1 28928442 Tonsillectomy 9e-07 GWAS_Catalog TagSNP rs17523802 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
5 chr1 9011627 9011627 1 + G A rs3765967 9011627 + 9011607 9011647 41 GGAGGATCTCTATGGGCAACGCTTGCTGAGTGCGGGCTTCG GGAGGATCTCTATGGGCAACACTTGCTGAGTGCGGGCTTCG Direct Gain 0 0.835124135017395 Functional Gain 0.835124135017395 CA6 ENSG00000131686 CDS Human protein_coding chr1:9011627 chr1:9011627 synonymous SNV . 0 21 hm6Am_associated_SNPs_597 0 28240269 Blood protein levels 6e-12 GWAS_Catalog TagSNP rs3765967 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
6 chr1 17674537 17674537 1 + C A rs2240335 17674537 + 17674517 17674557 41 AAGGAGTTTCCCATCAAACGCGTGATGGTACCTGCATGGGG AAGGAGTTTCCCATCAAACGAGTGATGGTACCTGCATGGGG Direct Gain 0 0.930473923683167 Functional Gain 0.930473923683167 PADI4 ENSG00000159339 CDS Human protein_coding chr1:17674537 chr1:17674537 synonymous SNV . 0 21 hm6Am_associated_SNPs_948 0 21505073 Rheumatoid arthritis 2e-08 GWAS_Catalog TagSNP rs2240335 GCST001042 The human AIRE gene at chromosome 21q22 is a genetic determinant for the predisposition to rheumatoid arthritis in Japanese population.
7 chr1 25889422 25889422 1 + C A rs12096438 25889422 + 25889402 25889442 41 TGTGAGGATTAACTGACATCCGAAAGGTTTCTTTCCTCCCG TGTGAGGATTAACTGACATCAGAAAGGTTTCTTTCCTCCCG Direct Gain 0 0.591642737388611 Functional Gain 0.591642737388611 LDLRAP1 ENSG00000157978 intronic Human protein_coding chr1:25889422 chr1:25889422 . . 0 21 hm6Am_associated_SNPs_1177 0 27863252 Mean platelet volume 5e-25 GWAS_Catalog TagSNP rs12096438 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
8 chr1 43919486 43919486 1 + C A rs182798940 43919486 + 43919466 43919506 41 CCTGGGGAGGCCGGGCCGGGCGGAGTCCGCGGGATCCAAAG CCTGGGGAGGCCGGGCCGGGAGGAGTCCGCGGGATCCAAAG Direct Gain 0 0.970389842987061 Functional Gain 0.970389842987061 HYI;SZT2 ENSG00000178922 UTR5 Human protein_coding chr1:43919486 chr1:43919486 . . 0 21 hm6Am_associated_SNPs_1603 0 26830138 Alzheimer disease and age of onset 7e-07 GWAS_Catalog TagSNP rs182798940 GCST003427 Family-based association analyses of imputed genotypes reveal genome-wide significant association of Alzheimer's disease with OSBPL6, PTPRG, and PDCL3.
9 chr1 46073489 46073489 1 + G A rs2230657 46073489 + 46073469 46073509 41 GAAGCAGAGTCTTTAGACCCGACAGTCAAGCCAGTGGATGT GAAGCAGAGTCTTTAGACCCAACAGTCAAGCCAGTGGATGT Direct Gain 0 0.527222692966461 Functional Gain 0.527222692966461 NASP ENSG00000132780 CDS Human protein_coding chr1:46073489 chr1:46073489 synonymous SNV . 0 21 hm6Am_associated_SNPs_1683 0 27863252 Hemoglobin concentration 3e-13 GWAS_Catalog TagSNP rs2230657 GCST004615 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
10 chr1 55523855 55523855 1 + G A rs28362263 55523855 + 55523835 55523875 41 TGACCCCCAACCTGGTGGCCGCCCTGCCCCCCAGCACCCAT TGACCCCCAACCTGGTGGCCACCCTGCCCCCCAGCACCCAT Direct Gain 0 0.90591824054718 Functional Gain 0.90591824054718 PCSK9 ENSG00000169174 CDS Human protein_coding chr1:55523855 chr1:55523855 nonsynonymous SNV 0.057 0 21 hm6Am_associated_SNPs_1815 4 29507422 Low density lipoprotein cholesterol levels 5e-08 GWAS_Catalog TagSNP rs28362263 GCST007141 A large electronic-health-record-based genome-wide study of serum lipids.
11 chr1 55529215 55529215 1 + C A rs28362286 55529215 + 55529195 55529235 41 ACAGCCGTTGCCATCTGCTGCCGGAGCCGGCACCTGGCGCA ACAGCCGTTGCCATCTGCTGACGGAGCCGGCACCTGGCGCA Direct Gain 0 0.855833530426025 Functional Gain 0.855833530426025 PCSK9 ENSG00000169174 CDS Human protein_coding chr1:55529215 chr1:55529215 stopgain 0.974 1 21 hm6Am_associated_SNPs_1816 1 31217584 Low density lipoprotein cholesterol levels 3e-42 GWAS_Catalog TagSNP rs28362286 GCST008037 Genetic analyses of diverse populations improves discovery for complex traits.
12 chr1 86900372 86900372 1 + C A rs17409304 86900372 + 86900352 86900392 41 CTCCCACATTCTCGCTTGTACAGGCTGGTGACAAAGTGGTC CTCCCACATTCTCGCTTGTAAAGGCTGGTGACAAAGTGGTC Direct Gain 0 0.574546635150909 Functional Gain 0.574546635150909 CLCA2 ENSG00000137975 CDS Human protein_coding chr1:86900372 chr1:86900372 nonsynonymous SNV 0.682 1 21 hm6Am_associated_SNPs_1938 0 17554300 Multiple complex diseases 0.000508882 Johnson and O'Donnell TagSNP rs17409304 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
13 chr1 107599918 107599918 1 + C A rs2232016 107599918 + 107599898 107599938 41 CTCCGCCGAGCTCTTCATAGCCCCCATCAGCGACCAGATGC CTCCGCCGAGCTCTTCATAGACCCCATCAGCGACCAGATGC Direct Gain 0 0.823664665222168 Functional Gain 0.823664665222168 PRMT6 ENSG00000198890 CDS Human protein_coding chr1:107599918 chr1:107599918 nonsynonymous SNV 0.956 4 21 hm6Am_associated_SNPs_2018 0 30595370 Red cell distribution width 2e-10 GWAS_Catalog TagSNP rs2232016 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
14 chr1 110086451 110086451 1 + G A rs17575798 110086451 + 110086431 110086471 41 TCCACGATGGTCACCAGCTCGGGGGCCCCCCAGACCACCCC TCCACGATGGTCACCAGCTCAGGGGCCCCCCAGACCACCCC Direct Gain 0 0.592894554138184 Functional Gain 0.592894554138184 GPR61 ENSG00000156097 CDS Human protein_coding chr1:110086451 chr1:110086451 synonymous SNV . 0 21 hm6Am_associated_SNPs_2071 0 30595370 Morning person 4e-12 GWAS_Catalog TagSNP rs17575798 GCST007083 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
15 chr1 114449662 114449662 1 + T A rs3761936 114449662 + 114449642 114449682 41 CTGGAGGTTGGTGAGAGCCATGTATTACCCCTAGATGAAAT CTGGAGGTTGGTGAGAGCCAAGTATTACCCCTAGATGAAAT Direct Gain 0 0.699343264102936 Functional Gain 0.699343264102936 DCLRE1B ENSG00000118655 CDS Human protein_coding chr1:114449662 chr1:114449662 nonsynonymous SNV 0.994 4 21 hm6Am_associated_SNPs_2167 0 17159887 Rheumatoid Arthritis 0.001 Johnson and O'Donnell TagSNP rs3761936 . Genomic DNA pooling for whole-genome association scans in complex disease: empirical demonstration of efficacy in rheumatoid arthritis.
16 chr1 152487917 152487917 1 + G A rs73004856 152487917 + 152487897 152487937 41 TTTCCAAGGGGTCGTCCCAGGGCCCCGCTCCGTGTCCCGCC TTTCCAAGGGGTCGTCCCAGAGCCCCGCTCCGTGTCCCGCC Direct Gain 0 0.921986639499664 Functional Gain 0.921986639499664 CRCT1 ENSG00000169509 CDS Human protein_coding chr1:152487917 chr1:152487917 nonsynonymous SNV 0.750 0 21 hm6Am_associated_SNPs_2383 0 23251661 Obesity-related traits 3e-06 GWAS_Catalog TagSNP rs73004856 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
17 chr1 154293675 154293675 1 + G A rs6668968 154293675 + 154293655 154293695 41 TGAAATCATGGGCCACCTCCGGATACGCAGCCTCCTGGCCC TGAAATCATGGGCCACCTCCAGATACGCAGCCTCCTGGCCC Direct Gain 0 0.520991623401642 Functional Gain 0.520991623401642 AQP10 ENSG00000143595 CDS Human protein_coding chr1:154293675 chr1:154293675 nonsynonymous SNV 0.040 1 21 hm6Am_associated_SNPs_2449 0 30595370 Red cell distribution width 1e-13 GWAS_Catalog TagSNP rs6668968 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
18 chr1 155033308 155033308 1 + G A rs11589479 155033308 + 155033288 155033328 41 CTGCTGGCACGAGGCACTAAGGTGAGTCCTGGATGCCAGAG CTGCTGGCACGAGGCACTAAAGTGAGTCCTGGATGCCAGAG Direct Gain 0 0.942608833312988 Functional Gain 0.942608833312988 ADAM15 ENSG00000143537 CDS Human protein_coding chr1:155033308 chr1:155033308 synonymous SNV . 0 21 hm6Am_associated_SNPs_2498 0 27182965 Chin dimples 5e-11 GWAS_Catalog TagSNP rs11589479 GCST003989 Detection and interpretation of shared genetic influences on 42 human traits.
19 chr1 155155731 155155731 1 + G A rs4971100 155155731 + 155155711 155155751 41 ACTAATGCTTTGCATCCTAAGCCTTCTCCCCAGCACTCTAT ACTAATGCTTTGCATCCTAAACCTTCTCCCCAGCACTCTAT Direct Gain 0 0.573150813579559 Functional Gain 0.573150813579559 TRIM46 ENSG00000163462;ENSG00000273088 intronic Human other chr1:155155731 chr1:155155731 . . 0 21 hm6Am_associated_SNPs_2513 0 25886283 Magnesium levels 1e-07 GWAS_Catalog TagSNP rs4971100 GCST002860 Genome-wide association study of serum minerals levels in children of different ethnic background.
20 chr1 156255456 156255456 1 + G A rs6684514 156255456 + 156255436 156255476 41 AGCCCCAAGAAGACCTTATCGTGCGCTGTGAGGCAGGCGAG AGCCCCAAGAAGACCTTATCATGCGCTGTGAGGCAGGCGAG Direct Gain 0 0.675821185112 Functional Gain 0.675821185112 TMEM79 ENSG00000163472 CDS Human protein_coding chr1:156255456 chr1:156255456 nonsynonymous SNV 0.000 0 21 hm6Am_associated_SNPs_2570 0 20139978 Mean corpuscular hemoglobin concentration 3e-09 GWAS_Catalog TagSNP rs6684514 GCST000582 Genome-wide association study of hematological and biochemical traits in a Japanese population.
21 chr1 156626796 156626796 1 + G A rs41267397 156626796 + 156626776 156626816 41 CTACAAGCACTTTTCCACACGAAGGAGCTGGGAGGAGGCAG CTACAAGCACTTTTCCACACAAAGGAGCTGGGAGGAGGCAG Direct Gain 0 0.949667751789093 Functional Gain 0.949667751789093 BCAN ENSG00000132692 CDS Human protein_coding chr1:156626796 chr1:156626796 nonsynonymous SNV 0.982 4 21 hm6Am_associated_SNPs_2588 0 29875488 Blood protein levels 2e-26 GWAS_Catalog TagSNP rs41267397 GCST005806 Genomic atlas of the human plasma proteome.
22 chr1 159175527 159175527 1 + G A rs13962 159175527 + 159175507 159175547 41 GCCCTGGCTGGCCTGTCCTGGCACAGCTGGCTGTGGGCAGT GCCCTGGCTGGCCTGTCCTGACACAGCTGGCTGTGGGCAGT Direct Gain 0 0.882162749767303 Functional Gain 0.882162749767303 ACKR1 ENSG00000213088 CDS Human protein_coding chr1:159175527 chr1:159175527 nonsynonymous SNV 0.100 1 21 hm6Am_associated_SNPs_2634 0 22075330 IgE levels 2e-11 GWAS_Catalog TagSNP rs13962 GCST001316 A genome-wide association study of plasma total IgE concentrations in the Framingham Heart Study.
23 chr1 161641384 161641384 1 + G A rs6665610 161641384 + 161641364 161641404 41 AATGACAGCGGGGAGTACACGTGCCAGACTGGCCAGACCAG AATGACAGCGGGGAGTACACATGCCAGACTGGCCAGACCAG Direct Gain 0 0.529106497764587 Functional Gain 0.529106497764587 FCGR2B ENSG00000072694 CDS Human protein_coding chr1:161641384 chr1:161641384 synonymous SNV . 0 21 hm6Am_associated_SNPs_2719 0 28240269 Blood protein levels 4e-160 GWAS_Catalog TagSNP rs6665610 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
24 chr1 161642985 161642985 1 + G A rs182968886 161642985 + 161642965 161643005 41 GGAAACATAGGCTACACGCTGTACTCATCCAAGCCTGTGAC GGAAACATAGGCTACACGCTATACTCATCCAAGCCTGTGAC Direct Gain 0 0.931326150894165 Functional Gain 0.931326150894165 FCGR2B ENSG00000072694 CDS Human protein_coding chr1:161642985 chr1:161642985 synonymous SNV . 0 21 hm6Am_associated_SNPs_2720 0 27863252 Monocyte percentage of white cells 7e-11 GWAS_Catalog TagSNP rs182968886 GCST004609 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
25 chr1 162737080 162737080 1 + C A rs143928882 162737080 + 162737060 162737100 41 ATTGGCTGCTTGGTGGCCATCATCTTTATCCTCCTGGCCAT ATTGGCTGCTTGGTGGCCATAATCTTTATCCTCCTGGCCAT Direct Gain 0 0.698647856712341 Functional Gain 0.698647856712341 DDR2 ENSG00000162733 CDS Human protein_coding chr1:162737080 chr1:162737080 synonymous SNV . 0 21 hm6Am_associated_SNPs_2748 0 28090653 Alanine aminotransferase (ALT) levels after remission induction therapy in actute lymphoblastic leukemia (ALL) 2e-06 GWAS_Catalog TagSNP rs143928882 GCST004250 Genome-Wide Study Links PNPLA3 Variant With Elevated Hepatic Transaminase After Acute Lymphoblastic Leukemia Therapy.
26 chr1 164529120 164529120 1 + G A rs2275558 164529120 + 164529100 164529140 41 TCGGGATGGCCGGACACCCCGGCCTGTCCCAGCACTTGCAG TCGGGATGGCCGGACACCCCAGCCTGTCCCAGCACTTGCAG Direct Gain 0 0.934224367141724 Functional Gain 0.934224367141724 PBX1 ENSG00000185630 CDS Human protein_coding chr1:164529120 chr1:164529120 nonsynonymous SNV 1.000 1 21 hm6Am_associated_SNPs_2754 0 30595370 Red blood cell count 4e-10 GWAS_Catalog TagSNP rs2275558 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
27 chr1 170521376 170521376 1 + G A rs913257 170521376 + 170521356 170521396 41 AGGTCGAGAGATTGCTACACGAACAAGAAGTAGAATCAAGG AGGTCGAGAGATTGCTACACAAACAAGAAGTAGAATCAAGG Direct Gain 0 0.875361680984497 Functional Gain 0.875361680984497 GORAB ENSG00000120370 CDS Human protein_coding chr1:170521376 chr1:170521376 nonsynonymous SNV 0.171 1 21 hm6Am_associated_SNPs_2801 2 30598549 Heel bone mineral density 1e-10 GWAS_Catalog TagSNP rs913257 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
28 chr1 183155482 183155482 1 + C A rs684527 183155482 + 183155462 183155502 41 CAGAGACTGAGCGGCCCGGCCCCGCCATGCCTGCGCTCTGG CAGAGACTGAGCGGCCCGGCACCGCCATGCCTGCGCTCTGG Direct Gain 0 0.973893463611603 Functional Gain 0.973893463611603 LAMC2 ENSG00000058085 UTR5 Human protein_coding chr1:183155482 chr1:183155482 . . 0 21 hm6Am_associated_SNPs_2926 1 30048462 Heel bone mineral density 2e-11 GWAS_Catalog TagSNP rs684527 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
29 chr1 184020945 184020945 1 + G A rs2274432 184020945 + 184020925 184020965 41 CTGCAGCGGCCTGGGTCCGGGCGGTGTTCGCGGCTTTGGCG CTGCAGCGGCCTGGGTCCGGACGGTGTTCGCGGCTTTGGCG Direct Gain 0 0.983938097953796 Functional Gain 0.983938097953796 TSEN15 ENSG00000198860 CDS Human protein_coding chr1:184020945 chr1:184020945 nonsynonymous SNV 0.094 0 21 hm6Am_associated_SNPs_2935 0 18391951 Height 8e-09 GWAS_Catalog TagSNP rs2274432 GCST000175 Many sequence variants affecting diversity of adult human height.
30 chr1 204989911 204989911 1 + C A rs3795559 204989911 + 204989891 204989931 41 TCCGTCGGCTGGGGCTAGTGCCAGAGAATCCCTTCTCAGTG TCCGTCGGCTGGGGCTAGTGACAGAGAATCCCTTCTCAGTG Direct Gain 0 0.98321259021759 Functional Gain 0.98321259021759 NFASC ENSG00000163531 UTR3 Human protein_coding chr1:204989911 chr1:204989911 . . 0 21 hm6Am_associated_SNPs_3129 0 28240269 Blood protein levels 8e-13 GWAS_Catalog TagSNP rs3795559 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
31 chr1 214161820 214161820 1 + G A rs340839 214161820 + 214161800 214161840 41 GCTCGGTCCCACTGCTCCCTGCACCGCGTAAGTATCTTCTT GCTCGGTCCCACTGCTCCCTACACCGCGTAAGTATCTTCTT Direct Gain 0 0.608558595180511 Functional Gain 0.608558595180511 PROX1 ENSG00000117707 UTR5 Human protein_coding chr1:214161820 chr1:214161820 . . 0 21 hm6Am_associated_SNPs_3266 0 25961943 Triglycerides 4e-10 GWAS_Catalog TagSNP rs340839 GCST002897 The impact of low-frequency and rare variants on lipid levels.
32 chr1 221057662 221057662 1 + G A rs3738182 221057662 + 221057642 221057682 41 GCCCCGGCTGCGGATGGCGAGCAGGACGAGAGGAGCCCCAG GCCCCGGCTGCGGATGGCGAACAGGACGAGAGGAGCCCCAG Direct Gain 0 0.684059858322144 Functional Gain 0.684059858322144 HLX ENSG00000136630 CDS Human protein_coding chr1:221057662 chr1:221057662 synonymous SNV . 0 21 hm6Am_associated_SNPs_3299 0 30595370 White blood cell count 4e-08 GWAS_Catalog TagSNP rs3738182 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
33 chr1 236229347 236229347 1 + C A rs12093542 236229347 + 236229327 236229367 41 GAATAATCGGTTGATCGTTACTTTGGCACTAGGGTGAAAGT GAATAATCGGTTGATCGTTAATTTGGCACTAGGGTGAAAGT Direct Gain 0 0.846016883850098 Functional Gain 0.846016883850098 NID1 ENSG00000116962 upstream Human protein_coding chr1:236229347 chr1:236229347 . . 0 21 hm6Am_associated_SNPs_3646 0 17554300 Multiple complex diseases 2.73729e-06 Johnson and O'Donnell TagSNP rs12093542 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
34 chr1 246829616 246829616 1 + T A rs4130648 246829616 + 246829596 246829636 41 CCGCCATCACGCAATAAGTTTGTGTGTAATCAGAAGGAGTT CCGCCATCACGCAATAAGTTAGTGTGTAATCAGAAGGAGTT Direct Gain 0 0.508193373680115 Functional Gain 0.508193373680115 CNST ENSG00000162852 UTR3 Human protein_coding chr1:246829616 chr1:246829616 . . 0 21 hm6Am_associated_SNPs_3755 0 17463246 Multiple continuous traits in DGI samples 0.0002453 Johnson and O'Donnell TagSNP rs4130648 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
35 chr2 3392075 3392075 1 + T A rs10865541 3392075 + 3392055 3392095 41 TCGGACTTCTTCGACTCCTTTACTACCTCCGCCTTCATTTC TCGGACTTCTTCGACTCCTTAACTACCTCCGCCTTCATTTC Direct Gain 0 0.936590313911438 Functional Gain 0.936590313911438 TRAPPC12 ENSG00000171853 CDS Human protein_coding chr2:3392075 chr2:3392075 nonsynonymous SNV 0.794 4 21 hm6Am_associated_SNPs_3849 0 23251661 Obesity-related traits 6e-06 GWAS_Catalog TagSNP rs10865541 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
36 chr2 11738091 11738091 1 + T A rs1435547 11738091 + 11738071 11738111 41 TACCAGCAGACTCTGCTCCATGTGTGGCATTCAGGTATGGG TACCAGCAGACTCTGCTCCAAGTGTGGCATTCAGGTATGGG Direct Gain 0 0.873638987541199 Functional Gain 0.873638987541199 GREB1 ENSG00000196208 CDS Human protein_coding chr2:11738091 chr2:11738091 nonsynonymous SNV 0.785 2 21 hm6Am_associated_SNPs_3934 0 25918132 Diisocyanate-induced asthma 1e-06 GWAS_Catalog TagSNP rs1435547 GCST002875 Genome-Wide Association Study Identifies Novel Loci Associated With Diisocyanate-Induced Occupational Asthma.
37 chr2 26799031 26799031 1 + G A rs2272464 26799031 + 26799011 26799051 41 CATCGCTCCACAGAGCTTACGAATTTCTACCAGGTAAGCTG CATCGCTCCACAGAGCTTACAAATTTCTACCAGGTAAGCTG Direct Gain 0 0.72178065776825 Functional Gain 0.72178065776825 C2orf70 ENSG00000173557 CDS Human protein_coding chr2:26799031 chr2:26799031 nonsynonymous SNV 0.000 0 21 hm6Am_associated_SNPs_4026 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0008728 Johnson and O'Donnell TagSNP rs2272464 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
38 chr2 27315252 27315252 1 + G A rs2304681 27315252 + 27315232 27315272 41 ACGCGTCCAACTCCTGCACCGTTCTCTCCCTGCTCGGAGCC ACGCGTCCAACTCCTGCACCATTCTCTCCCTGCTCGGAGCC Direct Gain 0 0.966538906097412 Functional Gain 0.966538906097412 KHK ENSG00000138030 CDS Human protein_coding chr2:27315252 chr2:27315252 nonsynonymous SNV 0.668 0 21 hm6Am_associated_SNPs_4076 1 30181555 Self-reported risk-taking behaviour 1e-07 GWAS_Catalog TagSNP rs2304681 GCST006461 Genetics of self-reported risk-taking behaviour, trans-ethnic consistency and relevance to brain gene expression.
39 chr2 27844601 27844601 1 + T A rs1881396 27844601 + 27844581 27844621 41 CAAGGCCAACTATAGGCTCCTCTTGCCCTGTACAAAACTAA CAAGGCCAACTATAGGCTCCACTTGCCCTGTACAAAACTAA Direct Gain 0 0.692533373832703 Functional Gain 0.692533373832703 ZNF512 ENSG00000259080 ncRNA_intronic Human processed_transcript chr2:27844601 chr2:27844601 . . 0 21 hm6Am_associated_SNPs_4118 0 29385134 Nonalcoholic fatty liver disease 1e-06 GWAS_Catalog TagSNP rs1881396 GCST005308 Risk estimation model for nonalcoholic fatty liver disease in the Japanese using multiple genetic markers.
40 chr2 27851918 27851918 1 + G A rs3749147 27851918 + 27851898 27851938 41 TGGTCGGGTGGGTGGGGCCAGGAGGAAGATGGCGGCGTCCG TGGTCGGGTGGGTGGGGCCAAGAGGAAGATGGCGGCGTCCG Direct Gain 0 0.859756588935852 Functional Gain 0.859756588935852 GPN1 ENSG00000198522 CDS Human protein_coding chr2:27851918 chr2:27851918 nonsynonymous SNV 0.021 0 21 hm6Am_associated_SNPs_4119 0 21386085 Waist Circumference - Triglycerides (WC-TG) 1e-09 GWAS_Catalog TagSNP rs3749147 GCST001006 A bivariate genome-wide approach to metabolic syndrome: STAMPEED consortium.
41 chr2 44066247 44066247 1 + G A rs11887534 44066247 + 44066227 44066267 41 CGAAAGGGGCCACTCCCCAGGATACCTCGGTGAGTGAGCAA CGAAAGGGGCCACTCCCCAGAATACCTCGGTGAGTGAGCAA Direct Gain 0 0.946205258369446 Functional Gain 0.946205258369446 ABCG8 ENSG00000143921 CDS Human protein_coding chr2:44066247 chr2:44066247 nonsynonymous SNV 0.045 1 21 hm6Am_associated_SNPs_4226 0 27286809 C-reactive protein levels or LDL-cholesterol levels (pleiotropy) 9e-33 GWAS_Catalog TagSNP rs11887534 GCST003679 Bivariate genome-wide association study identifies novel pleiotropic loci for lipids and inflammation.
42 chr2 162101261 162101261 1 + G A rs11678980 162101261 + 162101241 162101281 41 CTCCCCTCCAGAGTGCCCCGGCGTCTTTCTAGCCTCCGCCT CTCCCCTCCAGAGTGCCCCGACGTCTTTCTAGCCTCCGCCT Direct Gain 0 0.897562503814697 Functional Gain 0.897562503814697 LINC01806 ENSG00000227403 ncRNA_exonic Human lincRNA chr2:162101261 chr2:162101261 . . 0 21 hm6Am_associated_SNPs_5089 0 30038396 Cognitive performance 1e-10 GWAS_Catalog TagSNP rs11678980 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
43 chr2 162280748 162280748 1 + G A rs890076 162280748 + 162280728 162280768 41 CGCACAGCTAGGCCGCCCCTGCCCGCCCGGCCCCGCCGCGG CGCACAGCTAGGCCGCCCCTACCCGCCCGGCCCCGCCGCGG Direct Gain 0 0.985412836074829 Functional Gain 0.985412836074829 TBR1 ENSG00000251621 ncRNA_exonic Human 3prime_overlapping_ncRNA chr2:162280748 chr2:162280748 . . 0 21 hm6Am_associated_SNPs_5092 0 30038396 Highest math class taken (MTAG) 2e-08 GWAS_Catalog TagSNP rs890076 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
44 chr2 190649316 190649316 1 + G A rs5742933 190649316 + 190649296 190649336 41 TGCCTGCCTCGCGCTAGCAGGAAGGTAGTGTGGTGTGACTA TGCCTGCCTCGCGCTAGCAGAAAGGTAGTGTGGTGTGACTA Direct Gain 0 0.891704797744751 Functional Gain 0.891704797744751 PMS1 ENSG00000064933 UTR5 Human protein_coding chr2:190649316 chr2:190649316 . . 0 21 hm6Am_associated_SNPs_5263 0 25162662 Ferritin levels 2e-10 GWAS_Catalog TagSNP rs5742933 GCST002578 Genome-wide association study identifies variants in PMS1 associated with serum ferritin in a Chinese population.
45 chr2 202082459 202082459 1 + T A rs13006529 202082459 + 202082439 202082479 41 TGCCCCTGGATGCACTTTCATTATAGCAGAGAGTTTTTGTT TGCCCCTGGATGCACTTTCAATATAGCAGAGAGTTTTTGTT Direct Gain 0 0.522040486335754 Functional Gain 0.522040486335754 CASP10 ENSG00000003400 CDS Human protein_coding chr2:202082459 chr2:202082459 nonsynonymous SNV 0.000 0 21 hm6Am_associated_SNPs_5322 2 30595370 Mean corpuscular hemoglobin 1e-09 GWAS_Catalog TagSNP rs13006529 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
46 chr2 218999982 218999982 1 + G A rs55799208 218999982 + 218999962 219000002 41 GGCCATTGTCCATGCCACACGCACACTGACCCAGAAGCGCT GGCCATTGTCCATGCCACACACACACTGACCCAGAAGCGCT Direct Gain 0 0.64426851272583 Functional Gain 0.64426851272583 CXCR2 ENSG00000180871 CDS Human protein_coding chr2:218999982 chr2:218999982 nonsynonymous SNV 0.369 0 21 hm6Am_associated_SNPs_5407 0 27863252 Neutrophil percentage of white cells 3e-25 GWAS_Catalog TagSNP rs55799208 GCST004633 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
47 chr2 219755011 219755011 1 + T A rs121908120 219755011 + 219754991 219755031 41 GGGAGCGCTTTTCTAAGGACTTTCTGGACTCCCGGGAGCCT GGGAGCGCTTTTCTAAGGACATTCTGGACTCCCGGGAGCCT Direct Gain 0 0.934176921844482 Functional Gain 0.934176921844482 WNT10A ENSG00000135925 CDS Human protein_coding chr2:219755011 chr2:219755011 nonsynonymous SNV 0.999 5 21 hm6Am_associated_SNPs_5475 6 29364747 Tooth agenesis 2e-40 GWAS_Catalog TagSNP rs121908120 GCST005389 Rare and Common Variants Conferring Risk of Tooth Agenesis.
48 chr2 234113301 234113301 1 + C A rs9247 234113301 + 234113281 234113321 41 GCGACAACACCGAGCTCCCGCATCACGGCAAGCACCGGCCG GCGACAACACCGAGCTCCCGAATCACGGCAAGCACCGGCCG Direct Gain 0 0.800577640533447 Functional Gain 0.800577640533447 INPP5D ENSG00000168918 CDS Human protein_coding chr2:234113301 chr2:234113301 nonsynonymous SNV 0.126 4 21 hm6Am_associated_SNPs_5727 0 30595370 Eczema 1e-14 GWAS_Catalog TagSNP rs9247 GCST007075 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
49 chr2 234184417 234184417 1 + G A rs3792109 234184417 + 234184397 234184437 41 CTGATTGCACTGAATGTCACGGTCCCTTTGTTGCCCTCAAC CTGATTGCACTGAATGTCACAGTCCCTTTGTTGCCCTCAAC Direct Gain 0 0.902478337287903 Functional Gain 0.902478337287903 SCARNA5 ENSG00000252010 ncRNA_exonic Human scaRNA chr2:234184417 chr2:234184417 . . 0 21 hm6Am_associated_SNPs_5733 0 21102463 Crohn's disease 7e-41 GWAS_Catalog TagSNP rs3792109 GCST000879 Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci.
50 chr2 234627608 234627608 1 + T A rs2011425 234627608 + 234627588 234627628 41 GGCTCAGCATGCGGGAGGCCTTGCGGGAGCTCCATGCCAGA GGCTCAGCATGCGGGAGGCCATGCGGGAGCTCCATGCCAGA Direct Gain 0 0.858918607234955 Functional Gain 0.858918607234955 UGT1A4 ENSG00000244474 CDS Human protein_coding chr2:234627608 chr2:234627608 nonsynonymous SNV 0.012 1 21 hm6Am_associated_SNPs_5752 0 30922102 Plasma norclozapine levels in treatment-resistant schizophrenia 8e-09 GWAS_Catalog TagSNP rs2011425 GCST007686 Pharmacogenomic Variants and Drug Interactions Identified Through the Genetic Analysis of Clozapine Metabolism.
51 chr2 234740136 234740136 1 + G A rs879665 234740136 + 234740116 234740156 41 CCTCAGGGCCAAGTGATACCGCTACTGATGACAAGATGACC CCTCAGGGCCAAGTGATACCACTACTGATGACAAGATGACC Direct Gain 0 0.746991157531738 Functional Gain 0.746991157531738 MROH2A ENSG00000185038 CDS Human protein_coding chr2:234740136 chr2:234740136 nonsynonymous SNV 0.001 0 21 hm6Am_associated_SNPs_5759 0 29251981 Inhibitory control 5e-07 GWAS_Catalog TagSNP rs879665 GCST005246 Hierarchical investigation of genetic influences on response inhibition in healthy young adults.
52 chr2 238990388 238990388 1 + G A rs3210400 238990388 + 238990368 238990408 41 TGTCCAAGGTGAGCGGGCAGGCAGAGGTGGACGACATCCTC TGTCCAAGGTGAGCGGGCAGACAGAGGTGGACGACATCCTC Direct Gain 0 0.980991125106812 Functional Gain 0.980991125106812 SCLY ENSG00000132330 CDS Human protein_coding chr2:238990388 chr2:238990388 nonsynonymous SNV 0.038 0 21 hm6Am_associated_SNPs_5823 0 30038396 Highest math class taken 1e-12 GWAS_Catalog TagSNP rs3210400 GCST006574 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
53 chr3 21447336 21447336 1 + G A rs409974 21447336 + 21447316 21447356 41 GGGTCGACCCACACCCCCAGGCCTGCCGACGTCTCCCCCGG GGGTCGACCCACACCCCCAGACCTGCCGACGTCTCCCCCGG Direct Gain 0 0.91631007194519 Functional Gain 0.91631007194519 VENTXP7 ENSG00000236380 ncRNA_exonic Human processed_pseudogene chr3:21447336 chr3:21447336 . . 0 21 hm6Am_associated_SNPs_6238 0 24324551 QRS duration in Tripanosoma cruzi seropositivity 9e-06 GWAS_Catalog TagSNP rs409974 GCST002284 Genome wide association study (GWAS) of Chagas cardiomyopathy in Trypanosoma cruzi seropositive subjects.
54 chr3 111732608 111732608 1 + G A rs8070 111732608 + 111732588 111732628 41 TATGCAAAGACTCCGCTTCCGTTTTCCTGAGCTCCTCGGGC TATGCAAAGACTCCGCTTCCATTTTCCTGAGCTCCTCGGGC Direct Gain 0 0.512271583080292 Functional Gain 0.512271583080292 TAGLN3 ENSG00000144834 UTR3 Human protein_coding chr3:111732608 chr3:111732608 . . 0 21 hm6Am_associated_SNPs_6823 0 17463246 Multiple continuous traits in DGI samples 0.0004057 Johnson and O'Donnell TagSNP rs8070 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
55 chr3 122003045 122003045 1 + G A rs2036400 122003045 + 122003025 122003065 41 TGGCTCTACACCGCGCCCCCGTCAAGCTACCGCAACCAGGA TGGCTCTACACCGCGCCCCCATCAAGCTACCGCAACCAGGA Direct Gain 0 0.803520977497101 Functional Gain 0.803520977497101 CASR ENSG00000036828 CDS Human protein_coding chr3:122003045 chr3:122003045 synonymous SNV . 0 21 hm6Am_associated_SNPs_6883 0 17554300 Multiple complex diseases 6.42429e-05 Johnson and O'Donnell TagSNP rs2036400 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
56 chr3 126261202 126261202 1 + G A rs1056524 126261202 + 126261182 126261222 41 GTCGTGGGCAAGTTCGAGACGCTGGCGGAGGACGCGGCCTT GTCGTGGGCAAGTTCGAGACACTGGCGGAGGACGCGGCCTT Direct Gain 0 0.979342997074127 Functional Gain 0.979342997074127 CHST13 ENSG00000180767 CDS Human protein_coding chr3:126261202 chr3:126261202 synonymous SNV 0.284 0 21 hm6Am_associated_SNPs_6927 0 29875488 Blood protein levels 8e-26 GWAS_Catalog TagSNP rs1056524 GCST005806 Genomic atlas of the human plasma proteome.
57 chr3 141115219 141115219 1 + T A rs1582874 141115219 + 141115199 141115239 41 AAGATTGCAGAAATTCAGTCTCATCTTTAGGCTCCACTTCT AAGATTGCAGAAATTCAGTCACATCTTTAGGCTCCACTTCT Direct Gain 0 0.877146065235138 Functional Gain 0.877146065235138 ZBTB38 ENSG00000177311 UTR5 Human protein_coding chr3:141115219 chr3:141115219 . . 0 21 hm6Am_associated_SNPs_7156 0 30038396 Highest math class taken (MTAG) 7e-10 GWAS_Catalog TagSNP rs1582874 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
58 chr3 150128392 150128392 1 + G A rs879634 150128392 + 150128372 150128412 41 CCGTGGGCACCGGCCAGAATGCTTCCTCGGTGGGCGCGCAG CCGTGGGCACCGGCCAGAATACTTCCTCGGTGGGCGCGCAG Direct Gain 0 0.915769696235657 Functional Gain 0.915769696235657 TSC22D2 ENSG00000196428 CDS Human protein_coding chr3:150128392 chr3:150128392 nonsynonymous SNV 0.001 0 21 hm6Am_associated_SNPs_7201 0 27618447 Systolic blood pressure 8e-06 GWAS_Catalog TagSNP rs879634 GCST006021 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
59 chr3 186395436 186395436 1 + C A rs1042445 186395436 + 186395416 186395456 41 GAGGCCCAGGTAAAGGACCCCGTCCCTTCCATTGCAGACAA GAGGCCCAGGTAAAGGACCCAGTCCCTTCCATTGCAGACAA Direct Gain 0 0.501083374023438 Functional Gain 0.501083374023438 HRG ENSG00000113905 CDS Human protein_coding chr3:186395436 chr3:186395436 nonsynonymous SNV 0.001 0 21 hm6Am_associated_SNPs_7395 0 28240269 Blood protein levels 8e-78 GWAS_Catalog TagSNP rs1042445 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
60 chr4 996165 996165 1 + G A rs6831280 996165 + 996145 996185 41 GCTACCACCCGCACCCCTTCGCGCAGCGCACGCTCACCGCG GCTACCACCCGCACCCCTTCACGCAGCGCACGCTCACCGCG Direct Gain 0 0.958800196647644 Functional Gain 0.958800196647644 IDUA ENSG00000127415 CDS Human protein_coding chr4:996165 chr4:996165 nonsynonymous SNV 0.019 1 21 hm6Am_associated_SNPs_7592 2 29304378 Total body bone mineral density 8e-19 GWAS_Catalog TagSNP rs6831280 GCST005348 Life-Course Genome-wide Association Study Meta-analysis of Total Body BMD and Assessment of Age-Specific Effects.
61 chr4 3449652 3449652 1 + G A rs16844401 3449652 + 3449632 3449672 41 GCTGAAGAAGAAAGGGGACCGCTGTGCCACACGCTCGCAGT GCTGAAGAAGAAAGGGGACCACTGTGCCACACGCTCGCAGT Direct Gain 0 0.796936869621277 Functional Gain 0.796936869621277 HGFAC ENSG00000109758 CDS Human protein_coding chr4:3449652 chr4:3449652 nonsynonymous SNV 0.996 2 21 hm6Am_associated_SNPs_7874 0 23969696 Fibrinogen 2e-08 GWAS_Catalog TagSNP rs16844401 GCST002147 Multiethnic meta-analysis of genome-wide association studies in >100 000 subjects identifies 23 fibrinogen-associated Loci but no strong evidence of a causal association between circulating fibrinogen and cardiovascular disease.
62 chr4 3451109 3451109 1 + G A rs2498323 3451109 + 3451089 3451129 41 TGTGGACTGGATCAACGACCGGATACGGCCTCCCAGGCGGC TGTGGACTGGATCAACGACCAGATACGGCCTCCCAGGCGGC Direct Gain 0 0.803086996078491 Functional Gain 0.803086996078491 HGFAC ENSG00000109758 CDS Human protein_coding chr4:3451109 chr4:3451109 nonsynonymous SNV 0.371 1 21 hm6Am_associated_SNPs_7877 0 30578418 Pulse pressure 4e-16 GWAS_Catalog TagSNP rs2498323 GCST007269 Trans-ethnic association study of blood pressure determinants in over 750,000 individuals.
63 chr4 6303022 6303022 1 + C A rs1801214 6303022 + 6303002 6303042 41 GGCCACCTGGTCGTCCTCAACGTCAGCGTCCCGTGCCTGCT GGCCACCTGGTCGTCCTCAAAGTCAGCGTCCCGTGCCTGCT Direct Gain 0 0.702875256538391 Functional Gain 0.702875256538391 WFS1 ENSG00000109501 CDS Human protein_coding chr4:6303022 chr4:6303022 nonsynonymous SNV 0.009 2 21 hm6Am_associated_SNPs_7965 0 22885922 Type 2 diabetes 3e-12 GWAS_Catalog TagSNP rs1801214 GCST005047 Large-scale association analysis provides insights into the genetic architecture and pathophysiology of type 2 diabetes.
64 chr4 15709192 15709192 1 + G A rs2302465 15709192 + 15709172 15709212 41 CTTTGCAGACAACACCCGTCGTTTTATGCCCCTGAGCGATG CTTTGCAGACAACACCCGTCATTTTATGCCCCTGAGCGATG Direct Gain 0 0.898834526538849 Functional Gain 0.898834526538849 BST1 ENSG00000109743 CDS Human protein_coding chr4:15709192 chr4:15709192 nonsynonymous SNV 0.086 3 21 hm6Am_associated_SNPs_8181 0 28240269 Blood protein levels 1e-108 GWAS_Catalog TagSNP rs2302465 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
65 chr4 39529700 39529700 1 + G A rs3755899 39529700 + 39529680 39529720 41 CCCACAACCTCGAGGCCCCGGGGTCAACCGCGCCCTCCGGG CCCACAACCTCGAGGCCCCGAGGTCAACCGCGCCCTCCGGG Direct Gain 0 0.942351579666138 Functional Gain 0.942351579666138 UGDH-AS1 ENSG00000249348 ncRNA_exonic Human antisense chr4:39529700 chr4:39529700 . . 0 21 hm6Am_associated_SNPs_8258 0 27082954 Peripheral arterial disease (traffic-related air pollution interaction) 2e-08 GWAS_Catalog TagSNP rs3755899 GCST004482 Genetic Variants in the Bone Morphogenic Protein Gene Family Modify the Association between Residential Exposure to Traffic and Peripheral Arterial Disease.
66 chr4 39699701 39699701 1 + G A rs28450192 39699701 + 39699681 39699721 41 GGGCGTATGGGGGCTCCAACGGGAGCGGCTGCGCCGCCCGG GGGCGTATGGGGGCTCCAACAGGAGCGGCTGCGCCGCCCGG Direct Gain 0 0.7981196641922 Functional Gain 0.7981196641922 UBE2K ENSG00000078140 UTR5 Human protein_coding chr4:39699701 chr4:39699701 . . 0 21 hm6Am_associated_SNPs_8260 0 30038396 Educational attainment (years of education) 3e-09 GWAS_Catalog TagSNP rs28450192 GCST006442 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
67 chr4 110757224 110757224 1 + G A rs61747002 110757224 + 110757204 110757244 41 GGAGCCTGGATCAATGGCCTGTTTTGGGCTTTGATGCCTAT GGAGCCTGGATCAATGGCCTATTTTGGGCTTTGATGCCTAT Direct Gain 0 0.949037492275238 Functional Gain 0.949037492275238 RRH ENSG00000180245 CDS Human protein_coding chr4:110757224 chr4:110757224 synonymous SNV . 0 21 hm6Am_associated_SNPs_8561 0 30348214 DNA methylation variation (age effect) 3e-09 GWAS_Catalog TagSNP rs61747002 GCST006660 Genotype effects contribute to variation in longitudinal methylome patterns in older people.
68 chr4 145567471 145567471 1 + T A rs12507427 145567471 + 145567451 145567491 41 GTTACACGGACAAGTGAACATCTGTGGCTGTCCTCTCCTTT GTTACACGGACAAGTGAACAACTGTGGCTGTCCTCTCCTTT Direct Gain 0 0.679041266441345 Functional Gain 0.679041266441345 HHIP ENSG00000248890 ncRNA_intronic Human antisense chr4:145567471 chr4:145567471 . . 0 21 hm6Am_associated_SNPs_8716 0 31053729 Hip bone size 5e-09 GWAS_Catalog TagSNP rs12507427 GCST008281 GWAS of bone size yields twelve loci that also affect height, BMD, osteoarthritis or fractures.
69 chr5 72112421 72112421 1 + T A rs34648 72112421 + 72112401 72112441 41 CCAAGGCGACCGCCGCCGAATGTTCCCGCCGCGGGCTCCGC CCAAGGCGACCGCCGCCGAAAGTTCCCGCCGCGGGCTCCGC Direct Gain 0 0.983161747455597 Functional Gain 0.983161747455597 TNPO1 ENSG00000083312 UTR5 Human protein_coding chr5:72112421 chr5:72112421 . . 0 21 hm6Am_associated_SNPs_9313 0 30595370 White blood cell count 4e-08 GWAS_Catalog TagSNP rs34648 GCST007070 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
70 chr5 173491300 173491300 1 + G A rs17076802 173491300 + 173491280 173491320 41 AAAGGGAAGTTCCGGGTGCCGAAAATCGCTGAATTTACGGT AAAGGGAAGTTCCGGGTGCCAAAAATCGCTGAATTTACGGT Direct Gain 0 0.853667080402374 Functional Gain 0.853667080402374 HMP19 ENSG00000170091 CDS Human protein_coding chr5:173491300 chr5:173491300 synonymous SNV . 0 21 hm6Am_associated_SNPs_10293 0 16252231 Parkinson's disease 0.011171 Johnson and O'Donnell TagSNP rs17076802 . High-resolution whole-genome association study of Parkinson disease.
71 chr5 176520243 176520243 1 + G A rs351855 176520243 + 176520223 176520263 41 CTGTGCTCCTGCTGCTGGCCGGGCTGTATCGAGGGCAGGCG CTGTGCTCCTGCTGCTGGCCAGGCTGTATCGAGGGCAGGCG Direct Gain 0 0.848819196224213 Functional Gain 0.848819196224213 FGFR4 ENSG00000160867 CDS Human protein_coding chr5:176520243 chr5:176520243 nonsynonymous SNV 0.845 2 21 hm6Am_associated_SNPs_10350 1 26785701 Waist-to-hip ratio adjusted for body mass index 2e-06 GWAS_Catalog TagSNP rs351855 GCST003338 Genome-wide association studies in East Asians identify new loci for waist-hip ratio and waist circumference.
72 chr6 7231843 7231843 1 + G A rs9379084 7231843 + 7231823 7231863 41 GCGCCAACAGCGGCGGGGTGGACCTGGACTCCAGCGGGGAG GCGCCAACAGCGGCGGGGTGAACCTGGACTCCAGCGGGGAG Direct Gain 0 0.869606614112854 Functional Gain 0.869606614112854 RREB1 ENSG00000124782 CDS Human protein_coding chr6:7231843 chr6:7231843 nonsynonymous SNV 0.974 4 21 hm6Am_associated_SNPs_10580 0 28869591 Heel bone mineral density 6e-09 GWAS_Catalog TagSNP rs9379084 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
73 chr6 7250960 7250960 1 + G A rs2714338 7250960 + 7250940 7250980 41 TTTTCTCCGCCACTTCACCAGTTTCTGAAATCCAACCTCCC TTTTCTCCGCCACTTCACCAATTTCTGAAATCCAACCTCCC Direct Gain 0 0.781019508838654 Functional Gain 0.781019508838654 RREB1 ENSG00000124782 UTR3 Human protein_coding chr6:7250960 chr6:7250960 . . 0 21 hm6Am_associated_SNPs_10586 0 30595370 Balding type 1 1e-09 GWAS_Catalog TagSNP rs2714338 GCST007038 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
74 chr6 26569135 26569135 1 + T A rs36162392 26569135 + 26569115 26569155 41 GACTGTAGTTGGCTGTGTCCTTAGACATCCTTAGGTCGCTG GACTGTAGTTGGCTGTGTCCATAGACATCCTTAGGTCGCTG Direct Gain 0 0.758924067020416 Functional Gain 0.758924067020416 LOC105374988 ENSG00000182952;ENSG00000146109 intergenic Human other chr6:26569135 chr6:26569135 . . 0 21 hm6Am_associated_SNPs_10788 0 28604730 Lung cancer in ever smokers 6e-07 GWAS_Catalog TagSNP rs36162392 GCST004749 Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
75 chr6 28227604 28227604 1 + C A rs1635 28227604 + 28227584 28227624 41 GCTAGATTCTGACGAACATACCCCAGTTGAGGATGAAGAAG GCTAGATTCTGACGAACATAACCCAGTTGAGGATGAAGAAG Direct Gain 0 0.784817934036255 Functional Gain 0.784817934036255 NKAPL ENSG00000189134 CDS Human protein_coding chr6:28227604 chr6:28227604 nonsynonymous SNV 0.011 0 21 hm6Am_associated_SNPs_10840 0 22037552 Schizophrenia 7e-12 GWAS_Catalog TagSNP rs1635 GCST001299 Genome-wide association study identifies a susceptibility locus for schizophrenia in Han Chinese at 11p11.2.
76 chr6 29364951 29364951 1 + G A rs2073151 29364951 + 29364931 29364971 41 TCCATGCCCTGCTGCACTCCGTAATGACTTCTCGCTTGAAC TCCATGCCCTGCTGCACTCCATAATGACTTCTCGCTTGAAC Direct Gain 0 0.6922248005867 Functional Gain 0.6922248005867 OR12D2 ENSG00000168787 CDS Human other chr6:29364951 chr6:29364951 nonsynonymous SNV 0.000 0 21 hm6Am_associated_SNPs_10865 0 17554300 Multiple complex diseases 1.3e-11 Johnson and O'Donnell TagSNP rs2073151 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
77 chr6 30920890 30920890 1 + G A rs2240804 30920890 + 30920870 30920910 41 GGGCCAGATCCCTTCCCCACGGTGATCTTGGAGTAGGCGCC GGGCCAGATCCCTTCCCCACAGTGATCTTGGAGTAGGCGCC Direct Gain 0 0.510814428329468 Functional Gain 0.510814428329468 DPCR1 ENSG00000168631 CDS Human protein_coding chr6:30920890 chr6:30920890 nonsynonymous SNV 0.309 0 21 hm6Am_associated_SNPs_11042 0 17804836 Rheumatoid Arthritis 4.87e-12 Johnson and O'Donnell TagSNP rs2240804 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
78 chr6 31093482 31093482 1 + G A rs3131003 31093482 + 31093462 31093502 41 AAGGGTGGAATCTACAGTCCGTGAGCCCTGACTTCTTGCCT AAGGGTGGAATCTACAGTCCATGAGCCCTGACTTCTTGCCT Direct Gain 0 0.513787567615509 Functional Gain 0.513787567615509 PSORS1C1 ENSG00000204540 UTR5 Human protein_coding chr6:31093482 chr6:31093482 . . 0 21 hm6Am_associated_SNPs_11049 0 17641165 HIV-1 disease progression 1.38e-05 Johnson and O'Donnell TagSNP rs3131003 . A whole-genome association study of major determinants for host control of HIV-1.
79 chr6 31093587 31093587 1 + G A rs3815087 31093587 + 31093567 31093607 41 GAAACCATCACCCCCGGACCGTGGGCTCCATGCCAGTGGGC GAAACCATCACCCCCGGACCATGGGCTCCATGCCAGTGGGC Direct Gain 0 0.554728507995605 Functional Gain 0.554728507995605 PSORS1C1 ENSG00000204540 UTR5 Human protein_coding chr6:31093587 chr6:31093587 . . 0 21 hm6Am_associated_SNPs_11050 0 21801394 Drug-induced Stevens-Johnson syndrome or toxic epidermal necrolysis (SJS/TEN) 3e-07 GWAS_Catalog TagSNP rs3815087 GCST001181 Genome-wide association study of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis in Europe.
80 chr6 31138107 31138107 1 + G A rs1062630 31138107 + 31138087 31138127 41 TCCACCCCGACTCCTGCTTCGCCCTCAGGCTGAGAGGTCTC TCCACCCCGACTCCTGCTTCACCCTCAGGCTGAGAGGTCTC Direct Gain 0 0.739752650260925 Functional Gain 0.739752650260925 POU5F1 ENSG00000204531 CDS Human protein_coding chr6:31138107 chr6:31138107 synonymous SNV . 0 21 hm6Am_associated_SNPs_11052 0 28654678 Epstein-Barr virus copy number in lymphoblastoid cell lines 1e-06 GWAS_Catalog TagSNP rs1062630 GCST004735 Genetic factors affecting EBV copy number in lymphoblastoid cell lines derived from the 1000 Genome Project samples.
81 chr6 31540071 31540071 1 + G A rs1800683 31540071 + 31540051 31540091 41 CGTCCGGGCCCAGGGGCTCCGCACAGCAGGTGAGGCTCTCC CGTCCGGGCCCAGGGGCTCCACACAGCAGGTGAGGCTCTCC Direct Gain 0 0.872095704078674 Functional Gain 0.872095704078674 LTA ENSG00000226979 UTR5 Human protein_coding chr6:31540071 chr6:31540071 . . 0 21 hm6Am_associated_SNPs_11070 0 12426569 Myocardial infarction 3.3e-06 Johnson and O'Donnell TagSNP rs1800683 . Functional SNPs in the lymphotoxin-alpha gene that are associated with susceptibility to myocardial infarction.
82 chr6 31683157 31683157 1 + T A rs3749952 31683157 + 31683137 31683177 41 AACCCCAGTTTGTTGGGATCTTGCTCAGCTCCCTGCTAGGG AACCCCAGTTTGTTGGGATCATGCTCAGCTCCCTGCTAGGG Direct Gain 0 0.756845593452454 Functional Gain 0.756845593452454 LY6G6D ENSG00000244355 CDS Human protein_coding chr6:31683157 chr6:31683157 nonsynonymous SNV 0.668 3 21 hm6Am_associated_SNPs_11090 0 17804836 Rheumatoid Arthritis 2.05e-05 Johnson and O'Donnell TagSNP rs3749952 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
83 chr6 31914024 31914024 1 + T A rs4151667 31914024 + 31914004 31914044 41 GAGCAATCTCAGCCCCCAACTCTGCCTGATGCCCTTTATCT GAGCAATCTCAGCCCCCAACACTGCCTGATGCCCTTTATCT Direct Gain 0 0.772934913635254 Functional Gain 0.772934913635254 CFB ENSG00000243649 CDS Human protein_coding chr6:31914024 chr6:31914024 nonsynonymous SNV 0.337 3 21 hm6Am_associated_SNPs_11109 5 29875488 Blood protein levels 6e-53 GWAS_Catalog TagSNP rs4151667 GCST005806 Genomic atlas of the human plasma proteome.
84 chr6 31914180 31914180 1 + G A rs641153 31914180 + 31914160 31914200 41 CACTCCATGGTCTTTGGCCCGGCCCCAGGGATCCTGCTCTC CACTCCATGGTCTTTGGCCCAGCCCCAGGGATCCTGCTCTC Direct Gain 0 0.537396728992462 Functional Gain 0.537396728992462 CFB ENSG00000243649;ENSG00000244255 CDS Human other chr6:31914180 chr6:31914180 nonsynonymous SNV 0.000 0 21 hm6Am_associated_SNPs_11110 7 22705344 Age-related macular degeneration (choroidal neovascularisation) 1e-17 GWAS_Catalog TagSNP rs641153 GCST001579 Heritability and genome-wide association study to assess genetic differences between advanced age-related macular degeneration subtypes.
85 chr6 32122472 32122472 1 + C A rs3096696 32122472 + 32122452 32122492 41 AGCCCCCGCGCCCCACCGCGCGTCCTACAAGCCGGTCATCG AGCCCCCGCGCCCCACCGCGAGTCCTACAAGCCGGTCATCG Direct Gain 0 0.935856699943542 Functional Gain 0.935856699943542 PPT2 ENSG00000221988;ENSG00000258388 CDS Human other chr6:32122472 chr6:32122472 nonsynonymous SNV 0.852 1 21 hm6Am_associated_SNPs_11136 0 25987655 Asparaginase hypersensitivity in acute lymphoblastic leukemia 4e-06 GWAS_Catalog TagSNP rs3096696 GCST002915 Genome-wide analysis links NFATC2 with asparaginase hypersensitivity.
86 chr6 32862607 32862607 1 + T A rs3749982 32862607 + 32862587 32862627 41 CGGCAGTATGCCTGAGGGGGTCCTCCGTGTTCGCGCCTCCC CGGCAGTATGCCTGAGGGGGACCTCCGTGTTCGCGCCTCCC Direct Gain 0 0.82719361782074 Functional Gain 0.82719361782074 LOC100294145 ENSG00000234515;ENSG00000235301 intergenic Human other chr6:32862607 chr6:32862607 . . 0 21 hm6Am_associated_SNPs_11168 0 22993228 Disc degeneration (lumbar) 1e-07 GWAS_Catalog TagSNP rs3749982 GCST001687 Novel genetic variants associated with lumbar disc degeneration in northern Europeans: a meta-analysis of 4600 subjects.
87 chr6 33408542 33408542 1 + G A rs411136 33408542 + 33408522 33408562 41 CTGAAGGAGGTGTTTGCTTCGTGGCGGCTGCGCTGCGCAGA CTGAAGGAGGTGTTTGCTTCATGGCGGCTGCGCTGCGCAGA Direct Gain 0 0.973129153251648 Functional Gain 0.973129153251648 SYNGAP1 ENSG00000197283 CDS Human protein_coding chr6:33408542 chr6:33408542 synonymous SNV . 0 21 hm6Am_associated_SNPs_11202 1 17554300 Multiple complex diseases 5.31e-06 Johnson and O'Donnell TagSNP rs411136 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
88 chr6 33643558 33643558 1 + G A rs2229637 33643558 + 33643538 33643578 41 ACCATGCACGACTATGCGCCGCTGGTCTCGGGTGCCCTGCA ACCATGCACGACTATGCGCCACTGGTCTCGGGTGCCCTGCA Direct Gain 0 0.638452172279358 Functional Gain 0.638452172279358 ITPR3 ENSG00000096433 CDS Human protein_coding chr6:33643558 chr6:33643558 synonymous SNV . 0 21 hm6Am_associated_SNPs_11206 0 28203683 Venous thromboembolism adjusted for sickle cell variant rs77121243-T 5e-07 GWAS_Catalog TagSNP rs2229637 GCST004068 Identification of unique venous thromboembolism-susceptibility variants in African-Americans.
89 chr6 35389999 35389999 1 + G A rs2076168 35389999 + 35389979 35390019 41 TCCCTATACCTGAGGTTTACGCATTCTGGCCCAGAAGGGAA TCCCTATACCTGAGGTTTACACATTCTGGCCCAGAAGGGAA Direct Gain 0 0.828238248825073 Functional Gain 0.828238248825073 PPARD ENSG00000112033 intronic Human protein_coding chr6:35389999 chr6:35389999 . . 0 21 hm6Am_associated_SNPs_11267 0 30048462 Heel bone mineral density 4e-10 GWAS_Catalog TagSNP rs2076168 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
90 chr6 39046794 39046794 1 + G A rs10305492 39046794 + 39046774 39046814 41 TCCGGCTGCCCATTCTCTTTGCCATTGGGGTGAGTGATGGT TCCGGCTGCCCATTCTCTTTACCATTGGGGTGAGTGATGGT Direct Gain 0 0.932691335678101 Functional Gain 0.932691335678101 GLP1R ENSG00000112164 CDS Human protein_coding chr6:39046794 chr6:39046794 nonsynonymous SNV 0.996 1 21 hm6Am_associated_SNPs_11356 0 25625282 Fasting blood glucose adjusted for BMI 5e-07 GWAS_Catalog TagSNP rs10305492 GCST007858 Identification and functional characterization of G6PC2 coding variants influencing glycemic traits define an effector transcript at the G6PC2-ABCB11 locus.
91 chr6 43970827 43970827 1 + G A rs2295334 43970827 + 43970807 43970847 41 CCACCGCCGCTGTCATCCGCGGCGCTCCGCGGCGCTGGGCC CCACCGCCGCTGTCATCCGCAGCGCTCCGCGGCGCTGGGCC Direct Gain 0 0.930554330348969 Functional Gain 0.930554330348969 C6orf223 ENSG00000181577 CDS Human protein_coding chr6:43970827 chr6:43970827 synonymous SNV . 0 21 hm6Am_associated_SNPs_11523 0 25629512 Exudative age-related macular degeneration 6e-18 GWAS_Catalog TagSNP rs2295334 GCST002766 New loci and coding variants confer risk for age-related macular degeneration in East Asians.
92 chr6 160551204 160551204 1 + G A rs683369 160551204 + 160551184 160551224 41 TGTTTGAATGCGGGCTTCTTGTTTGGCTCTCTCGGTGTTGG TGTTTGAATGCGGGCTTCTTATTTGGCTCTCTCGGTGTTGG Direct Gain 0 0.963099002838135 Functional Gain 0.963099002838135 SLC22A1 ENSG00000175003 CDS Human protein_coding chr6:160551204 chr6:160551204 synonymous SNV . 0 21 hm6Am_associated_SNPs_12140 0 22179738 Gout 1e-07 GWAS_Catalog TagSNP rs683369 GCST001356 Gout and type 2 diabetes have a mutual inter-dependent effect on genetic risk factors and higher incidences.
93 chr7 2752152 2752152 1 + G A rs798565 2752152 + 2752132 2752172 41 GGGAGTCACACCTTCGCCTCGGGGCCAGAGGAAGGGCTGAG GGGAGTCACACCTTCGCCTCAGGGCCAGAGGAAGGGCTGAG Direct Gain 0 0.858989596366882 Functional Gain 0.858989596366882 AMZ1 ENSG00000174945 CDS Human protein_coding chr7:2752152 chr7:2752152 synonymous SNV . 0 21 hm6Am_associated_SNPs_12503 0 30804561 Chronic obstructive pulmonary disease 4e-09 GWAS_Catalog TagSNP rs798565 GCST007692 Genetic landscape of chronic obstructive pulmonary disease identifies heterogeneous cell-type and phenotype associations.
94 chr7 4780514 4780514 1 + G A rs3087749 4780514 + 4780494 4780534 41 GCCATCAAGATCCAGTTCACGTCGCTCTATCACAAAGAAGA GCCATCAAGATCCAGTTCACATCGCTCTATCACAAAGAAGA Direct Gain 0 0.522462666034698 Functional Gain 0.522462666034698 FOXK1 ENSG00000164916 CDS Human protein_coding chr7:4780514 chr7:4780514 nonsynonymous SNV . 0 21 hm6Am_associated_SNPs_12539 0 31085060 Emotional lability in attention deficit hyperactivity disorder 8e-06 GWAS_Catalog TagSNP rs3087749 GCST007880 Genome-wide analysis of emotional lability in adult attention deficit hyperactivity disorder (ADHD).
95 chr7 44622286 44622286 1 + G A rs217358 44622286 + 44622266 44622306 41 TGTGATGTTTTGCTTTGCGTGTCCACCTATCTGACTCGTAA TGTGATGTTTTGCTTTGCGTATCCACCTATCTGACTCGTAA Direct Gain 0 0.538326919078827 Functional Gain 0.538326919078827 TMED4 ENSG00000158604 upstream Human protein_coding chr7:44622286 chr7:44622286 . . 0 21 hm6Am_associated_SNPs_13069 0 17554300 Multiple complex diseases 0.000165477 Johnson and O'Donnell TagSNP rs217358 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
96 chr7 44808017 44808017 1 + G A rs1050327 44808017 + 44807997 44808037 41 CAGTGAGCTTCGGCCTGGCCGAGGTGGGTGGGTGGGCTCTC CAGTGAGCTTCGGCCTGGCCAAGGTGGGTGGGTGGGCTCTC Direct Gain 0 0.821737825870514 Functional Gain 0.821737825870514 ZMIZ2 ENSG00000122515 UTR3 Human protein_coding chr7:44808017 chr7:44808017 . . 0 21 hm6Am_associated_SNPs_13081 0 29326435 Intelligence (MTAG) 2e-09 GWAS_Catalog TagSNP rs1050327 GCST005316 A combined analysis of genetically correlated traits identifies 187 loci and a role for neurogenesis and myelination in intelligence.
97 chr7 99956436 99956436 1 + T A rs11771799 99956436 + 99956416 99956456 41 TTACCCCTGGGAGTTAGCCATAGTTCCCAACGTGAGAATAT TTACCCCTGGGAGTTAGCCAAAGTTCCCAACGTGAGAATAT Direct Gain 0 0.52952253818512 Functional Gain 0.52952253818512 PILRB ENSG00000121716 CDS Human protein_coding chr7:99956436 chr7:99956436 nonsynonymous SNV 0.000 0 21 hm6Am_associated_SNPs_13590 0 29875488 Blood protein levels 5e-31 GWAS_Catalog TagSNP rs11771799 GCST005806 Genomic atlas of the human plasma proteome.
98 chr7 100701610 100701610 1 + T A rs4729656 100701610 + 100701590 100701630 41 GTACTCTGACTGCAACATCTTTCACCCCATTGATCGCCAGG GTACTCTGACTGCAACATCTATCACCCCATTGATCGCCAGG Direct Gain 0 0.501915037631989 Functional Gain 0.501915037631989 MUC17 ENSG00000222636 ncRNA_exonic Human misc_RNA chr7:100701610 chr7:100701610 . . 0 21 hm6Am_associated_SNPs_13691 0 17554300 Multiple complex diseases 9.01e-05 Johnson and O'Donnell TagSNP rs4729656 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
99 chr7 130025713 130025713 1 + G A rs77792157 130025713 + 130025693 130025733 41 AGGCTGCTGTGACAGCCCTGGCCTCTCTCTACGGGACCAAG AGGCTGCTGTGACAGCCCTGACCTCTCTCTACGGGACCAAG Direct Gain 0 0.584740936756134 Functional Gain 0.584740936756134 CPA1 ENSG00000091704 CDS Human protein_coding chr7:130025713 chr7:130025713 nonsynonymous SNV 0.363 0 21 hm6Am_associated_SNPs_13953 0 30718926 Type 2 diabetes 3e-09 GWAS_Catalog TagSNP rs77792157 GCST007847 Identification of 28 new susceptibility loci for type 2 diabetes in the Japanese population.
100 chr7 150761314 150761314 1 + G A rs2303929 150761314 + 150761294 150761334 41 GCCAGAGAGCTTGGGCCCTGGGACGCCTGGGTTCCCCGAGC GCCAGAGAGCTTGGGCCCTGAGACGCCTGGGTTCCCCGAGC Direct Gain 0 0.914718568325043 Functional Gain 0.914718568325043 SLC4A2 ENSG00000164889 CDS Human protein_coding chr7:150761314 chr7:150761314 nonsynonymous SNV 0.043 1 21 hm6Am_associated_SNPs_14320 0 30038396 Educational attainment (years of education) 4e-08 GWAS_Catalog TagSNP rs2303929 GCST006442 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
101 chr8 23082971 23082971 1 + G A rs13278062 23082971 + 23082951 23082991 41 CGGCCTCCTCCGTCACTACCGGGCGAGTGATTCAGCCTGCC CGGCCTCCTCCGTCACTACCAGGCGAGTGATTCAGCCTGCC Direct Gain 0 0.756181836128235 Functional Gain 0.756181836128235 LOC389641 ENSG00000246582 ncRNA_exonic Human processed_transcript chr8:23082971 chr8:23082971 . . 0 21 hm6Am_associated_SNPs_14930 0 21909106 Age-related macular degeneration 1e-12 GWAS_Catalog TagSNP rs13278062 GCST001232 Genome-wide association study identifies two susceptibility loci for exudative age-related macular degeneration in the Japanese population.
102 chr9 7174673 7174673 1 + G A rs913588 7174673 + 7174653 7174693 41 ATGAATATGTGGCCGACCCTGTATACCGCACTTTTTTGAAG ATGAATATGTGGCCGACCCTATATACCGCACTTTTTTGAAG Direct Gain 0 0.603789746761322 Functional Gain 0.603789746761322 KDM4C ENSG00000107077 CDS Human protein_coding chr9:7174673 chr9:7174673 nonsynonymous SNV 0.990 0 21 hm6Am_associated_SNPs_15876 0 25231870 Menarche (age at onset) 6e-11 GWAS_Catalog TagSNP rs913588 GCST002541 Parent-of-origin-specific allelic associations among 106 genomic loci for age at menarche.
103 chr9 7174813 7174813 1 + T A rs10976088 7174813 + 7174793 7174833 41 CCTTGGGGCTGTGCCGTGAGTTTTGCTGGCATAGGTGACAG CCTTGGGGCTGTGCCGTGAGATTTGCTGGCATAGGTGACAG Direct Gain 0 0.939968228340149 Functional Gain 0.939968228340149 KDM4C ENSG00000107077 UTR3 Human protein_coding chr9:7174813 chr9:7174813 . . 0 21 hm6Am_associated_SNPs_15877 0 17463246 Multiple continuous traits in DGI samples 0.0001054 Johnson and O'Donnell TagSNP rs10976088 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
104 chr9 12775488 12775488 1 + G A rs10491742 12775488 + 12775468 12775508 41 ATCTTGATCATCTTAGTGTCGGAGGAGTCGCAGCGGACTGG ATCTTGATCATCTTAGTGTCAGAGGAGTCGCAGCGGACTGG Direct Gain 0 0.530012726783752 Functional Gain 0.530012726783752 LURAP1L-AS1 ENSG00000235448 ncRNA_intronic Human antisense chr9:12775488 chr9:12775488 . . 0 21 hm6Am_associated_SNPs_15883 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0002672 Johnson and O'Donnell TagSNP rs10491742 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
105 chr9 71789104 71789104 1 + G A rs62567129 71789104 + 71789084 71789124 41 GAGGCGCCACGCTCGGGTCGGGGGCGGGCTGACGCCGCCGC GAGGCGCCACGCTCGGGTCGAGGGCGGGCTGACGCCGCCGC Direct Gain 0 0.987699210643768 Functional Gain 0.987699210643768 TJP2 ENSG00000119139 UTR5 Human protein_coding chr9:71789104 chr9:71789104 . . 0 21 hm6Am_associated_SNPs_16103 0 30535121 Macular thickness 3e-08 GWAS_Catalog TagSNP rs62567129 GCST006976 Genome-wide association analyses identify 139 loci associated with macular thickness in the UK Biobank cohort.
106 chr9 133284310 133284310 1 + G A rs10793975 133284310 + 133284290 133284330 41 GAATGGCTCGCTGACCATCCGCAGGACTGAGGCAAGGCGGG GAATGGCTCGCTGACCATCCACAGGACTGAGGCAAGGCGGG Direct Gain 0 0.601959049701691 Functional Gain 0.601959049701691 HMCN2 ENSG00000215428;ENSG00000148357 intergenic Human other chr9:133284310 chr9:133284310 . 0.110 0 21 hm6Am_associated_SNPs_16877 0 17641165 HIV-1 disease progression 1.24e-05 Johnson and O'Donnell TagSNP rs10793975 . A whole-genome association study of major determinants for host control of HIV-1.
107 chr9 133928345 133928345 1 + C A rs12349966 133928345 + 133928325 133928365 41 CGCGTCAGTCCCGGCCCCAGCCCTGCCGGTCAGTAAAGACA CGCGTCAGTCCCGGCCCCAGACCTGCCGGTCAGTAAAGACA Direct Gain 0 0.503668665885925 Functional Gain 0.503668665885925 LAMC3 ENSG00000050555 CDS Human protein_coding chr9:133928345 chr9:133928345 nonsynonymous SNV 0.154 0 21 hm6Am_associated_SNPs_16927 0 30595370 Balding type 1 7e-09 GWAS_Catalog TagSNP rs12349966 GCST007038 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
108 chr9 135866648 135866648 1 + C A rs4962034 135866648 + 135866628 135866668 41 CCTGCTGCCAAGTGTGGGAGCCTGGCTGGGTCTTTCTCAGC CCTGCTGCCAAGTGTGGGAGACTGGCTGGGTCTTTCTCAGC Direct Gain 0 0.557894885540009 Functional Gain 0.557894885540009 GFI1B ENSG00000165702 UTR3 Human protein_coding chr9:135866648 chr9:135866648 . . 0 21 hm6Am_associated_SNPs_16989 0 30595370 Red blood cell count 2e-16 GWAS_Catalog TagSNP rs4962034 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
109 chr10 5726821 5726821 1 + G A rs11259192 5726821 + 5726801 5726841 41 GCTTCCGGTTGCTAGCGCCGGTCAGAGAGAAAGTCGGCATG GCTTCCGGTTGCTAGCGCCGATCAGAGAGAAAGTCGGCATG Direct Gain 0 0.880418598651886 Functional Gain 0.880418598651886 FAM208B ENSG00000108021 UTR5 Human protein_coding chr10:5726821 chr10:5726821 . . 0 21 hm6Am_associated_SNPs_17630 0 17554300 Multiple complex diseases 0.000537539 Johnson and O'Donnell TagSNP rs11259192 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
110 chr10 6276743 6276743 1 + G A rs1539234 6276743 + 6276723 6276763 41 GGCCTCATTCTTTGAACATCGACTCTGAAGTTTGATACAGA GGCCTCATTCTTTGAACATCAACTCTGAAGTTTGATACAGA Direct Gain 0 0.502180278301239 Functional Gain 0.502180278301239 PFKFB3 ENSG00000170525 UTR3 Human protein_coding chr10:6276743 chr10:6276743 . . 0 21 hm6Am_associated_SNPs_17658 0 17558408 Celiac disease 4.6e-06 Johnson and O'Donnell TagSNP rs1539234 . A genome-wide association study for celiac disease identifies risk variants in the region harboring IL2 and IL21.
111 chr10 73115942 73115942 1 + G A rs2252996 73115942 + 73115922 73115962 41 CCTTCTTCCTGACGGCCACTGTCTTCCTCGTGCTCTGCATG CCTTCTTCCTGACGGCCACTATCTTCCTCGTGCTCTGCATG Direct Gain 0 0.87755274772644 Functional Gain 0.87755274772644 SLC29A3 ENSG00000198246 CDS Human protein_coding chr10:73115942 chr10:73115942 nonsynonymous SNV 0.000 0 21 hm6Am_associated_SNPs_18098 2 23273568 Systemic lupus erythematosus 3e-06 GWAS_Catalog TagSNP rs2252996 GCST001795 Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians.
112 chr10 101287764 101287764 1 + G A rs10883365 101287764 + 101287744 101287784 41 TTCTCAGACGGTTTGAAGGTGTTTGTGCCAACGTGACCCCC TTCTCAGACGGTTTGAAGGTATTTGTGCCAACGTGACCCCC Direct Gain 0 0.765261054039001 Functional Gain 0.765261054039001 LINC01475 ENSG00000228778;ENSG00000257582 ncRNA_exonic Human other chr10:101287764 chr10:101287764 . . 0 21 hm6Am_associated_SNPs_18459 0 17554300 Crohn's disease 6e-08 GWAS_Catalog TagSNP rs10883365 GCST000042 Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
113 chr10 103922063 103922063 1 + G A rs1049466 103922063 + 103922043 103922083 41 GTGAAGCAAGGGTGATGATCGGAGACTACTTACTTTCTCCA GTGAAGCAAGGGTGATGATCAGAGACTACTTACTTTCTCCA Direct Gain 0 0.5274538397789 Functional Gain 0.5274538397789 NOLC1 ENSG00000166197 UTR3 Human protein_coding chr10:103922063 chr10:103922063 . . 0 21 hm6Am_associated_SNPs_18536 0 17554300 Multiple complex diseases 0.000513943 Johnson and O'Donnell TagSNP rs1049466 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
114 chr10 104837816 104837816 1 + G A rs1046411 104837816 + 104837796 104837836 41 TAAGCTCACAGAGTGTCGTCGCCCACCTCCCTGGTCCTTGC TAAGCTCACAGAGTGTCGTCACCCACCTCCCTGGTCCTTGC Direct Gain 0 0.575753688812256 Functional Gain 0.575753688812256 CNNM2 ENSG00000148842 UTR3 Human protein_coding chr10:104837816 chr10:104837816 . . 0 21 hm6Am_associated_SNPs_18587 1 30595370 Mean corpuscular hemoglobin 2e-41 GWAS_Catalog TagSNP rs1046411 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
115 chr10 133754334 133754334 1 + G A rs10870270 133754334 + 133754314 133754354 41 CCTCGTGATTCCTGAAAGTCGTTTGCACTCATGTGTGTGTT CCTCGTGATTCCTGAAAGTCATTTGCACTCATGTGTGTGTT Direct Gain 0 0.500198543071747 Functional Gain 0.500198543071747 PPP2R2D ENSG00000175470 intronic Human protein_coding chr10:133754334 chr10:133754334 . . 0 21 hm6Am_associated_SNPs_18852 0 22959728 Amyotrophic lateral sclerosis in C9orf72 mutation positive individuals 9e-06 GWAS_Catalog TagSNP rs10870270 GCST004792 Age of onset of amyotrophic lateral sclerosis is modulated by a locus on 1p34.1.
116 chr11 831883 831883 1 + G A rs35694355 831883 + 831863 831903 41 AGGGTCCCGGGAGTGGCCAGGGTCCCGTGTGTGCCCTCTGC AGGGTCCCGGGAGTGGCCAGAGTCCCGTGTGTGCCCTCTGC Direct Gain 0 0.902150630950928 Functional Gain 0.902150630950928 CRACR2B ENSG00000255108 ncRNA_intronic Human antisense chr11:831883 chr11:831883 . . 0 21 hm6Am_associated_SNPs_19213 0 23251661 Obesity-related traits 3e-06 GWAS_Catalog TagSNP rs35694355 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
117 chr11 1248087 1248087 1 + G A rs56293203 1248087 + 1248067 1248107 41 TGGAGGCGTCCAACGGCTCCGTCCTCATCAATGGGCAGCGG TGGAGGCGTCCAACGGCTCCATCCTCATCAATGGGCAGCGG Direct Gain 0 0.70441746711731 Functional Gain 0.70441746711731 MUC5B ENSG00000117983 CDS Human protein_coding chr11:1248087 chr11:1248087 nonsynonymous SNV 0.008 0 21 hm6Am_associated_SNPs_19273 1 27777418 Major depressive disorder 2e-09 GWAS_Catalog TagSNP rs56293203 GCST005547 The PHF21B gene is associated with major depression and modulates the stress response.
118 chr11 1892585 1892585 1 + G A rs4980389 1892585 + 1892565 1892605 41 GGCAGAGATGTGAAACAGCTGCAGAGCGGGACAAGGGTGCT GGCAGAGATGTGAAACAGCTACAGAGCGGGACAAGGGTGCT Direct Gain 0 0.722081184387207 Functional Gain 0.722081184387207 LSP1 ENSG00000130592 UTR5 Human protein_coding chr11:1892585 chr11:1892585 . . 0 21 hm6Am_associated_SNPs_19364 0 29912962 Systolic blood pressure x alcohol consumption interaction (2df test) 7e-40 GWAS_Catalog TagSNP rs4980389 GCST006434 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
119 chr11 1995223 1995223 1 + G A rs217719 1995223 + 1995203 1995243 41 CCCATGGCCAACAGGTAGGTGCCCAGATGCTGTTCTGTGGT CCCATGGCCAACAGGTAGGTACCCAGATGCTGTTCTGTGGT Direct Gain 0 0.554762065410614 Functional Gain 0.554762065410614 MRPL23;MRPL23-AS1 ENSG00000214026 intronic Human protein_coding chr11:1995223 chr11:1995223 . . 0 21 hm6Am_associated_SNPs_19373 0 29912962 Systolic blood pressure x alcohol consumption interaction (2df test) 3e-18 GWAS_Catalog TagSNP rs217719 GCST006434 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
120 chr11 12284950 12284950 1 + G A rs2279617 12284950 + 12284930 12284970 41 AGCTGTCCTAGGCAACACTCGCGGTCTCAGGCTGCGGTGGG AGCTGTCCTAGGCAACACTCACGGTCTCAGGCTGCGGTGGG Direct Gain 0 0.851620256900787 Functional Gain 0.851620256900787 MICAL2 ENSG00000133816 intronic Human protein_coding chr11:12284950 chr11:12284950 . . 0 21 hm6Am_associated_SNPs_19630 0 17407593 Nicotine dependence 0.00115 Johnson and O'Donnell TagSNP rs2279617 . Molecular genetics of nicotine dependence and abstinence: whole genome association using 520,000 SNPs.
121 chr11 47434986 47434986 1 + G A rs2293576 47434986 + 47434966 47435006 41 CCCACTGCTGCTGCCGCCGCGCTCAATGGAGGCCACTGTCT CCCACTGCTGCTGCCGCCGCACTCAATGGAGGCCACTGTCT Direct Gain 0 0.949029684066772 Functional Gain 0.949029684066772 SLC39A13 ENSG00000165915 CDS Human protein_coding chr11:47434986 chr11:47434986 synonymous SNV . 0 21 hm6Am_associated_SNPs_19985 1 25673412 Waist circumference 2e-08 GWAS_Catalog TagSNP rs2293576 GCST004065 New genetic loci link adipose and insulin biology to body fat distribution.
122 chr11 61722645 61722645 1 + C A rs1109748 61722645 + 61722625 61722665 41 CTGTATTGCGACAGCTACATCCAGCTCATCCCCATTTCCTT CTGTATTGCGACAGCTACATACAGCTCATCCCCATTTCCTT Direct Gain 0 0.582423448562622 Functional Gain 0.582423448562622 BEST1 ENSG00000167995 CDS Human protein_coding chr11:61722645 chr11:61722645 synonymous SNV . 0 21 hm6Am_associated_SNPs_20172 5 21829377 Plasma omega-3 polyunsaturated fatty acid level (eicosapentaenoic acid) 5e-09 GWAS_Catalog TagSNP rs1109748 GCST001178 Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium.
123 chr11 62381808 62381808 1 + G A rs1801144 62381808 + 62381788 62381828 41 TGCAACCCCCACTCACCCCGGCCTTGCCTGCAAAACCGTCT TGCAACCCCCACTCACCCCGACCTTGCCTGCAAAACCGTCT Direct Gain 0 0.545320153236389 Functional Gain 0.545320153236389 ROM1 ENSG00000149489 CDS Human protein_coding chr11:62381808 chr11:62381808 nonsynonymous SNV 0.996 0 21 hm6Am_associated_SNPs_20199 0 30595370 Lung function (FVC) 4e-30 GWAS_Catalog TagSNP rs1801144 GCST007081 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
124 chr11 63988045 63988045 1 + G A rs3802932 63988045 + 63988025 63988065 41 CGCACGGGCAGTGGGGGCCCGGGCAACCACCCCCACGGCCC CGCACGGGCAGTGGGGGCCCAGGCAACCACCCCCACGGCCC Direct Gain 0 0.671420335769653 Functional Gain 0.671420335769653 FERMT3 ENSG00000149781 CDS Human protein_coding chr11:63988045 chr11:63988045 nonsynonymous SNV 0.001 0 21 hm6Am_associated_SNPs_20267 0 31015401 Medication use (agents acting on the renin-angiotensin system) 6e-10 GWAS_Catalog TagSNP rs3802932 GCST007930 Genome-wide association study of medication-use and associated disease in the UK Biobank.
125 chr11 64009879 64009879 1 + G A rs4672 64009879 + 64009859 64009899 41 CATGAGGCTGAGCTGGTTCCGGGTCCTGACAGTACTGTCCA CATGAGGCTGAGCTGGTTCCAGGTCCTGACAGTACTGTCCA Direct Gain 0 0.607511162757874 Functional Gain 0.607511162757874 FKBP2 ENSG00000173486 CDS Human protein_coding chr11:64009879 chr11:64009879 nonsynonymous SNV 0.971 0 21 hm6Am_associated_SNPs_20282 0 30038396 Cognitive performance (MTAG) 6e-09 GWAS_Catalog TagSNP rs4672 GCST006570 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
126 chr11 64023971 64023971 1 + G A rs7943988 64023971 + 64023951 64023991 41 CGGCCCTCCCAGGCCCGGCTGCTCATCGAAAAGTATGAGCC CGGCCCTCCCAGGCCCGGCTACTCATCGAAAAGTATGAGCC Direct Gain 0 0.914128541946411 Functional Gain 0.914128541946411 PLCB3 ENSG00000149782 CDS Human protein_coding chr11:64023971 chr11:64023971 synonymous SNV . 0 21 hm6Am_associated_SNPs_20285 0 17554300 Multiple complex diseases 0.0003931 Johnson and O'Donnell TagSNP rs7943988 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
127 chr11 65349063 65349063 1 + G A rs3741380 65349063 + 65349043 65349083 41 CACCCCAGCCCCTCGGCTCCGGAAAGGCTCTGATGCCCTCC CACCCCAGCCCCTCGGCTCCAGAAAGGCTCTGATGCCCTCC Direct Gain 0 0.573112785816193 Functional Gain 0.573112785816193 EHBP1L1 ENSG00000173442 CDS Human protein_coding chr11:65349063 chr11:65349063 nonsynonymous SNV 0.599 0 21 hm6Am_associated_SNPs_20456 0 29212778 Coronary artery disease 3e-10 GWAS_Catalog TagSNP rs3741380 GCST005194 Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease.
128 chr11 65561369 65561369 1 + G A rs12797706 65561369 + 65561349 65561389 41 GTGGTGGTCGGGGCAGCCCCGCTCTGCTGCATGCCTGCGAT GTGGTGGTCGGGGCAGCCCCACTCTGCTGCATGCCTGCGAT Direct Gain 0 0.968476891517639 Functional Gain 0.968476891517639 OVOL1 ENSG00000172818 UTR5 Human protein_coding chr11:65561369 chr11:65561369 . . 0 21 hm6Am_associated_SNPs_20494 0 30595370 Hair color 1e-21 GWAS_Catalog TagSNP rs12797706 GCST007082 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
129 chr11 67184725 67184725 1 + G A rs61734601 67184725 + 67184705 67184745 41 GTTCCCATTAACAAGCCTTCGCCCCCAACACAAGCCTTTCC GTTCCCATTAACAAGCCTTCACCCCCAACACAAGCCTTTCC Direct Gain 0 0.507901310920715 Functional Gain 0.507901310920715 CARNS1 ENSG00000172508;ENSG00000172531 intronic Human other chr11:67184725 chr11:67184725 . . 0 21 hm6Am_associated_SNPs_20624 0 28552196 Height 2e-10 GWAS_Catalog TagSNP rs61734601 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
130 chr11 67192555 67192555 1 + G A rs1626067 67192555 + 67192535 67192575 41 CCAAATTCTAGGATAGCTCTGAAGCCTGCTGGAAACTTGGT CCAAATTCTAGGATAGCTCTAAAGCCTGCTGGAAACTTGGT Direct Gain 0 0.546525716781616 Functional Gain 0.546525716781616 CARNS1 ENSG00000172508 UTR3 Human protein_coding chr11:67192555 chr11:67192555 . . 0 21 hm6Am_associated_SNPs_20634 0 30595370 Sunburns 2e-11 GWAS_Catalog TagSNP rs1626067 GCST007086 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
131 chr11 68174189 68174189 1 + G A rs4988321 68174189 + 68174169 68174209 41 TCGAGACCAATAACAACGACGTGGCCATCCCGCTCACGGGC TCGAGACCAATAACAACGACATGGCCATCCCGCTCACGGGC Direct Gain 0 0.861433625221252 Functional Gain 0.861433625221252 LRP5 ENSG00000162337 CDS Human protein_coding chr11:68174189 chr11:68174189 nonsynonymous SNV 0.978 3 21 hm6Am_associated_SNPs_20684 3 28869591 Heel bone mineral density 7e-15 GWAS_Catalog TagSNP rs4988321 GCST006288 Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
132 chr11 69462910 69462910 1 + G A rs9344 69462910 + 69462890 69462930 41 AGAGTGATCAAGTGTGACCCGGTAAGTGAGGGTGATGTCCC AGAGTGATCAAGTGTGACCCAGTAAGTGAGGGTGATGTCCC Direct Gain 0 0.781012058258057 Functional Gain 0.781012058258057 CCND1 ENSG00000110092 CDS Human protein_coding chr11:69462910 chr11:69462910 synonymous SNV . 0 21 hm6Am_associated_SNPs_20759 3 28025584 Immunoglobulin light chain (AL) amyloidosis 8e-11 GWAS_Catalog TagSNP rs9344 GCST004028 Genome-wide association study of immunoglobulin light chain amyloidosis in three patient cohorts: comparison with myeloma.
133 chr11 71187294 71187294 1 + G A rs4944062 71187294 + 71187274 71187314 41 CGGCCTTCCACTCTGCTCTTGTTGGGAATGGGCATTAAAGC CGGCCTTCCACTCTGCTCTTATTGGGAATGGGCATTAAAGC Direct Gain 0 0.687647640705109 Functional Gain 0.687647640705109 NADSYN1 ENSG00000172890 UTR3 Human protein_coding chr11:71187294 chr11:71187294 . . 0 21 hm6Am_associated_SNPs_20797 0 29343764 Vitamin D levels (dietary vitamin D intake interaction) 2e-31 GWAS_Catalog TagSNP rs4944062 GCST005366 Genome-wide association study in 79,366 European-ancestry individuals informs the genetic architecture of 25-hydroxyvitamin D levels.
134 chr11 72947934 72947934 1 + G A rs11235688 72947934 + 72947914 72947954 41 GCTCAGCTGGACAGGGCCCCGCCCTAGCCTTTGGAAAGGGA GCTCAGCTGGACAGGGCCCCACCCTAGCCTTTGGAAAGGGA Direct Gain 0 0.922862231731415 Functional Gain 0.922862231731415 P2RY2 ENSG00000175591 downstream Human protein_coding chr11:72947934 chr11:72947934 . . 0 21 hm6Am_associated_SNPs_20866 0 27863252 Mean platelet volume 5e-11 GWAS_Catalog TagSNP rs11235688 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
135 chr11 73020846 73020846 1 + G A rs3741151 73020846 + 73020826 73020866 41 GGCCAGCCCCGCAGGCTCCCGCGGTAGCAGCCGTTATTCCA GGCCAGCCCCGCAGGCTCCCACGGTAGCAGCCGTTATTCCA Direct Gain 0 0.904356122016907 Functional Gain 0.904356122016907 ARHGEF17 ENSG00000110237 CDS Human protein_coding chr11:73020846 chr11:73020846 nonsynonymous SNV 0.928 1 21 hm6Am_associated_SNPs_20880 0 29093273 GIP levels in response to oral glucose tolerance test (120 minutes) 1e-06 GWAS_Catalog TagSNP rs3741151 GCST005166 Genetic determinants of circulating GIP and GLP-1 concentrations.
136 chr11 111411608 111411608 1 + G A rs11213935 111411608 + 111411588 111411628 41 TACAGGCCGTGCTGCTGGCCGTGCTGCTGGTGGGGCTGCGG TACAGGCCGTGCTGCTGGCCATGCTGCTGGTGGGGCTGCGG Direct Gain 0 0.906648874282837 Functional Gain 0.906648874282837 LAYN ENSG00000204381 CDS Human protein_coding chr11:111411608 chr11:111411608 nonsynonymous SNV 0.020 0 21 hm6Am_associated_SNPs_21152 0 23251661 Obesity-related traits 4e-06 GWAS_Catalog TagSNP rs11213935 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
137 chr11 120099679 120099679 1 + G A rs2508490 120099679 + 120099659 120099699 41 CGGGAAGCCCTGCGTCTGCCGCTATGGCCTGAGCCTGGCCT CGGGAAGCCCTGCGTCTGCCACTATGGCCTGAGCCTGGCCT Direct Gain 0 0.964923501014709 Functional Gain 0.964923501014709 OAF ENSG00000184232 CDS Human protein_coding chr11:120099679 chr11:120099679 nonsynonymous SNV 0.517 0 21 hm6Am_associated_SNPs_21330 0 29875488 Blood protein levels 6e-194 GWAS_Catalog TagSNP rs2508490 GCST005806 Genomic atlas of the human plasma proteome.
138 chr11 121016724 121016724 1 + G A rs148619105 121016724 + 121016704 121016744 41 GTTTGACTCTTGCATCGATGGGGGCGCGGTGCAGACCGCCT GTTTGACTCTTGCATCGATGAGGGCGCGGTGCAGACCGCCT Direct Gain 0 0.818918526172638 Functional Gain 0.818918526172638 TECTA ENSG00000109927 CDS Human protein_coding chr11:121016724 chr11:121016724 nonsynonymous SNV 1.000 2 21 hm6Am_associated_SNPs_21351 1 28714976 Alzheimer's disease (late onset) 1e-07 GWAS_Catalog TagSNP rs148619105 GCST005549 Rare coding variants in PLCG2, ABI3, and TREM2 implicate microglial-mediated innate immunity in Alzheimer's disease.
139 chr11 124017493 124017493 1 + G A rs4936894 124017493 + 124017473 124017513 41 TAGGAAGAAAGGAGCTCCCCGTAATCGTTCCTGACCCTTGT TAGGAAGAAAGGAGCTCCCCATAATCGTTCCTGACCCTTGT Direct Gain 0 0.914040505886078 Functional Gain 0.914040505886078 VWA5A ENSG00000110002 UTR3 Human protein_coding chr11:124017493 chr11:124017493 . . 0 21 hm6Am_associated_SNPs_21384 0 21782286 Aging (time to death) 2e-06 GWAS_Catalog TagSNP rs4936894 GCST001167 A genome-wide association study of aging.
140 chr12 2908330 2908330 1 + C A rs56196860 2908330 + 2908310 2908350 41 GAGATTGGCGAGGGGGAGAACCTGGATCTGCCTTATGGTCT GAGATTGGCGAGGGGGAGAAACTGGATCTGCCTTATGGTCT Direct Gain 0 0.869005441665649 Functional Gain 0.869005441665649 FKBP4 ENSG00000004478 CDS Human protein_coding chr12:2908330 chr12:2908330 nonsynonymous SNV 0.939 0 21 hm6Am_associated_SNPs_21664 0 30048462 Heel bone mineral density 6e-09 GWAS_Catalog TagSNP rs56196860 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
141 chr12 49373410 49373410 1 + T A rs61758378 49373410 + 49373390 49373430 41 GTGAGTGGGGGGCTGCAGAGTGCCGTGCGCGAGTGCAAGTG GTGAGTGGGGGGCTGCAGAGAGCCGTGCGCGAGTGCAAGTG Direct Gain 0 0.729097127914429 Functional Gain 0.729097127914429 WNT1 ENSG00000125084 CDS Human protein_coding chr12:49373410 chr12:49373410 nonsynonymous SNV 0.984 1 21 hm6Am_associated_SNPs_22065 1 30598549 Heel bone mineral density 1e-19 GWAS_Catalog TagSNP rs61758378 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
142 chr12 50366300 50366300 1 + G A rs2849266 50366300 + 50366280 50366320 41 CGTCCTTGGTAAAGTCGACTGTATTCACATCTGCATTCTGT CGTCCTTGGTAAAGTCGACTATATTCACATCTGCATTCTGT Direct Gain 0 0.831551432609558 Functional Gain 0.831551432609558 AQP6 ENSG00000086159 UTR5 Human protein_coding chr12:50366300 chr12:50366300 . . 0 21 hm6Am_associated_SNPs_22113 0 17554300 Multiple complex diseases 0.000167267 Johnson and O'Donnell TagSNP rs2849266 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
143 chr12 52381026 52381026 1 + C A rs2252518 52381026 + 52381006 52381046 41 GCGGGGAGTGCCCCGGTGCGCATAGCACGGGATTCATGCAG GCGGGGAGTGCCCCGGTGCGAATAGCACGGGATTCATGCAG Direct Gain 0 0.505129933357239 Functional Gain 0.505129933357239 ACVR1B ENSG00000135503 UTR3 Human protein_coding chr12:52381026 chr12:52381026 . . 0 21 hm6Am_associated_SNPs_22174 0 24939585 Age-related hearing impairment 5e-07 GWAS_Catalog TagSNP rs2252518 GCST002491 Genome-wide association analysis demonstrates the highly polygenic character of age-related hearing impairment.
144 chr12 56115585 56115585 1 + C A rs3138142 56115585 + 56115565 56115605 41 GTGAACACAATGGGTCCCATCGGGGTCACCCTTGCCCTGCT GTGAACACAATGGGTCCCATAGGGGTCACCCTTGCCCTGCT Direct Gain 0 0.547369122505188 Functional Gain 0.547369122505188 RDH5 ENSG00000135437 CDS Human protein_coding chr12:56115585 chr12:56115585 synonymous SNV . 0 21 hm6Am_associated_SNPs_22285 0 27020472 Spherical equivalent (joint analysis main effects and education interaction) 1e-08 GWAS_Catalog TagSNP rs3138142 GCST003455 Meta-analysis of gene-environment-wide association scans accounting for education level identifies additional loci for refractive error.
145 chr12 56435929 56435929 1 + C A rs1131017 56435929 + 56435909 56435949 41 CCTGCCAGGCACCGTCTCCTCTCTCCGGTCCGTGCCTCCAA CCTGCCAGGCACCGTCTCCTATCTCCGGTCCGTGCCTCCAA Direct Gain 0 0.979834616184235 Functional Gain 0.979834616184235 RPS26 ENSG00000197728 UTR5 Human protein_coding chr12:56435929 chr12:56435929 . . 0 21 hm6Am_associated_SNPs_22304 0 30038396 Cognitive performance 4e-09 GWAS_Catalog TagSNP rs1131017 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
146 chr12 69995273 69995273 1 + T A rs7200 69995273 + 69995253 69995293 41 GGTCTAATTTATTTGCCGTGTCATTTTCCATACAAATCAGT GGTCTAATTTATTTGCCGTGACATTTTCCATACAAATCAGT Direct Gain 0 0.884890556335449 Functional Gain 0.884890556335449 CCT2 ENSG00000166226 UTR3 Human protein_coding chr12:69995273 chr12:69995273 . . 0 21 hm6Am_associated_SNPs_22455 0 17463246 Multiple continuous traits in DGI samples 0.0003625 Johnson and O'Donnell TagSNP rs7200 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
147 chr12 104139034 104139034 1 + C A rs7306642 104139034 + 104139014 104139054 41 GTGAAACGGGGTGGACAGGCCCCTCGTGTGACACTCAGGCA GTGAAACGGGGTGGACAGGCACCTCGTGTGACACTCAGGCA Direct Gain 0 0.651909232139587 Functional Gain 0.651909232139587 STAB2 ENSG00000136011 CDS Human protein_coding chr12:104139034 chr12:104139034 nonsynonymous SNV 0.174 0 21 hm6Am_associated_SNPs_22646 0 21810271 vWF and FVIII levels 3e-06 GWAS_Catalog TagSNP rs7306642 GCST001188 Combined analysis of three genome-wide association studies on vWF and FVIII plasma levels.
148 chr12 107713696 107713696 1 + G A rs111260184 107713696 + 107713676 107713716 41 CGGCCGCCGCAGTCCCGCCGGCAGCCGCCGCCAACCACCAC CGGCCGCCGCAGTCCCGCCGACAGCCGCCGCCAACCACCAC Direct Gain 0 0.989987850189209 Functional Gain 0.989987850189209 BTBD11 ENSG00000151136 CDS Human protein_coding chr12:107713696 chr12:107713696 nonsynonymous SNV 0.121 1 21 hm6Am_associated_SNPs_22677 0 30595370 Body mass index 3e-09 GWAS_Catalog TagSNP rs111260184 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
149 chr12 113448652 113448652 1 + C A rs13311 113448652 + 113448632 113448672 41 GGTTCTCATAACTCTGTGATCTTGCTCTCGGTGCTTCCAAC GGTTCTCATAACTCTGTGATATTGCTCTCGGTGCTTCCAAC Direct Gain 0 0.550288081169128 Functional Gain 0.550288081169128 OAS2 ENSG00000257452 ncRNA_intronic Human antisense chr12:113448652 chr12:113448652 . . 0 21 hm6Am_associated_SNPs_22804 0 17463246 Multiple continuous traits in DGI samples 0.0009216 Johnson and O'Donnell TagSNP rs13311 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
150 chr12 122186317 122186317 1 + G A rs28655666 122186317 + 122186297 122186337 41 AGCGGCAGGACGTCTTCTTCGACATGGAGGCCTACCTGCCC AGCGGCAGGACGTCTTCTTCAACATGGAGGCCTACCTGCCC Direct Gain 0 0.576330780982971 Functional Gain 0.576330780982971 TMEM120B ENSG00000188735 CDS Human protein_coding chr12:122186317 chr12:122186317 nonsynonymous SNV 0.995 1 21 hm6Am_associated_SNPs_22937 0 29500382 Experiencing mood swings 6e-10 GWAS_Catalog TagSNP rs28655666 GCST006944 Item-level analyses reveal genetic heterogeneity in neuroticism.
151 chr12 132325239 132325239 1 + G A rs6598163 132325239 + 132325219 132325259 41 TCCACGAGGTGGCGGGCAGCGCCGCCGACATCCAGATCGAC TCCACGAGGTGGCGGGCAGCACCGCCGACATCCAGATCGAC Direct Gain 0 0.777772784233093 Functional Gain 0.777772784233093 MMP17 ENSG00000198598 CDS Human protein_coding chr12:132325239 chr12:132325239 nonsynonymous SNV 0.001 0 21 hm6Am_associated_SNPs_23150 0 22683712 Migraine 5e-07 GWAS_Catalog TagSNP rs6598163 GCST001563 Genome-wide association analysis identifies susceptibility loci for migraine without aura.
152 chr13 24553861 24553861 1 + G A rs9510982 24553861 + 24553841 24553881 41 TGGGCGGGGAGCCAGAGACTGATTCGCTGCGGTCCTGGGCC TGGGCGGGGAGCCAGAGACTAATTCGCTGCGGTCCTGGGCC Direct Gain 0 0.982886672019958 Functional Gain 0.982886672019958 SPATA13 ENSG00000273167 UTR5 Human protein_coding chr13:24553861 chr13:24553861 . . 0 21 hm6Am_associated_SNPs_23322 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 3.1e-05 Johnson and O'Donnell TagSNP rs9510982 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
153 chr13 100638392 100638392 1 + G A rs13542 100638392 + 100638372 100638412 41 TGCGTTCCTCCCCGCCTTCCGCCCCTTCCCTTCCCTAAAGT TGCGTTCCTCCCCGCCTTCCACCCCTTCCCTTCCCTAAAGT Direct Gain 0 0.902147710323334 Functional Gain 0.902147710323334 ZIC2 ENSG00000043355 UTR3 Human protein_coding chr13:100638392 chr13:100638392 . . 0 21 hm6Am_associated_SNPs_23647 0 22863734 Orofacial clefts 1e-06 GWAS_Catalog TagSNP rs13542 GCST001628 Genome-wide meta-analyses of nonsyndromic cleft lip with or without cleft palate identify six new risk loci.
154 chr13 114623821 114623821 1 + G A rs41284486 114623821 + 114623801 114623841 41 GGCCATGCGTGGTGACCTGTGCCCACTGCATCGCTCCTGTG GGCCATGCGTGGTGACCTGTACCCACTGCATCGCTCCTGTG Direct Gain 0 0.883857846260071 Functional Gain 0.883857846260071 LINC00452 ENSG00000229373 ncRNA_exonic Human lincRNA chr13:114623821 chr13:114623821 . . 0 21 hm6Am_associated_SNPs_23819 0 30595370 Cardiovascular disease 1e-07 GWAS_Catalog TagSNP rs41284486 GCST007072 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
155 chr13 115047305 115047305 1 + G A rs3752105 115047305 + 115047285 115047325 41 CAAACCTCGCGAGGAGAAGAGGACGGCCCTGAGCAAGGTGG CAAACCTCGCGAGGAGAAGAAGACGGCCCTGAGCAAGGTGG Direct Gain 0 0.559875786304474 Functional Gain 0.559875786304474 UPF3A ENSG00000169062 CDS Human protein_coding chr13:115047305 chr13:115047305 nonsynonymous SNV 0.979 0 21 hm6Am_associated_SNPs_23832 0 30595370 Cardiovascular disease 8e-09 GWAS_Catalog TagSNP rs3752105 GCST007072 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
156 chr13 115090193 115090193 1 + G A rs3813133 115090193 + 115090173 115090213 41 TCTCCTGAACCTTGGAAGCCGTTCCCTGCTGTCTCCCCAGA TCTCCTGAACCTTGGAAGCCATTCCCTGCTGTCTCCCCAGA Direct Gain 0 0.913591146469116 Functional Gain 0.913591146469116 CHAMP1 ENSG00000198824 CDS Human protein_coding chr13:115090193 chr13:115090193 synonymous SNV . 0 21 hm6Am_associated_SNPs_23834 0 18057069 Amyotrophic Lateral Sclerosis (ALS) 1.67e-05 Johnson and O'Donnell TagSNP rs3813133 . A genome-wide association study of sporadic ALS in a homogenous Irish population.
157 chr14 23313633 23313633 1 + G A rs17880989 23313633 + 23313613 23313653 41 GTGATGGATGGATACCCAATGCCCATTGGCCAGTTCTGGCG GTGATGGATGGATACCCAATACCCATTGGCCAGTTCTGGCG Direct Gain 0 0.945126354694366 Functional Gain 0.945126354694366 MMP14 ENSG00000157227 CDS Human protein_coding chr14:23313633 chr14:23313633 nonsynonymous SNV 1.000 2 21 hm6Am_associated_SNPs_23912 0 30595370 Height 5e-15 GWAS_Catalog TagSNP rs17880989 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
158 chr14 23777099 23777099 1 + G A rs2231301 23777099 + 23777079 23777119 41 GAGGGCCCAGCAGCTGACCCGCTGCACCAAGCCATGCGGGC GAGGGCCCAGCAGCTGACCCACTGCACCAAGCCATGCGGGC Direct Gain 0 0.58925449848175 Functional Gain 0.58925449848175 BCL2L2;BCL2L2-PABPN1 ENSG00000129473;ENSG00000258643 CDS Human other chr14:23777099 chr14:23777099 synonymous SNV . 0 21 hm6Am_associated_SNPs_23934 0 28552196 Height 3e-07 GWAS_Catalog TagSNP rs2231301 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
159 chr14 24771285 24771285 1 + G A rs4280164 24771285 + 24771265 24771305 41 TGCTGTGATTGGCTACCTGAGTACTCGCGGTTCCTCAGTAG TGCTGTGATTGGCTACCTGAATACTCGCGGTTCCTCAGTAG Direct Gain 0 0.797265529632568 Functional Gain 0.797265529632568 NOP9 ENSG00000196943 CDS Human protein_coding chr14:24771285 chr14:24771285 nonsynonymous SNV 0.852 1 21 hm6Am_associated_SNPs_24030 0 24571439 Parent of origin effect on language impairment (paternal) 4e-08 GWAS_Catalog TagSNP rs4280164 GCST002371 Genome-wide association analyses of child genotype effects and parent-of-origin effects in specific language impairment.
160 chr14 71374702 71374702 1 + G A rs2526882 71374702 + 71374682 71374722 41 TGGCTCTTTCTGCTGGGCCTGCCCTTCACCCTCTACATGGT TGGCTCTTTCTGCTGGGCCTACCCTTCACCCTCTACATGGT Direct Gain 0 0.983417868614197 Functional Gain 0.983417868614197 PCNX1 ENSG00000100731 CDS Human protein_coding chr14:71374702 chr14:71374702 synonymous SNV . 0 21 hm6Am_associated_SNPs_24349 0 28991256 Schizophrenia 1e-06 GWAS_Catalog TagSNP rs2526882 GCST004946 Genome-wide association analysis identifies 30 new susceptibility loci for schizophrenia.
161 chr14 93118669 93118669 1 + G A rs3742716 93118669 + 93118649 93118689 41 TCAGACGGCCCTGAGGACACGCCCCGGGAGAGCACGGAGCA TCAGACGGCCCTGAGGACACACCCCGGGAGAGCACGGAGCA Direct Gain 0 0.934816956520081 Functional Gain 0.934816956520081 RIN3 ENSG00000100599 CDS Human protein_coding chr14:93118669 chr14:93118669 synonymous SNV . 0 21 hm6Am_associated_SNPs_24554 0 27863252 Sum basophil neutrophil counts 3e-12 GWAS_Catalog TagSNP rs3742716 GCST004620 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
162 chr15 29033909 29033909 1 + G A rs56166703 29033909 + 29033889 29033929 41 AGGGCGACGCCGCGGCCGCAGCCATGGGTGCTGGGCCTGCA AGGGCGACGCCGCGGCCGCAACCATGGGTGCTGGGCCTGCA Direct Gain 0 0.991474449634552 Functional Gain 0.991474449634552 LOC100289656 ENSG00000232431 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr15:29033909 chr15:29033909 . . 0 21 hm6Am_associated_SNPs_25139 0 30595370 Hair color 1e-245 GWAS_Catalog TagSNP rs56166703 GCST007082 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
163 chr15 63891961 63891961 1 + G A rs57017013 63891961 + 63891941 63891981 41 GCTCCCTCTGGCTGCGGGGAGCCAAGGCCCCGGCCCATTAG GCTCCCTCTGGCTGCGGGGAACCAAGGCCCCGGCCCATTAG Direct Gain 0 0.503699421882629 Functional Gain 0.503699421882629 USP3-AS1 ENSG00000259248 ncRNA_intronic Human antisense chr15:63891961 chr15:63891961 . . 0 21 hm6Am_associated_SNPs_25549 0 24324551 QRS duration in Tripanosoma cruzi seropositivity 2e-06 GWAS_Catalog TagSNP rs57017013 GCST002284 Genome wide association study (GWAS) of Chagas cardiomyopathy in Trypanosoma cruzi seropositive subjects.
164 chr15 65153690 65153690 1 + G A rs12595292 65153690 + 65153670 65153710 41 CTCCAGGTAAAGGTGGACAAGAGCTGCGCCCTGGAGCATGT CTCCAGGTAAAGGTGGACAAAAGCTGCGCCCTGGAGCATGT Direct Gain 0 0.61747670173645 Functional Gain 0.61747670173645 PLEKHO2 ENSG00000241839;ENSG00000249240 CDS Human other chr15:65153690 chr15:65153690 synonymous SNV . 0 21 hm6Am_associated_SNPs_25572 0 21347282 LDL cholesterol 9e-06 GWAS_Catalog TagSNP rs12595292 GCST000975 Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project.
165 chr15 74219582 74219582 1 + G A rs3825942 74219582 + 74219562 74219602 41 CTCCCAGCAACGGCACGGGGGCTCCGCCTCCTCGGTCTCGG CTCCCAGCAACGGCACGGGGACTCCGCCTCCTCGGTCTCGG Direct Gain 0 0.808651685714722 Functional Gain 0.808651685714722 LOXL1 ENSG00000129038 CDS Human protein_coding chr15:74219582 chr15:74219582 nonsynonymous SNV 0.982 1 21 hm6Am_associated_SNPs_25702 1 17690259 Glaucoma (exfoliation) 3e-21 GWAS_Catalog TagSNP rs3825942 GCST000067 Common sequence variants in the LOXL1 gene confer susceptibility to exfoliation glaucoma.
166 chr15 74466271 74466271 1 + G A rs923118 74466271 + 74466251 74466291 41 AAGTCCTCCCTTGGGCGCCCGTGGCCCTGCAGACTCTCAGG AAGTCCTCCCTTGGGCGCCCATGGCCCTGCAGACTCTCAGG Direct Gain 0 0.572539627552032 Functional Gain 0.572539627552032 ISLR ENSG00000261543 ncRNA_intronic Human antisense chr15:74466271 chr15:74466271 . . 0 21 hm6Am_associated_SNPs_25724 0 30072576 Blood protein levels 2e-11 GWAS_Catalog TagSNP rs923118 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
167 chr15 78833036 78833036 1 + C A rs57064725 78833036 + 78833016 78833056 41 CTCCTCTGTGACGGACCGACCGCCGGGAATGGCCCCCGCCG CTCCTCTGTGACGGACCGACAGCCGGGAATGGCCCCCGCCG Direct Gain 0 0.95805811882019 Functional Gain 0.95805811882019 PSMA4 ENSG00000041357 intronic Human protein_coding chr15:78833036 chr15:78833036 . . 0 21 hm6Am_associated_SNPs_25842 0 26634245 Post bronchodilator FEV1 6e-07 GWAS_Catalog TagSNP rs57064725 GCST003262 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
168 chr15 78857896 78857896 1 + T A rs503464 78857896 + 78857876 78857916 41 CCCGCCAGAAGCTGCTAGGCTGAGGCTGCTGTCCCGGCGGG CCCGCCAGAAGCTGCTAGGCAGAGGCTGCTGTCCCGGCGGG Direct Gain 0 0.963672757148743 Functional Gain 0.963672757148743 CHRNA5 ENSG00000169684 UTR5 Human protein_coding chr15:78857896 chr15:78857896 . . 0 21 hm6Am_associated_SNPs_25847 0 26030696 Emphysema imaging phenotypes 3e-07 GWAS_Catalog TagSNP rs503464 GCST002945 A Genome-Wide Association Study of Emphysema and Airway Quantitative Imaging Phenotypes.
169 chr15 91426560 91426560 1 + G A rs4702 91426560 + 91426540 91426580 41 CCCGGCTGGTTTTGTAAGATGCTGGGTTGGTGCACAGTGAT CCCGGCTGGTTTTGTAAGATACTGGGTTGGTGCACAGTGAT Direct Gain 0 0.699255585670471 Functional Gain 0.699255585670471 FURIN ENSG00000140564 UTR3 Human protein_coding chr15:91426560 chr15:91426560 . . 0 21 hm6Am_associated_SNPs_26092 0 29500382 Feeling hurt 2e-09 GWAS_Catalog TagSNP rs4702 GCST006951 Item-level analyses reveal genetic heterogeneity in neuroticism.
170 chr16 334580 334580 1 + G A rs432925 334580 + 334560 334600 41 AATGGGAACCGCACGCACCCGGAGGAGTACACAGGTGAGGG AATGGGAACCGCACGCACCCAGAGGAGTACACAGGTGAGGG Direct Gain 0 0.93257749080658 Functional Gain 0.93257749080658 PDIA2 ENSG00000185615 CDS Human protein_coding chr16:334580 chr16:334580 synonymous SNV . 0 21 hm6Am_associated_SNPs_26320 0 26835600 Morning vs. evening chronotype 6e-06 GWAS_Catalog TagSNP rs432925 GCST003429 GWAS of 89,283 individuals identifies genetic variants associated with self-reporting of being a morning person.
171 chr16 1129010 1129010 1 + C A rs4988483 1129010 + 1128990 1129030 41 TGCTGGTGCCCGTGCTGTACCTGCTGGTGTGTGCGGCCGGG TGCTGGTGCCCGTGCTGTACATGCTGGTGTGTGCGGCCGGG Direct Gain 0 0.98823344707489 Functional Gain 0.98823344707489 SSTR5 ENSG00000162009 CDS Human protein_coding chr16:1129010 chr16:1129010 nonsynonymous SNV 0.427 0 21 hm6Am_associated_SNPs_26593 0 30048462 Heel bone mineral density 2e-17 GWAS_Catalog TagSNP rs4988483 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
172 chr16 1250559 1250559 1 + T A rs8044363 1250559 + 1250539 1250579 41 AACATCGGCTACGCCTGGATTGCCATCTTCCAGGTGGGCGG AACATCGGCTACGCCTGGATAGCCATCTTCCAGGTGGGCGG Direct Gain 0 0.547132551670074 Functional Gain 0.547132551670074 CACNA1H ENSG00000196557 CDS Human protein_coding chr16:1250559 chr16:1250559 synonymous SNV . 0 21 hm6Am_associated_SNPs_26618 0 30038396 Self-reported math ability 8e-10 GWAS_Catalog TagSNP rs8044363 GCST006573 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
173 chr16 1252369 1252369 1 + C A rs61734410 1252369 + 1252349 1252389 41 GGGGAAGTGGGCCGGTGGACCGCCAGGCACCGGGGGGCACG GGGGAAGTGGGCCGGTGGACAGCCAGGCACCGGGGGGCACG Direct Gain 0 0.635448038578033 Functional Gain 0.635448038578033 CACNA1H ENSG00000196557 CDS Human protein_coding chr16:1252369 chr16:1252369 nonsynonymous SNV 0.001 1 21 hm6Am_associated_SNPs_26622 0 30038396 Educational attainment (MTAG) 6e-21 GWAS_Catalog TagSNP rs61734410 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
174 chr16 1291597 1291597 1 + C A rs144979264 1291597 + 1291577 1291617 41 GAGCTGGAGGAGCCGGTGAACGTCTCCAGCCACGTCCACAC GAGCTGGAGGAGCCGGTGAAAGTCTCCAGCCACGTCCACAC Direct Gain 0 0.837966322898865 Functional Gain 0.837966322898865 TPSAB1 ENSG00000172236 CDS Human protein_coding chr16:1291597 chr16:1291597 nonsynonymous SNV 0.004 1 21 hm6Am_associated_SNPs_26658 0 29875488 Blood protein levels 0 GWAS_Catalog TagSNP rs144979264 GCST005806 Genomic atlas of the human plasma proteome.
175 chr16 2512523 2512523 1 + G A rs3810794 2512523 + 2512503 2512543 41 CGCATGAGGGAGGAGCTCTCGGCAGGTCAGTGGGTCCTGGG CGCATGAGGGAGGAGCTCTCAGCAGGTCAGTGGGTCCTGGG Direct Gain 0 0.74365645647049 Functional Gain 0.74365645647049 C16orf59 ENSG00000162062 CDS Human protein_coding chr16:2512523 chr16:2512523 synonymous SNV . 0 21 hm6Am_associated_SNPs_26897 0 28552196 Height 1e-06 GWAS_Catalog TagSNP rs3810794 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
176 chr16 15129940 15129940 1 + C A rs3198697 15129940 + 15129920 15129960 41 GAGACCAGCTCAGTCAGTCACATTGAAGACTTAGAAAAGGT GAGACCAGCTCAGTCAGTCAAATTGAAGACTTAGAAAAGGT Direct Gain 0 0.698554396629333 Functional Gain 0.698554396629333 PDXDC1 ENSG00000179889 CDS Human protein_coding chr16:15129940 chr16:15129940 nonsynonymous SNV 0.948 1 21 hm6Am_associated_SNPs_27362 0 24097068 Triglycerides 2e-08 GWAS_Catalog TagSNP rs3198697 GCST002216 Discovery and refinement of loci associated with lipid levels.
177 chr16 21689879 21689879 1 + T A rs78970023 21689879 + 21689859 21689899 41 CTCCCTTTTCCTATTCCTTTTTCTGAGCCATGGAGTGTCGA CTCCCTTTTCCTATTCCTTTATCTGAGCCATGGAGTGTCGA Direct Gain 0 0.865490794181824 Functional Gain 0.865490794181824 OTOA ENSG00000155719 CDS Human protein_coding chr16:21689879 chr16:21689879 nonsynonymous SNV 0.426 1 21 hm6Am_associated_SNPs_27452 1 29378355 Thrombin-activatable fibrinolysis inhibitor activation peptide 5e-07 GWAS_Catalog TagSNP rs78970023 GCST005411 A Genome-wide Study of Common and Rare Genetic Variants Associated with Circulating Thrombin Activatable Fibrinolysis Inhibitor.
178 chr16 30546488 30546488 1 + G A rs6565191 30546488 + 30546468 30546508 41 TCGGACTTCAGCCCATCACTGTCTCGTTTTGTCCTCAGAAA TCGGACTTCAGCCCATCACTATCTCGTTTTGTCCTCAGAAA Direct Gain 0 0.939658582210541 Functional Gain 0.939658582210541 ZNF747 ENSG00000235560 ncRNA_exonic Human antisense chr16:30546488 chr16:30546488 . . 0 21 hm6Am_associated_SNPs_27728 0 17554300 Multiple complex diseases 0.00072162 Johnson and O'Donnell TagSNP rs6565191 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
179 chr16 31121793 31121793 1 + G A rs14235 31121793 + 31121773 31121813 41 GGAATCCGCATGTTGGCCACGCATCACCTGGCGCTGCATGA GGAATCCGCATGTTGGCCACACATCACCTGGCGCTGCATGA Direct Gain 0 0.544037997722626 Functional Gain 0.544037997722626 BCKDK ENSG00000103507 CDS Human protein_coding chr16:31121793 chr16:31121793 synonymous SNV . 0 21 hm6Am_associated_SNPs_27794 1 28892059 Parkinson's disease 5e-12 GWAS_Catalog TagSNP rs14235 GCST004902 A meta-analysis of genome-wide association studies identifies 17 new Parkinson's disease risk loci.
180 chr16 31276811 31276811 1 + G A rs1143679 31276811 + 31276791 31276831 41 AGGCTCATGCGAGCCCATCCGCCTGCAGGGTGAGTCACTGC AGGCTCATGCGAGCCCATCCACCTGCAGGGTGAGTCACTGC Direct Gain 0 0.854442358016968 Functional Gain 0.854442358016968 ITGAM ENSG00000169896 CDS Human protein_coding chr16:31276811 chr16:31276811 nonsynonymous SNV 0.548 0 21 hm6Am_associated_SNPs_27805 0 27399966 Systemic lupus erythematosus 5e-48 GWAS_Catalog TagSNP rs1143679 GCST003622 Genome-wide association meta-analysis in Chinese and European individuals identifies ten new loci associated with systemic lupus erythematosus.
181 chr16 50757276 50757276 1 + G A rs5743291 50757276 + 50757256 50757296 41 CACTGATGCTGGCAAAGAACGTCATGCTAGAAGAACTCTGG CACTGATGCTGGCAAAGAACATCATGCTAGAAGAACTCTGG Direct Gain 0 0.616027355194092 Functional Gain 0.616027355194092 NOD2 ENSG00000167207 CDS Human protein_coding chr16:50757276 chr16:50757276 nonsynonymous SNV 0.005 1 21 hm6Am_associated_SNPs_27882 3 17804789 Crohn's disease 1e-20 Johnson and O'Donnell TagSNP rs5743291 . Genome-wide association study for Crohn's disease in the Quebec Founder Population identifies multiple validated disease loci.
182 chr16 66638245 66638245 1 + G A rs35320143 66638245 + 66638225 66638265 41 GCCCCCAAGAAAAAGAGAGGGCATGGGTTGCGGAGCCGACA GCCCCCAAGAAAAAGAGAGGACATGGGTTGCGGAGCCGACA Direct Gain 0 0.559983968734741 Functional Gain 0.559983968734741 CMTM3 ENSG00000140931 UTR5 Human protein_coding chr16:66638245 chr16:66638245 . . 0 21 hm6Am_associated_SNPs_28069 0 25742292 Number of children (6+ vs. 0 or 1) 9e-06 GWAS_Catalog TagSNP rs35320143 GCST002800 Genome-wide association study of parity in Bangladeshi women.
183 chr16 69975360 69975360 1 + G A rs1052429 69975360 + 69975340 69975380 41 GCTTAGCTTGCCACAGCGCAGCCTCTTCTGTCCCTTTCAGT GCTTAGCTTGCCACAGCGCAACCTCTTCTGTCCCTTTCAGT Direct Gain 0 0.727875888347626 Functional Gain 0.727875888347626 WWP2 ENSG00000198373 UTR3 Human protein_coding chr16:69975360 chr16:69975360 . . 0 21 hm6Am_associated_SNPs_28219 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0003932 Johnson and O'Donnell TagSNP rs1052429 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
184 chr16 89985918 89985918 1 + C A rs1805006 89985918 + 89985898 89985938 41 TGCTGCCTGGCCTTGTCGGACCTGCTGGTGAGCGGGAGCAA TGCTGCCTGGCCTTGTCGGAACTGCTGGTGAGCGGGAGCAA Direct Gain 0 0.862114310264587 Functional Gain 0.862114310264587 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89985918 chr16:89985918 nonsynonymous SNV 0.816 4 21 hm6Am_associated_SNPs_28873 3 30531825 Red vs. brown/black hair color 2e-308 GWAS_Catalog TagSNP rs1805006 GCST006986 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
185 chr16 89985940 89985940 1 + G A rs2228479 89985940 + 89985920 89985960 41 TGCTGGTGAGCGGGAGCAACGTGCTGGAGACGGCCGTCATC TGCTGGTGAGCGGGAGCAACATGCTGGAGACGGCCGTCATC Direct Gain 0 0.876898229122162 Functional Gain 0.876898229122162 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89985940 chr16:89985940 nonsynonymous SNV 0.138 0 21 hm6Am_associated_SNPs_28874 4 17999355 Skin pigmentation 0.00068 Johnson and O'Donnell TagSNP rs2228479 . A genomewide association study of skin pigmentation in a South Asian population.
186 chr16 89986091 89986091 1 + G A rs11547464 89986091 + 89986071 89986111 41 GGGCGCCATCGCCGTGGACCGCTACATCTCCATCTTCTACG GGGCGCCATCGCCGTGGACCACTACATCTCCATCTTCTACG Direct Gain 0 0.901975095272064 Functional Gain 0.901975095272064 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89986091 chr16:89986091 nonsynonymous SNV 0.307 4 21 hm6Am_associated_SNPs_28876 2 30531825 Blond vs. brown/black hair color 3e-50 GWAS_Catalog TagSNP rs11547464 GCST006988 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
187 chr16 89986117 89986117 1 + C A rs1805007 89986117 + 89986097 89986137 41 TCTCCATCTTCTACGCACTGCGCTACCACAGCATCGTGACC TCTCCATCTTCTACGCACTGAGCTACCACAGCATCGTGACC Direct Gain 0 0.89733874797821 Functional Gain 0.89733874797821 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89986117 chr16:89986117 nonsynonymous SNV 0.461 3 21 hm6Am_associated_SNPs_28877 0 23548203 Tanning 1e-65 GWAS_Catalog TagSNP rs1805007 GCST001939 Genome-wide association studies identify several new loci associated with pigmentation traits and skin cancer risk in European Americans.
188 chr16 89998794 89998794 1 + G A rs2302898 89998794 + 89998774 89998814 41 GGACGTGTAGGTGTGGAGGTGCATATTTATTATGGCAATTT GGACGTGTAGGTGTGGAGGTACATATTTATTATGGCAATTT Direct Gain 0 0.6219482421875 Functional Gain 0.6219482421875 TUBB3 ENSG00000258947 UTR5 Human protein_coding chr16:89998794 chr16:89998794 . . 0 21 hm6Am_associated_SNPs_28889 0 30531825 Red vs. brown/black hair color 3e-103 GWAS_Catalog TagSNP rs2302898 GCST006986 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
189 chr17 4837195 4837195 1 + C A rs553749201 4837195 + 4837175 4837215 41 CCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCCAGAGCC CCCACCTCAGAGCCCGCCCCAAGCCCGACCACCCCAGAGCC Direct Gain 0 0.65474933385849 Functional Gain 0.65474933385849 GP1BA ENSG00000185245 CDS Human protein_coding chr17:4837195 chr17:4837195 synonymous SNV . 0 21 hm6Am_associated_SNPs_29172 0 27863252 Mean platelet volume 8e-10 GWAS_Catalog TagSNP rs553749201 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
190 chr17 7185062 7185062 1 + C A rs5417 7185062 + 7185042 7185082 41 TTCCCCCAGCCCCGCTCCACCAGATCCGCGGGAGCCCCACT TTCCCCCAGCCCCGCTCCACAAGATCCGCGGGAGCCCCACT Direct Gain 0 0.988721132278442 Functional Gain 0.988721132278442 SLC2A4 ENSG00000181856 UTR5 Human protein_coding chr17:7185062 chr17:7185062 . . 0 21 hm6Am_associated_SNPs_29262 0 28135244 Diastolic blood pressure 1e-13 GWAS_Catalog TagSNP rs5417 GCST004280 Genome-wide association analysis identifies novel blood pressure loci and offers biological insights into cardiovascular risk.
191 chr17 7185092 7185092 1 + G A rs5418 7185092 + 7185072 7185112 41 GGAGCCCCACTGCTCTCCGGGTCCTTGGCTTGTGGCTGTGG GGAGCCCCACTGCTCTCCGGATCCTTGGCTTGTGGCTGTGG Direct Gain 0 0.69611644744873 Functional Gain 0.69611644744873 SLC2A4 ENSG00000181856 UTR5 Human protein_coding chr17:7185092 chr17:7185092 . . 0 21 hm6Am_associated_SNPs_29264 0 30595370 Systolic blood pressure 7e-19 GWAS_Catalog TagSNP rs5418 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
192 chr17 7484782 7484782 1 + G A rs17607 7484782 + 7484762 7484802 41 TCCTCGCCCTGGTGCTTATTGCTTTCTGCATCATCCGGAGA TCCTCGCCCTGGTGCTTATTACTTTCTGCATCATCCGGAGA Direct Gain 0 0.875822007656097 Functional Gain 0.875822007656097 CD68 ENSG00000129226 CDS Human protein_coding chr17:7484782 chr17:7484782 nonsynonymous SNV 0.034 0 21 hm6Am_associated_SNPs_29337 0 26634245 Post bronchodilator FEV1/FVC ratio 4e-06 GWAS_Catalog TagSNP rs17607 GCST003264 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
193 chr17 7754993 7754993 1 + G A rs12939056 7754993 + 7754973 7755013 41 CCCCAGCTGCAGGAGCTGCTGAAGCTGCCCGCCTTCATGCG CCCCAGCTGCAGGAGCTGCTAAAGCTGCCCGCCTTCATGCG Direct Gain 0 0.858403205871582 Functional Gain 0.858403205871582 KDM6B ENSG00000132510 CDS Human protein_coding chr17:7754993 chr17:7754993 synonymous SNV . 0 21 hm6Am_associated_SNPs_29372 0 29782485 Height 8e-07 GWAS_Catalog TagSNP rs12939056 GCST005908 Evaluation and application of summary statistic imputation to discover new height-associated loci.
194 chr17 7758522 7758522 1 + C A rs2270518 7758522 + 7758502 7758542 41 TGGTGGCTGCCTTCAATCTTCTCCTGCTGGTGCTGGTGCTA TGGTGGCTGCCTTCAATCTTATCCTGCTGGTGCTGGTGCTA Direct Gain 0 0.828254699707031 Functional Gain 0.828254699707031 TMEM88 ENSG00000167874 CDS Human protein_coding chr17:7758522 chr17:7758522 nonsynonymous SNV 0.992 0 21 hm6Am_associated_SNPs_29377 0 25429064 Height 8e-10 GWAS_Catalog TagSNP rs2270518 GCST002702 Meta-analysis of genome-wide association studies of adult height in East Asians identifies 17 novel loci.
195 chr17 17696755 17696755 1 + C A rs11649804 17696755 + 17696735 17696775 41 CAGAGCAGGGCGCCCAGGTGCCCTTTCGGACTCACTCCCTG CAGAGCAGGGCGCCCAGGTGACCTTTCGGACTCACTCCCTG Direct Gain 0 0.652145028114319 Functional Gain 0.652145028114319 RAI1 ENSG00000108557 CDS Human protein_coding chr17:17696755 chr17:17696755 nonsynonymous SNV 0.996 4 21 hm6Am_associated_SNPs_29571 1 28928442 Myringotomy 3e-07 GWAS_Catalog TagSNP rs11649804 GCST005015 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
196 chr17 38173143 38173143 1 + G A rs25645 38173143 + 38173123 38173163 41 CGCCGGGCAGGAGGGGTCCTGGTTGCCTCCCATCTGCAGAG CGCCGGGCAGGAGGGGTCCTAGTTGCCTCCCATCTGCAGAG Direct Gain 0 0.948474526405334 Functional Gain 0.948474526405334 CSF3 ENSG00000108342 CDS Human protein_coding chr17:38173143 chr17:38173143 synonymous SNV . 0 21 hm6Am_associated_SNPs_30030 0 27863252 Myeloid white cell count 6e-191 GWAS_Catalog TagSNP rs25645 GCST004626 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
197 chr17 40985648 40985648 1 + C A rs139945697 40985648 + 40985628 40985668 41 CGGACACGGCCCGGCCCGGCCATGGCCTCGTTGCTGAAGGT CGGACACGGCCCGGCCCGGCAATGGCCTCGTTGCTGAAGGT Direct Gain 0 0.898100733757019 Functional Gain 0.898100733757019 PSME3 ENSG00000131467 UTR5 Human protein_coding chr17:40985648 chr17:40985648 . . 0 21 hm6Am_associated_SNPs_30139 0 30595370 Waist-hip ratio 4e-08 GWAS_Catalog TagSNP rs139945697 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
198 chr17 44828931 44828931 1 + G A rs199533 44828931 + 44828911 44828951 41 CAGCAAGTCAAAGGGAAGAAGGTCTGGATAGGAATCAAGAA CAGCAAGTCAAAGGGAAGAAAGTCTGGATAGGAATCAAGAA Direct Gain 0 0.725609660148621 Functional Gain 0.725609660148621 NSF ENSG00000073969 CDS Human protein_coding chr17:44828931 chr17:44828931 synonymous SNV . 0 21 hm6Am_associated_SNPs_30303 0 20711177 Parkinson's disease 1e-06 GWAS_Catalog TagSNP rs199533 GCST000772 Common genetic variation in the HLA region is associated with late-onset sporadic Parkinson's disease.
199 chr17 58755262 58755262 1 + C A rs117023868 58755262 + 58755242 58755282 41 AGCTGGAGACTAGCGTTAACCGGCGGGGCGGCCGGTGAGAG AGCTGGAGACTAGCGTTAACAGGCGGGGCGGCCGGTGAGAG Direct Gain 0 0.984149634838104 Functional Gain 0.984149634838104 BCAS3 ENSG00000141376 UTR5 Human protein_coding chr17:58755262 chr17:58755262 . . 0 21 hm6Am_associated_SNPs_30589 0 30595370 Red cell distribution width 3e-08 GWAS_Catalog TagSNP rs117023868 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
200 chr17 58824617 58824617 1 + G A rs34431714 58824617 + 58824597 58824637 41 TGGCCCAATTCGAGCGGCTAGAATCTTGCCTGCTCCACAGT TGGCCCAATTCGAGCGGCTAAAATCTTGCCTGCTCCACAGT Direct Gain 0 0.874362468719482 Functional Gain 0.874362468719482 BCAS3 ENSG00000141376 CDS Human protein_coding chr17:58824617 chr17:58824617 nonsynonymous SNV 0.998 3 21 hm6Am_associated_SNPs_30590 0 27989323 Interleukin-2 levels 6e-06 GWAS_Catalog TagSNP rs34431714 GCST004455 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
201 chr17 72469966 72469966 1 + G A rs2272111 72469966 + 72469946 72469986 41 GGTGGATACACCATGGCTCCGAGACTTTCATGATCCCGTTG GGTGGATACACCATGGCTCCAAGACTTTCATGATCCCGTTG Direct Gain 0 0.888622879981995 Functional Gain 0.888622879981995 CD300A ENSG00000167851 CDS Human protein_coding chr17:72469966 chr17:72469966 nonsynonymous SNV 0.000 0 21 hm6Am_associated_SNPs_30813 0 30072576 Blood protein levels 1e-52 GWAS_Catalog TagSNP rs2272111 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
202 chr17 73687495 73687495 1 + G A rs820218 73687495 + 73687475 73687515 41 GACGTGACTCAACAACCTCAGCTGAGCCTGGCAGCACACAC GACGTGACTCAACAACCTCAACTGAGCCTGGCAGCACACAC Direct Gain 0 0.8104088306427 Functional Gain 0.8104088306427 SAP30BP ENSG00000161526 intronic Human protein_coding chr17:73687495 chr17:73687495 . . 0 21 hm6Am_associated_SNPs_30960 0 26350878 Rotator cuff tears 4e-09 GWAS_Catalog TagSNP rs820218 GCST003115 Genome-wide association study for rotator cuff tears identifies two significant single-nucleotide polymorphisms.
203 chr17 74381555 74381555 1 + G A rs2247856 74381555 + 74381535 74381575 41 CAGCCGCCGCAGGGAATGACGCCGGTGCTCCTGCAGCCACG CAGCCGCCGCAGGGAATGACACCGGTGCTCCTGCAGCCACG Direct Gain 0 0.977170407772064 Functional Gain 0.977170407772064 SPHK1 ENSG00000176170 CDS Human protein_coding chr17:74381555 chr17:74381555 nonsynonymous SNV 0.294 1 21 hm6Am_associated_SNPs_30995 0 27863252 Reticulocyte fraction of red cells 2e-27 GWAS_Catalog TagSNP rs2247856 GCST004619 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
204 chr17 79419025 79419025 1 + G A rs35572189 79419025 + 79419005 79419045 41 CCTGAAGGCCGCCATCGACCGGCTGGACACGCAGGAGGTGG CCTGAAGGCCGCCATCGACCAGCTGGACACGCAGGAGGTGG Direct Gain 0 0.890960812568665 Functional Gain 0.890960812568665 BAHCC1 ENSG00000171282 CDS Human other chr17:79419025 chr17:79419025 nonsynonymous SNV 1.000 0 21 hm6Am_associated_SNPs_31391 0 30220432 Urinary albumin excretion 1e-09 GWAS_Catalog TagSNP rs35572189 GCST006586 Genetic Association of Albuminuria with Cardiometabolic Disease and Blood Pressure.
205 chr17 79954544 79954544 1 + T A rs8074498 79954544 + 79954524 79954564 41 CTCGGGTGGGGGACAGAGACTGGGGGGCCCTCCTGGGCCCA CTCGGGTGGGGGACAGAGACAGGGGGGCCCTCCTGGGCCCA Direct Gain 0 0.920233011245728 Functional Gain 0.920233011245728 ASPSCR1 ENSG00000169696 CDS Human protein_coding chr17:79954544 chr17:79954544 nonsynonymous SNV 0.876 3 21 hm6Am_associated_SNPs_31475 0 30595370 Red blood cell count 6e-10 GWAS_Catalog TagSNP rs8074498 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
206 chr18 42456653 42456653 1 + G A rs663651 42456653 + 42456633 42456673 41 GCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACT GCCCCCGGAACCCATTCCCCACAAAACCCGGTTCTCTCACT Direct Gain 0 0.931626737117767 Functional Gain 0.931626737117767 SETBP1 ENSG00000152217 CDS Human protein_coding chr18:42456653 chr18:42456653 nonsynonymous SNV 0.008 1 21 hm6Am_associated_SNPs_31819 1 30012220 QRS duration 4e-33 GWAS_Catalog TagSNP rs663651 GCST007104 Exome-chip meta-analysis identifies novel loci associated with cardiac conduction, including ADAMTS6.
207 chr18 77156171 77156171 1 + G A rs74183647 77156171 + 77156151 77156191 41 GACCCCGGCAGCGCGGGGCGGCCGCTTCTCCTGTGCCTCCG GACCCCGGCAGCGCGGGGCGACCGCTTCTCCTGTGCCTCCG Direct Gain 0 0.983467936515808 Functional Gain 0.983467936515808 NFATC1 ENSG00000131196 UTR5 Human protein_coding chr18:77156171 chr18:77156171 . . 0 21 hm6Am_associated_SNPs_32061 0 29779033 Estimated glomerular filtration rate 2e-11 GWAS_Catalog TagSNP rs74183647 GCST006392 Genome-Wide Association Study of Renal Function Traits: Results from the Japan Multi-Institutional Collaborative Cohort Study.
208 chr19 577782 577782 1 + G A rs144824657 577782 + 577762 577802 41 CTCTCCCCACAGCCGGCTTCGTCCAGGCGCCGCTGTCCCAG CTCTCCCCACAGCCGGCTTCATCCAGGCGCCGCTGTCCCAG Direct Gain 0 0.980807781219482 Functional Gain 0.980807781219482 BSG ENSG00000172270 CDS Human protein_coding chr19:577782 chr19:577782 nonsynonymous SNV 0.000 0 21 hm6Am_associated_SNPs_32149 0 28881265 Endometriosis 1e-06 GWAS_Catalog TagSNP rs144824657 GCST004873 New variants near RHOJ and C2, HLA-DRA region and susceptibility to endometriosis in the Polish population-The genome-wide association study.
209 chr19 844020 844020 1 + G A rs351111 844020 + 844000 844040 41 CGGAGAACAAACTGAACGACGTTCTCCTCATCCAGGTGGGC CGGAGAACAAACTGAACGACATTCTCCTCATCCAGGTGGGC Direct Gain 0 0.970613121986389 Functional Gain 0.970613121986389 PRTN3 ENSG00000196415 CDS Human protein_coding chr19:844020 chr19:844020 nonsynonymous SNV 0.001 0 21 hm6Am_associated_SNPs_32216 0 29875488 Blood protein levels 4e-66 GWAS_Catalog TagSNP rs351111 GCST005806 Genomic atlas of the human plasma proteome.
210 chr19 1049305 1049305 1 + C A rs4147915 1049305 + 1049285 1049325 41 CCCGGCCTGAGTCCTGGCGTCTCCGTTCGCAGCCTGGAGAA CCCGGCCTGAGTCCTGGCGTATCCGTTCGCAGCCTGGAGAA Direct Gain 0 0.821048259735107 Functional Gain 0.821048259735107 ABCA7 ENSG00000064687 CDS Human protein_coding chr19:1049305 chr19:1049305 synonymous SNV . 0 21 hm6Am_associated_SNPs_32283 0 27863252 Myeloid white cell count 2e-11 GWAS_Catalog TagSNP rs4147915 GCST004626 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
211 chr19 1079959 1079959 1 + G A rs36084354 1079959 + 1079939 1079979 41 TACTACCAGATGATGCATATGCAGACGGCGCCGCTGCCCGT TACTACCAGATGATGCATATACAGACGGCGCCGCTGCCCGT Direct Gain 0 0.979687452316284 Functional Gain 0.979687452316284 ARHGAP45 ENSG00000180448 CDS Human protein_coding chr19:1079959 chr19:1079959 nonsynonymous SNV 0.999 0 21 hm6Am_associated_SNPs_32306 0 27863252 Neutrophil percentage of white cells 2e-12 GWAS_Catalog TagSNP rs36084354 GCST004633 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
212 chr19 1104078 1104078 1 + G A rs4807542 1104078 + 1104058 1104098 41 CTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCT CTTTGCCGCCTACTGAAGCCAGCGCTGCTCTGTGGGGCTCT Direct Gain 0 0.881485641002655 Functional Gain 0.881485641002655 GPX4 ENSG00000167468 CDS Human protein_coding chr19:1104078 chr19:1104078 unknown . 0 21 hm6Am_associated_SNPs_32320 0 27863252 Eosinophil percentage of granulocytes 3e-11 GWAS_Catalog TagSNP rs4807542 GCST004617 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
213 chr19 3150418 3150418 1 + C A rs2302063 3150418 + 3150398 3150438 41 TCCTGCTCCAGGATGAGGTCCTTCCAGGGGGACCCTAATTC TCCTGCTCCAGGATGAGGTCATTCCAGGGGGACCCTAATTC Direct Gain 0 0.907435655593872 Functional Gain 0.907435655593872 LOC100996351 ENSG00000267551 ncRNA_intronic Human antisense chr19:3150418 chr19:3150418 . . 0 21 hm6Am_associated_SNPs_32641 0 25524916 Glucose homeostasis traits 7e-08 GWAS_Catalog TagSNP rs2302063 GCST002726 Genetic Variants Associated With Quantitative Glucose Homeostasis Traits Translate to Type 2 Diabetes in Mexican Americans: The GUARDIAN (Genetics Underlying Diabetes in Hispanics) Consortium.
214 chr19 3927771 3927771 1 + G A rs10412199 3927771 + 3927751 3927791 41 ACCGTTCCCAGCTGGGCCACGACCTGCACCGTCCACAGATG ACCGTTCCCAGCTGGGCCACAACCTGCACCGTCCACAGATG Direct Gain 0 0.776849150657654 Functional Gain 0.776849150657654 MIR1268A ENSG00000167654 UTR3 Human protein_coding chr19:3927771 chr19:3927771 . . 0 21 hm6Am_associated_SNPs_32732 1 21782286 Aging (time to event) 3e-06 GWAS_Catalog TagSNP rs10412199 GCST001166 A genome-wide association study of aging.
215 chr19 5823903 5823903 1 + G A rs3763046 5823903 + 5823883 5823923 41 TCTGCCTGGCCAACTCCTACGTTTATTCAAGTCTGGACCTT TCTGCCTGGCCAACTCCTACATTTATTCAAGTCTGGACCTT Direct Gain 0 0.775893211364746 Functional Gain 0.775893211364746 NRTN ENSG00000171119 UTR5 Human protein_coding chr19:5823903 chr19:5823903 . . 0 21 hm6Am_associated_SNPs_32850 0 18178869 Minor histocompatibility antigenicity 0.01 Johnson and O'Donnell TagSNP rs3763046 . Identification of human minor histocompatibility antigens based on genetic association with highly parallel genotyping of pooled DNA.
216 chr19 7536221 7536221 1 + G A rs7245775 7536221 + 7536201 7536241 41 AGTGAGCTGTTGCAGCTTACGGTCCGTTCCCTGGAGGGGTG AGTGAGCTGTTGCAGCTTACAGTCCGTTCCCTGGAGGGGTG Direct Gain 0 0.979432344436646 Functional Gain 0.979432344436646 ARHGEF18 ENSG00000104880 UTR3 Human protein_coding chr19:7536221 chr19:7536221 . . 0 21 hm6Am_associated_SNPs_32920 0 17554300 Multiple complex diseases 0.000374166 Johnson and O'Donnell TagSNP rs7245775 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
217 chr19 8429323 8429323 1 + G A rs116843064 8429323 + 8429303 8429343 41 CGCGCTTTGCGTCCTGGGACGAGATGAATGTCCTGGCGCAC CGCGCTTTGCGTCCTGGGACAAGATGAATGTCCTGGCGCAC Direct Gain 0 0.849641442298889 Functional Gain 0.849641442298889 ANGPTL4 ENSG00000167772 CDS Human protein_coding chr19:8429323 chr19:8429323 nonsynonymous SNV 1.000 3 21 hm6Am_associated_SNPs_33015 1 27036123 Triglycerides 4e-13 GWAS_Catalog TagSNP rs116843064 GCST003661 Meta-analysis of 49 549 individuals imputed with the 1000 Genomes Project reveals an exonic damaging variant in ANGPTL4 determining fasting TG levels.
218 chr19 9959014 9959014 1 + G A rs2287838 9959014 + 9958994 9959034 41 ACACAGGGAGGGGGGCTGCAGCACTTTCTTCCTGGCATCAT ACACAGGGAGGGGGGCTGCAACACTTTCTTCCTGGCATCAT Direct Gain 0 0.662896931171417 Functional Gain 0.662896931171417 PIN1 ENSG00000127445 UTR3 Human protein_coding chr19:9959014 chr19:9959014 . . 0 21 hm6Am_associated_SNPs_33049 0 30038396 Educational attainment (MTAG) 7e-13 GWAS_Catalog TagSNP rs2287838 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
219 chr19 10394792 10394792 1 + G A rs1799969 10394792 + 10394772 10394812 41 CCGTGGTCTGTTCCCTGGACGGGCTGTTCCCAGTCTCGGAG CCGTGGTCTGTTCCCTGGACAGGCTGTTCCCAGTCTCGGAG Direct Gain 0 0.748497009277344 Functional Gain 0.748497009277344 ICAM1 ENSG00000090339 CDS Human protein_coding chr19:10394792 chr19:10394792 nonsynonymous SNV 0.003 3 21 hm6Am_associated_SNPs_33084 0 28240269 Blood protein levels 8e-36 GWAS_Catalog TagSNP rs1799969 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
220 chr19 10801185 10801185 1 + G A rs8102380 10801185 + 10801165 10801205 41 AGGATGCTGTCAAGCATACTGTACTGCCCAGAACAGTGGCC AGGATGCTGTCAAGCATACTATACTGCCCAGAACAGTGGCC Direct Gain 0 0.591993391513824 Functional Gain 0.591993391513824 ILF3 ENSG00000129351 UTR3 Human protein_coding chr19:10801185 chr19:10801185 . . 0 21 hm6Am_associated_SNPs_33116 0 25282103 Height 8e-11 GWAS_Catalog TagSNP rs8102380 GCST002647 Defining the role of common variation in the genomic and biological architecture of adult human height.
221 chr19 11210912 11210912 1 + C A rs2228671 11210912 + 11210892 11210932 41 CTCTCAGTGGGCGACAGATGCGAAAGAAACGAGTTCCAGTG CTCTCAGTGGGCGACAGATGAGAAAGAAACGAGTTCCAGTG Direct Gain 0 0.830316305160522 Functional Gain 0.830316305160522 LDLR ENSG00000130164 CDS Human protein_coding chr19:11210912 chr19:11210912 stopgain 0.010 1 21 hm6Am_associated_SNPs_33162 1 19060911 LDL cholesterol 4e-14 GWAS_Catalog TagSNP rs2228671 GCST000282 Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts.
222 chr19 11350326 11350326 1 + G A rs59168178 11350326 + 11350306 11350346 41 CCTCAGTCATGCCAGTGCCTGCTCTGTGCCTGCTCTGGGCC CCTCAGTCATGCCAGTGCCTACTCTGTGCCTGCTCTGGGCC Direct Gain 0 0.927538335323334 Functional Gain 0.927538335323334 ANGPTL8 ENSG00000130173 CDS Human protein_coding chr19:11350326 chr19:11350326 nonsynonymous SNV 0.028 0 21 hm6Am_associated_SNPs_33172 0 30275531 Triglycerides 3e-14 GWAS_Catalog TagSNP rs59168178 GCST006613 Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program.
223 chr19 17392894 17392894 1 + G A rs8100241 17392894 + 17392874 17392914 41 AGGAGCTGCTGCGCTGCGGCGCGGACCCTAATTTGGTGCTA AGGAGCTGCTGCGCTGCGGCACGGACCCTAATTTGGTGCTA Direct Gain 0 0.87426495552063 Functional Gain 0.87426495552063 ANKLE1 ENSG00000160117 CDS Human protein_coding chr19:17392894 chr19:17392894 nonsynonymous SNV 0.145 3 21 hm6Am_associated_SNPs_33485 0 22976474 Breast cancer 4e-08 GWAS_Catalog TagSNP rs8100241 GCST001683 A meta-analysis of genome-wide association studies of breast cancer identifies two novel susceptibility loci at 6q14 and 20q11.
224 chr19 18285944 18285944 1 + G A rs11554159 18285944 + 18285924 18285964 41 AGCACTGTGCGGTGGCTGCCGAGCCTTCCTGATCCGGGAGC AGCACTGTGCGGTGGCTGCCAAGCCTTCCTGATCCGGGAGC Direct Gain 0 0.652896106243134 Functional Gain 0.652896106243134 IFI30 ENSG00000216490 CDS Human protein_coding chr19:18285944 chr19:18285944 nonsynonymous SNV 0.009 1 21 hm6Am_associated_SNPs_33607 0 24076602 Multiple sclerosis 2e-24 GWAS_Catalog TagSNP rs11554159 GCST005531 Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis.
225 chr19 18497141 18497141 1 + T A rs1059369 18497141 + 18497121 18497161 41 CGGGACCCTCAGAGTTGCACTCCGAAGACTCCAGATTCCGA CGGGACCCTCAGAGTTGCACACCGAAGACTCCAGATTCCGA Direct Gain 0 0.95148241519928 Functional Gain 0.95148241519928 GDF15 ENSG00000130513 CDS Human protein_coding chr19:18497141 chr19:18497141 nonsynonymous SNV 0.002 1 21 hm6Am_associated_SNPs_33618 0 29628937 Growth differentiation factor-15 levels (conditioned on rs888663) 2e-10 GWAS_Catalog TagSNP rs1059369 GCST005712 A Meta-Analysis of Genome-Wide Association Studies of Growth Differentiation Factor-15 Concentration in Blood.
226 chr19 18530161 18530161 1 + T A rs28375303 18530161 + 18530141 18530181 41 AGCTGCGCCCGCGGGCGGCGTAGAGGCAGCGGGCGGGGGCG AGCTGCGCCCGCGGGCGGCGAAGAGGCAGCGGGCGGGGGCG Direct Gain 0 0.986737012863159 Functional Gain 0.986737012863159 SSBP4 ENSG00000130511 UTR5 Human protein_coding chr19:18530161 chr19:18530161 . . 0 21 hm6Am_associated_SNPs_33621 0 27863252 Monocyte count 2e-10 GWAS_Catalog TagSNP rs28375303 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
227 chr19 36273534 36273534 1 + G A rs2291067 36273534 + 36273514 36273554 41 CCTGGGGAGGAGGAGCGTCTGGTGCGGGTGCACGATGTCAT CCTGGGGAGGAGGAGCGTCTAGTGCGGGTGCACGATGTCAT Direct Gain 0 0.923754930496216 Functional Gain 0.923754930496216 ARHGAP33 ENSG00000004777 CDS Human protein_coding chr19:36273534 chr19:36273534 synonymous SNV . 0 21 hm6Am_associated_SNPs_33987 0 31005965 Umami taste perception in obesity with metabolic syndrome 8e-06 GWAS_Catalog TagSNP rs2291067 GCST008022 Association between taste perception and adiposity in overweight or obese older subjects with metabolic syndrome and identification of novel taste-related genes.
228 chr19 41117300 41117300 1 + G A rs34093919 41117300 + 41117280 41117320 41 GGCCCGGGGCCCCCTGCCAAGGTGAGGGTGCTGAGCCCAGC GGCCCGGGGCCCCCTGCCAAAGTGAGGGTGCTGAGCCCAGC Direct Gain 0 0.693179845809937 Functional Gain 0.693179845809937 LTBP4 ENSG00000090006 CDS Human protein_coding chr19:41117300 chr19:41117300 nonsynonymous SNV 1.000 1 21 hm6Am_associated_SNPs_34279 1 30595370 Lung function (FEV1/FVC) 4e-48 GWAS_Catalog TagSNP rs34093919 GCST007080 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
229 chr19 41257046 41257046 1 + G A rs1455434 41257046 + 41257026 41257066 41 CAATGGGAATCGCCATTTAGGGTGCTCCGCCCACCGGGTCG CAATGGGAATCGCCATTTAGAGTGCTCCGCCCACCGGGTCG Direct Gain 0 0.834054946899414 Functional Gain 0.834054946899414 SNRPA ENSG00000077312 UTR5 Human protein_coding chr19:41257046 chr19:41257046 . . 0 21 hm6Am_associated_SNPs_34298 0 28240269 Blood protein levels 2e-28 GWAS_Catalog TagSNP rs1455434 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
230 chr19 45405499 45405499 1 + G A rs141864196 45405499 + 45405479 45405519 41 GAGACTGGTCTCCCTCTGTCGCCCAGGCTAGAGTGCAGCAG GAGACTGGTCTCCCTCTGTCACCCAGGCTAGAGTGCAGCAG Direct Gain 0 0.602655589580536 Functional Gain 0.602655589580536 TOMM40 ENSG00000130204 UTR3 Human protein_coding chr19:45405499 chr19:45405499 . . 0 21 hm6Am_associated_SNPs_34507 0 29777097 Family history of Alzheimer's disease 2e-06 GWAS_Catalog TagSNP rs141864196 GCST005921 GWAS on family history of Alzheimer's disease.
231 chr19 45406673 45406673 1 + G A rs10119 45406673 + 45406653 45406693 41 GGGGTCCCGGGAGGGATTCCGGAATTGAGGGGCACGCAGGA GGGGTCCCGGGAGGGATTCCAGAATTGAGGGGCACGCAGGA Direct Gain 0 0.558426260948181 Functional Gain 0.558426260948181 TOMM40 ENSG00000130204 UTR3 Human protein_coding chr19:45406673 chr19:45406673 . . 0 21 hm6Am_associated_SNPs_34508 0 29777097 Family history of Alzheimer's disease 1e-307 GWAS_Catalog TagSNP rs10119 GCST005921 GWAS on family history of Alzheimer's disease.
232 chr19 45807945 45807945 1 + G A rs12971645 45807945 + 45807925 45807965 41 GTCCAATGGAGGAGGCAGATGTGTCCTCAGGCAGCGACTGG GTCCAATGGAGGAGGCAGATATGTCCTCAGGCAGCGACTGG Direct Gain 0 0.759446978569031 Functional Gain 0.759446978569031 MARK4 ENSG00000007047 UTR3 Human protein_coding chr19:45807945 chr19:45807945 . . 0 21 hm6Am_associated_SNPs_34549 0 30595370 Body mass index 2e-08 GWAS_Catalog TagSNP rs12971645 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
233 chr19 46206262 46206262 1 + G A rs17850756 46206262 + 46206242 46206282 41 CCACCCACGGTACACAACTTGTGCCGCATTCTCGCTGTGTT CCACCCACGGTACACAACTTATGCCGCATTCTCGCTGTGTT Direct Gain 0 0.798479378223419 Functional Gain 0.798479378223419 QPCTL ENSG00000011478 CDS Human protein_coding chr19:46206262 chr19:46206262 synonymous SNV . 0 21 hm6Am_associated_SNPs_34589 0 29875488 Blood protein levels 2e-28 GWAS_Catalog TagSNP rs17850756 GCST005806 Genomic atlas of the human plasma proteome.
234 chr19 47548678 47548678 1 + G A rs889169 47548678 + 47548658 47548698 41 GTGCGGCCATGGGGCCTGGCGCCTCCCGGGGACCCCCCGCC GTGCGGCCATGGGGCCTGGCACCTCCCGGGGACCCCCCGCC Direct Gain 0 0.78857958316803 Functional Gain 0.78857958316803 NPAS1 ENSG00000130751 CDS Human protein_coding chr19:47548678 chr19:47548678 synonymous SNV . 0 21 hm6Am_associated_SNPs_34661 0 30038396 Cognitive performance 6e-09 GWAS_Catalog TagSNP rs889169 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
235 chr19 49132867 49132867 1 + G A rs61751862 49132867 + 49132847 49132887 41 CCTGGGCTGTCCGCAGCTGGGCTACGCCGCGGCCCGTGCCT CCTGGGCTGTCCGCAGCTGGACTACGCCGCGGCCCGTGCCT Direct Gain 0 0.850665092468262 Functional Gain 0.850665092468262 SPHK2 ENSG00000063176 CDS Human protein_coding chr19:49132867 chr19:49132867 nonsynonymous SNV 0.997 2 21 hm6Am_associated_SNPs_34794 0 30595370 Red cell distribution width 1e-13 GWAS_Catalog TagSNP rs61751862 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
236 chr19 49206462 49206462 1 + C A rs681343 49206462 + 49206442 49206482 41 GGCGAGTACGCCACACTGTACGCCCTGGCCAAGATGAACGG GGCGAGTACGCCACACTGTAAGCCCTGGCCAAGATGAACGG Direct Gain 0 0.856551468372345 Functional Gain 0.856551468372345 FUT2 ENSG00000176920 CDS Human protein_coding chr19:49206462 chr19:49206462 stopgain 0.010 0 21 hm6Am_associated_SNPs_34803 0 27182965 Childhood ear infection 4e-30 GWAS_Catalog TagSNP rs681343 GCST003991 Detection and interpretation of shared genetic influences on 42 human traits.
237 chr19 49206674 49206674 1 + G A rs601338 49206674 + 49206654 49206694 41 CACCGGCTACCCCTGCTCCTGGACCTTCTACCACCACCTCC CACCGGCTACCCCTGCTCCTAGACCTTCTACCACCACCTCC Direct Gain 0 0.843462944030762 Functional Gain 0.843462944030762 FUT2 ENSG00000176920 CDS Human protein_coding chr19:49206674 chr19:49206674 stopgain 1.000 0 21 hm6Am_associated_SNPs_34804 3 28928442 Number of common colds 4e-07 GWAS_Catalog TagSNP rs601338 GCST005019 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
238 chr19 49605705 49605705 1 + G A rs73046792 49605705 + 49605685 49605725 41 TTGGGTTCCACCCAGCCTCTGATGACCCGGCTTCGTGATGT TTGGGTTCCACCCAGCCTCTAATGACCCGGCTTCGTGATGT Direct Gain 0 0.913817286491394 Functional Gain 0.913817286491394 SNRNP70 ENSG00000104852 UTR3 Human protein_coding chr19:49605705 chr19:49605705 . . 0 21 hm6Am_associated_SNPs_34847 0 30595370 Systolic blood pressure 1e-17 GWAS_Catalog TagSNP rs73046792 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
239 chr19 50099218 50099218 1 + G A rs143035740 50099218 + 50099198 50099238 41 GGCCATTCCCCAGCGCTCTCGGGCCATGGGGGTGGCTGGGG GGCCATTCCCCAGCGCTCTCAGGCCATGGGGGTGGCTGGGG Direct Gain 0 0.97690612077713 Functional Gain 0.97690612077713 PRR12 ENSG00000126464 CDS Human protein_coding chr19:50099218 chr19:50099218 synonymous SNV . 0 21 hm6Am_associated_SNPs_34923 0 30595370 Lung function (FEV1/FVC) 2e-08 GWAS_Catalog TagSNP rs143035740 GCST007080 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
240 chr19 50168871 50168871 1 + G A rs2304206 50168871 + 50168851 50168891 41 GACGCCACCAACGCTCTCCCGGGCTCTTCCGCGTTACCTAC GACGCCACCAACGCTCTCCCAGGCTCTTCCGCGTTACCTAC Direct Gain 0 0.97527551651001 Functional Gain 0.97527551651001 BCL2L12 ENSG00000126453;ENSG00000126456 UTR5 Human other chr19:50168871 chr19:50168871 . . 0 21 hm6Am_associated_SNPs_34941 0 27723757 Vitiligo 2e-09 GWAS_Catalog TagSNP rs2304206 GCST004785 Genome-wide association studies of autoimmune vitiligo identify 23 new risk loci and highlight key pathways and regulatory variants.
241 chr19 55107308 55107308 1 + G A rs35534776 55107308 + 55107288 55107328 41 CACCCTGGGCCCTGTGAGCCGCTCCTACGGGGGCCAGTACA CACCCTGGGCCCTGTGAGCCACTCCTACGGGGGCCAGTACA Direct Gain 0 0.975662469863892 Functional Gain 0.975662469863892 LILRA1 ENSG00000104974 CDS Human protein_coding chr19:55107308 chr19:55107308 nonsynonymous SNV 0.001 0 21 hm6Am_associated_SNPs_35276 0 29875488 Blood protein levels 7e-107 GWAS_Catalog TagSNP rs35534776 GCST005806 Genomic atlas of the human plasma proteome.
242 chr19 56652592 56652592 1 + G A rs3745836 56652592 + 56652572 56652612 41 GTTGTTGGGCTGAACGAGCGGCTCGGAGTATGGGATTGGGG GTTGTTGGGCTGAACGAGCGACTCGGAGTATGGGATTGGGG Direct Gain 0 0.978290796279907 Functional Gain 0.978290796279907 ZNF444 ENSG00000167685 UTR5 Human protein_coding chr19:56652592 chr19:56652592 . . 0 21 hm6Am_associated_SNPs_35441 0 17554300 Multiple complex diseases 0.000864359 Johnson and O'Donnell TagSNP rs3745836 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
243 chr20 23017082 23017082 1 + T A rs2567608 23017082 + 23017062 23017102 41 CTCCGACAACTTCCGCCGATTCTTCCAGCGGGTTCTCTGCC CTCCGACAACTTCCGCCGATACTTCCAGCGGGTTCTCTGCC Direct Gain 0 0.97805643081665 Functional Gain 0.97805643081665 SSTR4 ENSG00000132671 CDS Human protein_coding chr20:23017082 chr20:23017082 nonsynonymous SNV 0.074 1 21 hm6Am_associated_SNPs_35861 0 18282107 Schizophrenia 0.006979535 Johnson and O'Donnell TagSNP rs2567608 . Genome-wide association identifies a common variant in the reelin gene that increases the risk of schizophrenia only in women.
244 chr20 25202892 25202892 1 + G A rs6037062 25202892 + 25202872 25202912 41 GGAGCATGGGTCTGTGGACCGTGGGAACCCTGGAAGCACTC GGAGCATGGGTCTGTGGACCATGGGAACCCTGGAAGCACTC Direct Gain 0 0.506986856460571 Functional Gain 0.506986856460571 ENTPD6 ENSG00000197586 intronic Human protein_coding chr20:25202892 chr20:25202892 . . 0 21 hm6Am_associated_SNPs_35883 0 30595370 Lung function (FVC) 5e-12 GWAS_Catalog TagSNP rs6037062 GCST007081 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
245 chr20 36977970 36977970 1 + G A rs1739654 36977970 + 36977950 36977990 41 GCGGCCCAGGAGGGGCTATTGGCTCTGCAGAGTGAGCTGCT GCGGCCCAGGAGGGGCTATTAGCTCTGCAGAGTGAGCTGCT Direct Gain 0 0.880431890487671 Functional Gain 0.880431890487671 LBP ENSG00000129988 CDS Human protein_coding chr20:36977970 chr20:36977970 synonymous SNV . 0 21 hm6Am_associated_SNPs_36125 0 23382691 IgG glycosylation 5e-06 GWAS_Catalog TagSNP rs1739654 GCST001848 Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers.
246 chr20 48568929 48568929 1 + G A rs6125829 48568929 + 48568909 48568949 41 TCGAGTTCGTATTGGTTCTCGGCTACTTCCTGGAGCTTCTG TCGAGTTCGTATTGGTTCTCAGCTACTTCCTGGAGCTTCTG Direct Gain 0 0.648500740528107 Functional Gain 0.648500740528107 RNF114 ENSG00000124226 UTR3 Human protein_coding chr20:48568929 chr20:48568929 . . 0 21 hm6Am_associated_SNPs_36317 0 17052657 Parkinson's disease 1.4e-05 Johnson and O'Donnell TagSNP rs6125829 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
247 chr20 48884124 48884124 1 + C A rs6125961 48884124 + 48884104 48884144 41 GCACCCAATTTAGGACCCCGCGGGGAGGCCCAAGCCCCGGG GCACCCAATTTAGGACCCCGAGGGGAGGCCCAAGCCCCGGG Direct Gain 0 0.57646906375885 Functional Gain 0.57646906375885 SMIM25 ENSG00000224397 ncRNA_exonic Human lincRNA chr20:48884124 chr20:48884124 . . 0 21 hm6Am_associated_SNPs_36325 0 27863252 Monocyte count 2e-57 GWAS_Catalog TagSNP rs6125961 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
248 chr20 62321128 62321128 1 + G A rs35640778 62321128 + 62321108 62321148 41 CTCTGGGCAGGAGTGGTACCGGCAGCAGGCGTCCAGGGCTG CTCTGGGCAGGAGTGGTACCAGCAGCAGGCGTCCAGGGCTG Direct Gain 0 0.534456074237823 Functional Gain 0.534456074237823 RTEL1 ENSG00000026036;ENSG00000258366 CDS Human other chr20:62321128 chr20:62321128 nonsynonymous SNV 0.989 1 21 hm6Am_associated_SNPs_36658 0 30595370 Mean corpuscular hemoglobin 3e-16 GWAS_Catalog TagSNP rs35640778 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
249 chr20 62327582 62327582 1 + G A rs2297441 62327582 + 62327562 62327602 41 GGACAGGGCTCTCTAATAAAGCTGCTGGCAGTGCCCAGGAC GGACAGGGCTCTCTAATAAAACTGCTGGCAGTGCCCAGGAC Direct Gain 0 0.576518893241882 Functional Gain 0.576518893241882 RTEL1-TNFRSF6B ENSG00000258366 UTR3 Human protein_coding chr20:62327582 chr20:62327582 . . 0 21 hm6Am_associated_SNPs_36666 0 21297633 Ulcerative colitis 2e-10 GWAS_Catalog TagSNP rs2297441 GCST000964 Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47.
250 chr20 62372706 62372706 1 + G A rs4809221 62372706 + 62372686 62372726 41 GGCTGGGTCACCCGCACCCCGCCCCCATCTCCTCCAGAGCC GGCTGGGTCACCCGCACCCCACCCCCATCTCCTCCAGAGCC Direct Gain 0 0.611286520957947 Functional Gain 0.611286520957947 SLC2A4RG ENSG00000125520 intronic Human protein_coding chr20:62372706 chr20:62372706 . . 0 21 hm6Am_associated_SNPs_36679 0 30595370 Lung function (FVC) 4e-36 GWAS_Catalog TagSNP rs4809221 GCST007081 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
251 chr21 34925689 34925689 1 + G A rs61739710 34925689 + 34925669 34925709 41 TCTTCGACTGTAACTGTCCTGGAGCCTTCGGTTGTGACTGT TCTTCGACTGTAACTGTCCTAGAGCCTTCGGTTGTGACTGT Direct Gain 0 0.520570695400238 Functional Gain 0.520570695400238 SON ENSG00000159140 CDS Human protein_coding chr21:34925689 chr21:34925689 synonymous SNV . 0 21 hm6Am_associated_SNPs_36853 0 30038396 Educational attainment (years of education) 4e-10 GWAS_Catalog TagSNP rs61739710 GCST006442 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
252 chr21 42694870 42694870 1 + G A rs2838012 42694870 + 42694850 42694890 41 GCCTGCTCAAGGTGGTGTTCGTGGTCTTCGCCTCCTTGTGT GCCTGCTCAAGGTGGTGTTCATGGTCTTCGCCTCCTTGTGT Direct Gain 0 0.905438423156738 Functional Gain 0.905438423156738 FAM3B ENSG00000183844 CDS Human protein_coding chr21:42694870 chr21:42694870 nonsynonymous SNV 0.000 0 21 hm6Am_associated_SNPs_36948 0 29875488 Blood protein levels 8e-26 GWAS_Catalog TagSNP rs2838012 GCST005806 Genomic atlas of the human plasma proteome.
253 chr21 46875775 46875775 1 + G A rs114139997 46875775 + 46875755 46875795 41 AGGAGAACATTGCCGGTGTCGGAGCCGAGATCCTGAACGTG AGGAGAACATTGCCGGTGTCAGAGCCGAGATCCTGAACGTG Direct Gain 0 0.623267292976379 Functional Gain 0.623267292976379 COL18A1 ENSG00000182871 CDS Human protein_coding chr21:46875775 chr21:46875775 nonsynonymous SNV 0.299 2 21 hm6Am_associated_SNPs_37237 0 30275531 Triglycerides 1e-28 GWAS_Catalog TagSNP rs114139997 GCST006613 Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program.
254 chr21 46930092 46930092 1 + G A rs144147445 46930092 + 46930072 46930112 41 GGCTGGCGGGCACCTTCCGCGCCTTCCTGTCCTCGCGCCTG GGCTGGCGGGCACCTTCCGCACCTTCCTGTCCTCGCGCCTG Direct Gain 0 0.574744522571564 Functional Gain 0.574744522571564 COL18A1 ENSG00000182871 CDS Human protein_coding chr21:46930092 chr21:46930092 nonsynonymous SNV 0.982 3 21 hm6Am_associated_SNPs_37254 1 29875488 Blood protein levels 6e-44 GWAS_Catalog TagSNP rs144147445 GCST005806 Genomic atlas of the human plasma proteome.
255 chr21 46931109 46931109 1 + G A rs12483377 46931109 + 46931089 46931129 41 GGGCACGCATCTTCTCCTTTGACGGCAAGGACGTCCTGAGG GGGCACGCATCTTCTCCTTTAACGGCAAGGACGTCCTGAGG Direct Gain 0 0.702795684337616 Functional Gain 0.702795684337616 COL18A1 ENSG00000182871 CDS Human protein_coding chr21:46931109 chr21:46931109 nonsynonymous SNV 0.595 3 21 hm6Am_associated_SNPs_37258 2 29875488 Blood protein levels 0 GWAS_Catalog TagSNP rs12483377 GCST005806 Genomic atlas of the human plasma proteome.
256 chr22 17591089 17591089 1 + G A rs2895332 17591089 + 17591069 17591109 41 ACCGCTAGTGCCGAGGACACGTTAAACGAACAGGATGGGCC ACCGCTAGTGCCGAGGACACATTAAACGAACAGGATGGGCC Direct Gain 0 0.939805388450623 Functional Gain 0.939805388450623 IL17RA ENSG00000177663 UTR3 Human protein_coding chr22:17591089 chr22:17591089 . . 0 21 hm6Am_associated_SNPs_37428 1 17463246 Multiple continuous traits in DGI samples 0.0006142 Johnson and O'Donnell TagSNP rs2895332 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
257 chr22 18518634 18518634 1 + G A rs4819660 18518634 + 18518614 18518654 41 TCTCCTGTTCTGCAGTCCTCGTCTGATTGGCCAACACTATG TCTCCTGTTCTGCAGTCCTCATCTGATTGGCCAACACTATG Direct Gain 0 0.867492973804474 Functional Gain 0.867492973804474 LINC01634 ENSG00000235295 ncRNA_exonic Human lincRNA chr22:18518634 chr22:18518634 . . 0 21 hm6Am_associated_SNPs_37448 0 17554300 Multiple complex diseases 2.5e-67 Johnson and O'Donnell TagSNP rs4819660 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
258 chr22 32487700 32487700 1 + G A rs17683430 32487700 + 32487680 32487720 41 TCTTCACCATGGACATCTACGCCAAGGTCCGCAAGAGAGCA TCTTCACCATGGACATCTACACCAAGGTCCGCAAGAGAGCA Direct Gain 0 0.74479603767395 Functional Gain 0.74479603767395 SLC5A1 ENSG00000100170 CDS Human protein_coding chr22:32487700 chr22:32487700 nonsynonymous SNV 0.989 1 21 hm6Am_associated_SNPs_38113 2 29093273 GIP levels in response to oral glucose tolerance test (120 minutes) 3e-18 GWAS_Catalog TagSNP rs17683430 GCST005166 Genetic determinants of circulating GIP and GLP-1 concentrations.
259 chr22 39830586 39830586 1 + G A rs17001110 39830586 + 39830566 39830606 41 TGATGTCAGCCCCGAGCAGAGACAGGCGCTTGGCATTCCAC TGATGTCAGCCCCGAGCAGAAACAGGCGCTTGGCATTCCAC Direct Gain 0 0.801714956760406 Functional Gain 0.801714956760406 LOC100506472 ENSG00000100324 intronic Human protein_coding chr22:39830586 chr22:39830586 . . 0 21 hm6Am_associated_SNPs_38314 0 28552196 Waist circumference 6e-06 GWAS_Catalog TagSNP rs17001110 GCST008151 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
260 chr22 40075400 40075400 1 + G A rs2294369 40075400 + 40075380 40075420 41 GGCCGGGAGGGGCGGGCGGCGGGGGCGACACCGAGGGCGGC GGCCGGGAGGGGCGGGCGGCAGGGGCGACACCGAGGGCGGC Direct Gain 0 0.949817538261414 Functional Gain 0.949817538261414 CACNA1I ENSG00000100346 CDS Human protein_coding chr22:40075400 chr22:40075400 nonsynonymous SNV 0.000 1 21 hm6Am_associated_SNPs_38341 0 24709693 Response to methotrexate in juvenile idiopathic arthritis 9e-08 GWAS_Catalog TagSNP rs2294369 GCST002408 Genome-wide data reveal novel genes for methotrexate response in a large cohort of juvenile idiopathic arthritis cases.
261 chr22 41753603 41753603 1 + G A rs11090045 41753603 + 41753583 41753623 41 CCACCACCGCCCCGGTGTGCGTACCCAGGCGCACGTGCTGC CCACCACCGCCCCGGTGTGCATACCCAGGCGCACGTGCTGC Direct Gain 0 0.852497577667236 Functional Gain 0.852497577667236 ZC3H7B ENSG00000100403 UTR3 Human protein_coding chr22:41753603 chr22:41753603 . . 0 21 hm6Am_associated_SNPs_38392 0 30038396 Self-reported math ability 1e-32 GWAS_Catalog TagSNP rs11090045 GCST006573 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
262 chr22 51042336 51042336 1 + G A rs116947359 51042336 + 51042316 51042356 41 GCAGTCGCCAGTGCGCCCGGGTTGCGACTGCGAAGGGAACC GCAGTCGCCAGTGCGCCCGGATTGCGACTGCGAAGGGAACC Direct Gain 0 0.885658144950867 Functional Gain 0.885658144950867 MAPK8IP2 ENSG00000008735 CDS Human protein_coding chr22:51042336 chr22:51042336 nonsynonymous SNV 0.498 0 21 hm6Am_associated_SNPs_38777 0 30072576 Blood protein levels 1e-07 GWAS_Catalog TagSNP rs116947359 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
263 chrX 148622745 148622745 1 + T A rs3747442 148622745 + 148622725 148622765 41 GGGGAGGCAGAGGACTGTTCTTTCCTGTGGCGAAAAGCCGG GGGGAGGCAGAGGACTGTTCATTCCTGTGGCGAAAAGCCGG Direct Gain 0 0.877053260803223 Functional Gain 0.877053260803223 CXorf40A ENSG00000197620 UTR5 Human protein_coding chrX:148622745 chrX:148622745 . . 0 21 hm6Am_associated_SNPs_39436 0 17052657 Parkinson's disease 0.000510495 Johnson and O'Donnell TagSNP rs3747442 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
264 chrX 153248248 153248248 1 + G A rs13397 153248248 + 153248228 153248268 41 TTTGCGTTTTTGTTTCTGACGCATTTCAACACTCACCCAAG TTTGCGTTTTTGTTTCTGACACATTTCAACACTCACCCAAG Direct Gain 0 0.549810588359833 Functional Gain 0.549810588359833 TMEM187 ENSG00000177854 CDS Human protein_coding chrX:153248248 chrX:153248248 synonymous SNV . 0 21 hm6Am_associated_SNPs_39549 0 22057235 Celiac disease 3e-08 GWAS_Catalog TagSNP rs13397 GCST005523 Dense genotyping identifies and localizes multiple common and rare variant association signals in celiac disease.
265 chr1 3328659 3328659 1 + C T rs2493292 3328659 - 3328639 3328679 41 CCTTGCCCTTGTCCTTGTCAGGGTCGCTGTCCACGTCGCTG CCTTGCCCTTGTCCTTGTCAAGGTCGCTGTCCACGTCGCTG Direct Gain 0 0.789440095424652 Functional Gain 0.789440095424652 PRDM16 ENSG00000142611 CDS Human protein_coding chr1:3328659 chr1:3328659 nonsynonymous SNV 0.009 1 21 hm6Am_associated_SNPs_137927 1 27618448 Systolic blood pressure 1e-08 GWAS_Catalog TagSNP rs2493292 GCST006228 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
266 chr1 9789150 9789150 1 + C T rs14271 9789150 - 9789130 9789170 41 TCGCCGCGCGGTTTCCCTTCGCAGATGTGTATACTCATGAT TCGCCGCGCGGTTTCCCTTCACAGATGTGTATACTCATGAT Direct Gain 0 0.877320349216461 Functional Gain 0.877320349216461 CLSTN1 ENSG00000171603;ENSG00000171608 UTR3 Human other chr1:9789150 chr1:9789150 . . 0 21 hm6Am_associated_SNPs_138052 0 25918132 Diisocyanate-induced asthma 1e-06 GWAS_Catalog TagSNP rs14271 GCST002875 Genome-Wide Association Study Identifies Novel Loci Associated With Diisocyanate-Induced Occupational Asthma.
267 chr1 17601165 17601165 1 + C T rs11585357 17601165 - 17601145 17601185 41 AGGCCACTCACAGACCTGTCGCGTGGTTCCCGAGTCACGTA AGGCCACTCACAGACCTGTCACGTGGTTCCCGAGTCACGTA Direct Gain 0 0.902947664260864 Functional Gain 0.902947664260864 PADI3 ENSG00000142619 CDS Human protein_coding chr1:17601165 chr1:17601165 synonymous SNV . 0 21 hm6Am_associated_SNPs_138249 0 29220522 Hair shape 4e-18 GWAS_Catalog TagSNP rs11585357 GCST005191 Meta-analysis of genome-wide association studies identifies 8 novel loci involved in shape variation of human head hair.
268 chr1 43611453 43611453 1 + C T rs511875 43611453 - 43611433 43611473 41 CTTCTCAAGACAGTCTTGCCGCTTCTTGGCCCTTTGTATGT CTTCTCAAGACAGTCTTGCCACTTCTTGGCCCTTTGTATGT Direct Gain 0 0.680523335933685 Functional Gain 0.680523335933685 SLC2A1-AS1;FAM183A ENSG00000186973 intronic Human protein_coding chr1:43611453 chr1:43611453 . . 0 21 hm6Am_associated_SNPs_138646 0 30019117 Adolescent idiopathic scoliosis 4e-40 GWAS_Catalog TagSNP rs511875 GCST006287 The coexistence of copy number variations (CNVs) and single nucleotide polymorphisms (SNPs) at a locus can result in distorted calculations of the significance in associating SNPs to disease.
269 chr1 53550640 53550640 1 + C T rs41294750 53550640 - 53550620 53550660 41 GGCAGACGGCGAGCTGCTATGGCTGATTCTGGCTGGGGCAA GGCAGACGGCGAGCTGCTATAGCTGATTCTGGCTGGGGCAA Direct Gain 0 0.529610455036163 Functional Gain 0.529610455036163 PODN ENSG00000232993 ncRNA_intronic Human antisense chr1:53550640 chr1:53550640 . . 0 21 hm6Am_associated_SNPs_138768 0 27989323 Interleukin-9 levels 2e-06 GWAS_Catalog TagSNP rs41294750 GCST004450 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
270 chr1 55505447 55505447 1 + C T rs45448095 55505447 - 55505427 55505467 41 GGCCGTGCGCGGTCCACGCCGGCGGCGCCTTGAGCCTTGCG GGCCGTGCGCGGTCCACGCCAGCGGCGCCTTGAGCCTTGCG Direct Gain 0 0.980311334133148 Functional Gain 0.980311334133148 PCSK9 ENSG00000169174 UTR5 Human protein_coding chr1:55505447 chr1:55505447 . . 0 21 hm6Am_associated_SNPs_138803 2 29748315 Plasma proprotein convertase subtilisin/kexin type 9 levels in stable coronary artery disease 4e-12 GWAS_Catalog TagSNP rs45448095 GCST006284 Genetic Regulation of PCSK9 (Proprotein Convertase Subtilisin/Kexin Type 9) Plasma Levels and Its Impact on Atherosclerotic Vascular Disease Phenotypes.
271 chr1 155178782 155178782 1 + A T rs760077 155178782 - 155178762 155178802 41 CGGCCCGGCGCGCCTCGGAGTGTCACGGCGCCTCGTCCAAG CGGCCCGGCGCGCCTCGGAGAGTCACGGCGCCTCGTCCAAG Direct Gain 0 0.948469460010529 Functional Gain 0.948469460010529 MTX1 ENSG00000173171 CDS Human protein_coding chr1:155178782 chr1:155178782 nonsynonymous SNV . 0 21 hm6Am_associated_SNPs_139194 0 27863252 Hematocrit 2e-23 GWAS_Catalog TagSNP rs760077 GCST004604 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
272 chr1 156878473 156878473 1 + C T rs77795865 156878473 - 156878453 156878493 41 CCGCCCAGCCCGGCAGGCAGGAGCACTCCCCGTTCATCGGG CCGCCCAGCCCGGCAGGCAGAAGCACTCCCCGTTCATCGGG Direct Gain 0 0.834243059158325 Functional Gain 0.834243059158325 PEAR1 ENSG00000187800 CDS Human protein_coding chr1:156878473 chr1:156878473 nonsynonymous SNV 0.997 2 21 hm6Am_associated_SNPs_139246 0 27863252 Mean platelet volume 2e-09 GWAS_Catalog TagSNP rs77795865 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
273 chr1 180905694 180905694 1 + C T rs3795503 180905694 - 180905674 180905714 41 TGCAGCCCCCGAGGTGCGCTGTTGTTGCAGTTGTTGGTGGA TGCAGCCCCCGAGGTGCGCTATTGTTGCAGTTGTTGGTGGA Direct Gain 0 0.903460264205933 Functional Gain 0.903460264205933 KIAA1614 ENSG00000135835 CDS Human protein_coding chr1:180905694 chr1:180905694 synonymous SNV . 0 21 hm6Am_associated_SNPs_139419 0 31015462 Estimated glomerular filtration rate 8e-13 GWAS_Catalog TagSNP rs3795503 GCST007876 Sex-specific and pleiotropic effects underlying kidney function identified from GWAS meta-analysis.
274 chr1 204967186 204967186 1 + A T rs35068223 204967186 - 204967166 204967206 41 ATTTTCCCTCCATGCCTGCATTTGAGGGCTTGGGGAATGTG ATTTTCCCTCCATGCCTGCAATTGAGGGCTTGGGGAATGTG Direct Gain 0 0.502685010433197 Functional Gain 0.502685010433197 NFASC ENSG00000163531 intronic Human protein_coding chr1:204967186 chr1:204967186 . . 0 21 hm6Am_associated_SNPs_139555 0 30643258 Number of sexual partners 3e-09 GWAS_Catalog TagSNP rs35068223 GCST007326 Genome-wide association analyses of risk tolerance and risky behaviors in over 1 million individuals identify hundreds of loci and shared genetic influences.
275 chr1 205027561 205027561 1 + G T rs9787409 205027561 - 205027541 205027581 41 AGGCCCGGCTTGAGGGTGTCCCTTATCCTTTCTCAGTAATT AGGCCCGGCTTGAGGGTGTCACTTATCCTTTCTCAGTAATT Direct Gain 0 0.848156571388245 Functional Gain 0.848156571388245 CNTN2 ENSG00000184144 intronic Human protein_coding chr1:205027561 chr1:205027561 . . 0 21 hm6Am_associated_SNPs_139563 0 29875488 Blood protein levels 3e-61 GWAS_Catalog TagSNP rs9787409 GCST005806 Genomic atlas of the human plasma proteome.
276 chr1 215342573 215342573 1 + C T rs17024342 215342573 - 215342553 215342593 41 ATGATACAGAATATTTTGCCGCCTTCTGTGCGTGGTGAGAT ATGATACAGAATATTTTGCCACCTTCTGTGCGTGGTGAGAT Direct Gain 0 0.746846675872803 Functional Gain 0.746846675872803 KCNK2 ENSG00000082482 CDS Human protein_coding chr1:215342573 chr1:215342573 nonsynonymous SNV . 0 21 hm6Am_associated_SNPs_139649 0 17554300 Multiple complex diseases 0.000142444 Johnson and O'Donnell TagSNP rs17024342 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
277 chr2 3642756 3642756 1 + C T rs77246730 3642756 - 3642736 3642776 41 CCGGGCAGAGTCTCCTACCTGAGCACGCGCTAGGCGAACGG CCGGGCAGAGTCTCCTACCTAAGCACGCGCTAGGCGAACGG Direct Gain 0 0.627835094928741 Functional Gain 0.627835094928741 COLEC11 ENSG00000118004 UTR5 Human protein_coding chr2:3642756 chr2:3642756 . . 0 21 hm6Am_associated_SNPs_139956 0 29875488 Blood protein levels 3e-42 GWAS_Catalog TagSNP rs77246730 GCST005806 Genomic atlas of the human plasma proteome.
278 chr2 54684398 54684398 1 + C T rs76070960 54684398 - 54684378 54684418 41 GCTGAGACAAACCTGTTGAAGAGAGGGTGGCAGGAGCTGAA GCTGAGACAAACCTGTTGAAAAGAGGGTGGCAGGAGCTGAA Direct Gain 0 0.814136266708374 Functional Gain 0.814136266708374 SPTBN1 ENSG00000115306 UTR5 Human protein_coding chr2:54684398 chr2:54684398 . . 0 21 hm6Am_associated_SNPs_140221 0 29617998 Intraocular pressure 1e-09 GWAS_Catalog TagSNP rs76070960 GCST005580 Genome-Wide Association Analyses Identify New Loci Influencing Intraocular Pressure.
279 chr2 87002229 87002229 1 + C T rs1193 87002229 - 87002209 87002249 41 AGAATCATGGGGCAAAAGTCGCTATGGGGCCAGACTGAGGT AGAATCATGGGGCAAAAGTCACTATGGGGCCAGACTGAGGT Direct Gain 0 0.760946810245514 Functional Gain 0.760946810245514 RMND5A ENSG00000153561 UTR3 Human protein_coding chr2:87002229 chr2:87002229 . . 0 21 hm6Am_associated_SNPs_140401 0 27863252 Immature fraction of reticulocytes 1e-09 GWAS_Catalog TagSNP rs1193 GCST004628 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
280 chr2 113890373 113890373 1 + C T rs4252023 113890373 - 113890353 113890393 41 TTGGTGAGGCTGACGGGCTGGTCAGCTTCCATCGCTGTGCA TTGGTGAGGCTGACGGGCTGATCAGCTTCCATCGCTGTGCA Direct Gain 0 0.881127655506134 Functional Gain 0.881127655506134 IL1RN ENSG00000136689 CDS Human protein_coding chr2:113890373 chr2:113890373 synonymous SNV . 0 21 hm6Am_associated_SNPs_140514 1 23251661 Obesity-related traits 2e-06 GWAS_Catalog TagSNP rs4252023 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
281 chr2 241569692 241569692 1 + C T rs3749171 241569692 - 241569672 241569712 41 AGCGGTCCACGGCGATGGCCGTGACCAGGCTGATGCTCATG AGCGGTCCACGGCGATGGCCATGACCAGGCTGATGCTCATG Direct Gain 0 0.606318175792694 Functional Gain 0.606318175792694 GPR35 ENSG00000178623 CDS Human protein_coding chr2:241569692 chr2:241569692 nonsynonymous SNV 0.011 1 21 hm6Am_associated_SNPs_141122 0 29562276 Childhood onset ulcerative colitis 9e-07 GWAS_Catalog TagSNP rs3749171 GCST005815 Enhanced Contribution of HLA in Pediatric Onset Ulcerative Colitis.
282 chr3 38271881 38271881 1 + C T rs6599079 38271881 - 38271861 38271901 41 TGGTTGGTGCTCTCTGCAATGTTTTTTCTTGAAGAAATTCT TGGTTGGTGCTCTCTGCAATATTTTTTCTTGAAGAAATTCT Direct Gain 0 0.608910501003265 Functional Gain 0.608910501003265 OXSR1 ENSG00000172939 CDS Human protein_coding chr3:38271881 chr3:38271881 nonsynonymous SNV 0.996 0 21 hm6Am_associated_SNPs_141330 0 30595370 Red cell distribution width 1e-13 GWAS_Catalog TagSNP rs6599079 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
283 chr3 49453834 49453834 1 + C T rs6997 49453834 - 49453814 49453854 41 GATCCTGACTCTGTGCAGTAGTATTAGTGGGTGGGCCAGGG GATCCTGACTCTGTGCAGTAATATTAGTGGGTGGGCCAGGG Direct Gain 0 0.88138735294342 Functional Gain 0.88138735294342 TCTA ENSG00000145022 UTR3 Human protein_coding chr3:49453834 chr3:49453834 . . 0 21 hm6Am_associated_SNPs_141448 0 25644384 Cognitive function 8e-06 GWAS_Catalog TagSNP rs6997 GCST002774 Genetic contributions to variation in general cognitive function: a meta-analysis of genome-wide association studies in the CHARGE consortium (N=53949).
284 chr3 138668509 138668509 1 + C T rs142253798 138668509 - 138668489 138668529 41 GACCTGAAAGTAATCATTCTGCCAGCTTTCCCGCCCGCATT GACCTGAAAGTAATCATTCTACCAGCTTTCCCGCCCGCATT Direct Gain 0 0.612683773040771 Functional Gain 0.612683773040771 FOXL2NB ENSG00000206262 intronic Human protein_coding chr3:138668509 chr3:138668509 . . 0 21 hm6Am_associated_SNPs_141861 0 29059683 Breast cancer 8e-06 GWAS_Catalog TagSNP rs142253798 GCST004988 Association analysis identifies 65 new breast cancer risk loci.
285 chr4 941518 941518 1 + C T rs2290402 941518 - 941498 941538 41 GGCTGGGACATGGCGGGGCCGCTGCCTGGCGGTTACAGGAG GGCTGGGACATGGCGGGGCCACTGCCTGGCGGTTACAGGAG Direct Gain 0 0.98094654083252 Functional Gain 0.98094654083252 TMEM175 ENSG00000127419 UTR5 Human protein_coding chr4:941518 chr4:941518 . . 0 21 hm6Am_associated_SNPs_142108 0 25102180 Type 2 diabetes 7e-06 GWAS_Catalog TagSNP rs2290402 GCST002560 Meta-analysis of genome-wide association studies in African Americans provides insights into the genetic architecture of type 2 diabetes.
286 chr4 3446091 3446091 1 + G T rs3748034 3446091 - 3446071 3446111 41 GTGGCCCTGGCGCACGCGGGCCCAGCGGTCGCCCCCCTCCA GTGGCCCTGGCGCACGCGGGACCAGCGGTCGCCCCCCTCCA Direct Gain 0 0.905392646789551 Functional Gain 0.905392646789551 HGFAC ENSG00000109758 CDS Human protein_coding chr4:3446091 chr4:3446091 nonsynonymous SNV 0.560 1 21 hm6Am_associated_SNPs_142275 0 27989323 Hepatocyte growth factor levels 2e-10 GWAS_Catalog TagSNP rs3748034 GCST004449 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
287 chr4 38698924 38698924 1 + C T rs36023504 38698924 - 38698904 38698944 41 GCAGGACAGAGAGAGAGCCAGGTGAGTGGGGAGTCACGCTG GCAGGACAGAGAGAGAGCCAAGTGAGTGGGGAGTCACGCTG Direct Gain 0 0.575644552707672 Functional Gain 0.575644552707672 KLF3 ENSG00000109787 UTR3 Human protein_coding chr4:38698924 chr4:38698924 . . 0 21 hm6Am_associated_SNPs_142483 0 30595370 Red cell distribution width 3e-11 GWAS_Catalog TagSNP rs36023504 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
288 chr4 71554974 71554974 1 + C T rs111485612 71554974 - 71554954 71554994 41 CTCAGCCTCATCTACCTGAGGCACTGGTTTTGCAAAGGCCT CTCAGCCTCATCTACCTGAGACACTGGTTTTGCAAAGGCCT Direct Gain 0 0.589227318763733 Functional Gain 0.589227318763733 UTP3 ENSG00000132467 CDS Human protein_coding chr4:71554974 chr4:71554974 nonsynonymous SNV 0.827 0 21 hm6Am_associated_SNPs_142553 0 29093273 Glucagon levels in response to oral glucose tolerance test (120 minutes) 7e-06 GWAS_Catalog TagSNP rs111485612 GCST005163 Genetic determinants of circulating GIP and GLP-1 concentrations.
289 chr4 155488821 155488821 1 + C T rs6056 155488821 - 155488801 155488841 41 CGAAGGTTAGTTGGGATATTGCTATTCACAGTCTCATCTAT CGAAGGTTAGTTGGGATATTACTATTCACAGTCTCATCTAT Direct Gain 0 0.807219266891479 Functional Gain 0.807219266891479 FGB ENSG00000171564 CDS Human protein_coding chr4:155488821 chr4:155488821 synonymous SNV . 0 21 hm6Am_associated_SNPs_142780 2 20031577 Fibrinogen 8e-39 GWAS_Catalog TagSNP rs6056 GCST000368 Novel loci, including those related to Crohn disease, psoriasis, and inflammation, identified in a genome-wide association study of fibrinogen in 17 686 women: the Women's Genome Health Study.
290 chr5 14488128 14488128 1 + C T rs115054458 14488128 - 14488108 14488148 41 CCTTGCCGAGAGAAGGGACCGCGCTGGAGAGCGGCGAGTTC CCTTGCCGAGAGAAGGGACCACGCTGGAGAGCGGCGAGTTC Direct Gain 0 0.84115731716156 Functional Gain 0.84115731716156 TRIO ENSG00000038382 CDS Human protein_coding chr5:14488128 chr5:14488128 nonsynonymous SNV 0.039 1 21 hm6Am_associated_SNPs_142964 0 27777418 Major depressive disorder 3e-07 GWAS_Catalog TagSNP rs115054458 GCST005547 The PHF21B gene is associated with major depression and modulates the stress response.
291 chr5 72144005 72144005 1 + C T rs34651 72144005 - 72143985 72144025 41 TCCTGGCAGCCCGGCCGCCAGCGTCTGCTGCTGCTGCCGCC TCCTGGCAGCCCGGCCGCCAACGTCTGCTGCTGCTGCCGCC Direct Gain 0 0.979759573936462 Functional Gain 0.979759573936462 TNPO1 ENSG00000083312 intronic Human protein_coding chr5:72144005 chr5:72144005 . . 0 21 hm6Am_associated_SNPs_143102 0 27863252 Mean platelet volume 4e-16 GWAS_Catalog TagSNP rs34651 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
292 chr5 131607300 131607300 1 + C T rs55722650 131607300 - 131607280 131607320 41 GGGAAGCCAGGGCGTAGCAAGGTTGTAGCAAGGGCGTGGGA GGGAAGCCAGGGCGTAGCAAAGTTGTAGCAAGGGCGTGGGA Direct Gain 0 0.825664460659027 Functional Gain 0.825664460659027 PDLIM4 ENSG00000072682;ENSG00000131435 intronic Human other chr5:131607300 chr5:131607300 . . 0 21 hm6Am_associated_SNPs_143225 0 28199695 Mosquito bite size 3e-20 GWAS_Catalog TagSNP rs55722650 GCST004863 GWAS of self-reported mosquito bite size, itch intensity and attractiveness to mosquitoes implicates immune-related predisposition loci.
293 chr5 153837106 153837106 1 + C T rs148763909 153837106 - 153837086 153837126 41 AGACCTTTGGACACTCCGCCGCCCTGCTCAGTAGGGGGTTT AGACCTTTGGACACTCCGCCACCCTGCTCAGTAGGGGGTTT Direct Gain 0 0.510326862335205 Functional Gain 0.510326862335205 SAP30L ENSG00000164576 UTR3 Human protein_coding chr5:153837106 chr5:153837106 . . 0 21 hm6Am_associated_SNPs_143556 0 23535033 Alzheimer's disease (cognitive decline) 1e-08 GWAS_Catalog TagSNP rs148763909 GCST001915 Genome-wide association study of the rate of cognitive decline in Alzheimer's disease.
294 chr6 7251037 7251037 1 + C T rs2842352 7251037 - 7251017 7251057 41 CCTCAACCTTTTTTCCTTTCGTATGCGAAGATATCACTTTT CCTCAACCTTTTTTCCTTTCATATGCGAAGATATCACTTTT Direct Gain 0 0.583191215991974 Functional Gain 0.583191215991974 RREB1 ENSG00000124782 UTR3 Human protein_coding chr6:7251037 chr6:7251037 . . 0 21 hm6Am_associated_SNPs_143805 0 30048462 Heel bone mineral density 2e-11 GWAS_Catalog TagSNP rs2842352 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
295 chr6 29911030 29911030 1 + C T rs9260151 29911030 - 29911010 29911050 41 GAGAACCTGGCCCCGACCCCGCGGTCAGCCCAGTCCCCCGA GAGAACCTGGCCCCGACCCCACGGTCAGCCCAGTCCCCCGA Direct Gain 0 0.969061255455017 Functional Gain 0.969061255455017 HLA-A ENSG00000206503 intronic Human protein_coding chr6:29911030 chr6:29911030 . . 0 21 hm6Am_associated_SNPs_143996 0 29404672 C-peptide levels in type I diabetes 8e-08 GWAS_Catalog TagSNP rs9260151 GCST005436 Meta-genome-wide association studies identify a locus on chromosome 1 and multiple variants in the MHC region for serum C-peptide in type 1 diabetes.
296 chr6 30876152 30876152 1 + C T rs1052693 30876152 - 30876132 30876172 41 CGATCCTCCTCGCGCACCCCGAGTCTCGGGCCGTCGCTTAA CGATCCTCCTCGCGCACCCCAAGTCTCGGGCCGTCGCTTAA Direct Gain 0 0.981025338172913 Functional Gain 0.981025338172913 GTF2H4 ENSG00000213780 UTR5 Human protein_coding chr6:30876152 chr6:30876152 . . 0 21 hm6Am_associated_SNPs_144034 0 23028341 Complement C3 and C4 levels 3e-48 GWAS_Catalog TagSNP rs1052693 GCST001679 Genome-wide association study for serum complement C3 and C4 levels in healthy Chinese subjects.
297 chr6 30890483 30890483 1 + G T rs2074506 30890483 - 30890463 30890503 41 TCTCAGCTTTTCCTGCAGCACCTGGGGATGGAAGGGGGCAA TCTCAGCTTTTCCTGCAGCAACTGGGGATGGAAGGGGGCAA Direct Gain 0 0.506686151027679 Functional Gain 0.506686151027679 VARS2 ENSG00000137411 CDS Human protein_coding chr6:30890483 chr6:30890483 nonsynonymous SNV 0.983 0 21 hm6Am_associated_SNPs_144040 1 17804836 Rheumatoid Arthritis 1.68e-12 Johnson and O'Donnell TagSNP rs2074506 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
298 chr6 31107733 31107733 1 + C T rs1966 31107733 - 31107713 31107753 41 GAAAGGTCCTTGAGGGAAACGTTCTAGGGGTCTCTCTGGGA GAAAGGTCCTTGAGGGAAACATTCTAGGGGTCTCTCTGGGA Direct Gain 0 0.823740363121033 Functional Gain 0.823740363121033 PSORS1C1 ENSG00000204540 UTR3 Human protein_coding chr6:31107733 chr6:31107733 . . 0 21 hm6Am_associated_SNPs_144074 0 17804836 Rheumatoid Arthritis 5.77e-09 Johnson and O'Donnell TagSNP rs1966 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
299 chr6 31431691 31431691 1 + G T rs2255221 31431691 - 31431671 31431711 41 CAGGTAATAGATCCTGATCCCCAGGAGGAGGCATGGCTGCT CAGGTAATAGATCCTGATCCACAGGAGGAGGCATGGCTGCT Direct Gain 0 0.540646016597748 Functional Gain 0.540646016597748 HCP5 ENSG00000206337 ncRNA_exonic Human sense_overlapping chr6:31431691 chr6:31431691 . . 0 21 hm6Am_associated_SNPs_144087 0 21051598 HIV-1 control 4e-14 GWAS_Catalog TagSNP rs2255221 GCST000863 The major genetic determinants of HIV-1 control affect HLA class I peptide presentation.
300 chr6 31583931 31583931 1 + C T rs2269475 31583931 - 31583911 31583951 41 CCTGCCCCCGCAAATCACCCGTTTCTCACCAATATCGCCAT CCTGCCCCCGCAAATCACCCATTTCTCACCAATATCGCCAT Direct Gain 0 0.802621781826019 Functional Gain 0.802621781826019 AIF1 ENSG00000204472 intronic Human protein_coding chr6:31583931 chr6:31583931 . . 0 21 hm6Am_associated_SNPs_144093 0 17804836 Rheumatoid Arthritis 3.65e-12 Johnson and O'Donnell TagSNP rs2269475 . TRAF1-C5 as a risk locus for rheumatoid arthritis--a genomewide study.
301 chr6 31994782 31994782 1 + C T rs451637 31994782 - 31994762 31994802 41 TCGCGGAACACCCGGAGCTGGACTGGGGTGGCCACACATAG TCGCGGAACACCCGGAGCTGAACTGGGGTGGCCACACATAG Direct Gain 0 0.94890558719635 Functional Gain 0.94890558719635 C4B;C4B_2 ENSG00000224389 CDS Human protein_coding chr6:31994782 chr6:31994782 synonymous SNV . 0 21 hm6Am_associated_SNPs_144120 0 29875488 Blood protein levels 2e-22 GWAS_Catalog TagSNP rs451637 GCST005806 Genomic atlas of the human plasma proteome.
302 chr6 32862740 32862740 1 + C T rs241407 32862740 - 32862720 32862760 41 CGCCGGAACTCTTCTTCCAGGCAGGCGTTCCGAGACTCCGC CGCCGGAACTCTTCTTCCAGACAGGCGTTCCGAGACTCCGC Direct Gain 0 0.965966284275055 Functional Gain 0.965966284275055 LOC100294145 ENSG00000234515;ENSG00000235301 intergenic Human other chr6:32862740 chr6:32862740 . . 0 21 hm6Am_associated_SNPs_144139 0 17632545 Type I Diabetes 2.39e-10 Johnson and O'Donnell TagSNP rs241407 . A genome-wide association study identifies KIAA0350 as a type 1 diabetes gene.
303 chr6 33055501 33055501 1 + C T rs9277552 33055501 - 33055481 33055521 41 TCCTGAAATTGGAGGAAGCCGGTCCCCCGATGGAAGATATT TCCTGAAATTGGAGGAAGCCAGTCCCCCGATGGAAGATATT Direct Gain 0 0.504240810871124 Functional Gain 0.504240810871124 HLA-DPB1 ENSG00000223865 downstream Human protein_coding chr6:33055501 chr6:33055501 . . 0 21 hm6Am_associated_SNPs_144156 0 30664745 Knee osteoarthritis 2e-08 GWAS_Catalog TagSNP rs9277552 GCST007090 Identification of new therapeutic targets for osteoarthritis through genome-wide analyses of UK Biobank data.
304 chr6 41487357 41487357 1 + C T rs36025606 41487357 - 41487337 41487377 41 TTGTGGCAGGTCCGGGTGTGGCAGTGCCCACCACACTGTAG TTGTGGCAGGTCCGGGTGTGACAGTGCCCACCACACTGTAG Direct Gain 0 0.969751358032227 Functional Gain 0.969751358032227 LINC01276 ENSG00000226917 ncRNA_exonic Human lincRNA chr6:41487357 chr6:41487357 . . 0 21 hm6Am_associated_SNPs_144269 0 29703844 Diabetic kidney disease in type 2 diabetes (ESRD vs. no ESRD) 4e-06 GWAS_Catalog TagSNP rs36025606 GCST005893 A Genome-Wide Association Study of Diabetic Kidney Disease in Subjects With Type 2 Diabetes.
305 chr6 43270151 43270151 1 + C T rs2270860 43270151 - 43270131 43270171 41 CCTATGGGACTGGGCTCACCGGAGGACACTAGCAGTCTAGT CCTATGGGACTGGGCTCACCAGAGGACACTAGCAGTCTAGT Direct Gain 0 0.536875665187836 Functional Gain 0.536875665187836 SLC22A7 ENSG00000137204 CDS Human protein_coding chr6:43270151 chr6:43270151 synonymous SNV . 0 21 hm6Am_associated_SNPs_144328 0 29455858 Diastolic blood pressure (cigarette smoking interaction) 4e-11 GWAS_Catalog TagSNP rs2270860 GCST006187 A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
306 chr6 159331260 159331260 1 + C T rs78995442 159331260 - 159331240 159331280 41 ACGGAATTTTCTTTCCACTTGTAAGATTTAAGTGTTTAACA ACGGAATTTTCTTTCCACTTATAAGATTTAAGTGTTTAACA Direct Gain 0 0.788180589675903 Functional Gain 0.788180589675903 C6orf99 ENSG00000203711 UTR3 Human lincRNA chr6:159331260 chr6:159331260 . . 0 21 hm6Am_associated_SNPs_144703 0 26053186 3-hydroxypropylmercapturic acid levels in smokers 5e-06 GWAS_Catalog TagSNP rs78995442 GCST002956 Mercapturic Acids Derived from the Toxicants Acrolein and Crotonaldehyde in the Urine of Cigarette Smokers from Five Ethnic Groups with Differing Risks for Lung Cancer.
307 chr6 160769811 160769811 1 + C T rs668871 160769811 - 160769791 160769831 41 CACGGCACAAGGGGAGCCGAGCGGTTGGGGAAGGCGGCGAG CACGGCACAAGGGGAGCCGAACGGTTGGGGAAGGCGGCGAG Direct Gain 0 0.84858250617981 Functional Gain 0.84858250617981 SLC22A3 ENSG00000146477 CDS Human protein_coding chr6:160769811 chr6:160769811 synonymous SNV . 0 21 hm6Am_associated_SNPs_144729 0 30595370 Waist-hip ratio 8e-30 GWAS_Catalog TagSNP rs668871 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
308 chr7 4832198 4832198 1 + C T rs11971803 4832198 - 4832178 4832218 41 TTCCTGGGCTGGAACCTGGCGGTGAGGACCCCGCGGTTCGG TTCCTGGGCTGGAACCTGGCAGTGAGGACCCCGCGGTTCGG Direct Gain 0 0.504810214042664 Functional Gain 0.504810214042664 AP5Z1 ENSG00000242802 downstream Human protein_coding chr7:4832198 chr7:4832198 . . 0 21 hm6Am_associated_SNPs_145005 1 27082954 Peripheral arterial disease (traffic-related air pollution interaction) 9e-06 GWAS_Catalog TagSNP rs11971803 GCST004482 Genetic Variants in the Bone Morphogenic Protein Gene Family Modify the Association between Residential Exposure to Traffic and Peripheral Arterial Disease.
309 chr7 29440195 29440195 1 + C T rs34045356 29440195 - 29440175 29440215 41 CCCACAAAGTGTTTCCCGTCGTGGAAGAGCCTGTAGTTTAA CCCACAAAGTGTTTCCCGTCATGGAAGAGCCTGTAGTTTAA Direct Gain 0 0.833213686943054 Functional Gain 0.833213686943054 CHN2 ENSG00000106069 CDS Human protein_coding chr7:29440195 chr7:29440195 synonymous SNV . 0 21 hm6Am_associated_SNPs_145128 0 29898447 Erosive tooth wear (severe vs non-severe) 9e-06 GWAS_Catalog TagSNP rs34045356 GCST006218 Genome-Wide Association Study of Erosive Tooth Wear in a Finnish Cohort.
310 chr7 50610379 50610379 1 + A T rs7809234 50610379 - 50610359 50610399 41 GGGAGAGGTGTGGCTAAATGTCAGGCAGTGGGGAGTACAGG GGGAGAGGTGTGGCTAAATGACAGGCAGTGGGGAGTACAGG Direct Gain 0 0.824090838432312 Functional Gain 0.824090838432312 DDC-AS1 ENSG00000226122 ncRNA_exonic Human antisense chr7:50610379 chr7:50610379 . . 0 21 hm6Am_associated_SNPs_145281 0 24816252 Blood metabolite ratios 6e-14 GWAS_Catalog TagSNP rs7809234 GCST002442 An atlas of genetic influences on human blood metabolites.
311 chr7 64075993 64075993 1 + C T rs985668 64075993 - 64075973 64076013 41 GCTTCTTGGGCAGAGTCTAAGTAGTGGAGGACAGTCATACC GCTTCTTGGGCAGAGTCTAAATAGTGGAGGACAGTCATACC Direct Gain 0 0.754221975803375 Functional Gain 0.754221975803375 LOC100128885 ENSG00000224669;ENSG00000196247 intergenic Human other chr7:64075993 chr7:64075993 . . 0 21 hm6Am_associated_SNPs_145298 0 17998437 Alzheimer's disease 3.3e-05 Johnson and O'Donnell TagSNP rs985668 . Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.
312 chr9 2622134 2622134 1 + C T rs34881325 2622134 - 2622114 2622154 41 CGCCGCCGTTCGCTCCGCACGACAAGTTACCAGTCCTTCCG CGCCGCCGTTCGCTCCGCACAACAAGTTACCAGTCCTTCCG Direct Gain 0 0.978435158729553 Functional Gain 0.978435158729553 VLDLR-AS1 ENSG00000236404 ncRNA_exonic Human antisense chr9:2622134 chr9:2622134 . . 0 21 hm6Am_associated_SNPs_146718 1 27989323 Vascular endothelial growth factor levels 3e-10 GWAS_Catalog TagSNP rs34881325 GCST004422 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
313 chr9 35906471 35906471 1 + C T rs76452347 35906471 - 35906451 35906491 41 GATTCCCAGGTGGCCCCGCCGCCGGAAGGGCCAAGGCTGGG GATTCCCAGGTGGCCCCGCCACCGGAAGGGCCAAGGCTGGG Direct Gain 0 0.525892555713654 Functional Gain 0.525892555713654 HRCT1 ENSG00000196196 CDS Human protein_coding chr9:35906471 chr9:35906471 nonsynonymous SNV 0.013 2 21 hm6Am_associated_SNPs_146804 0 27618448 Diastolic blood pressure 7e-10 GWAS_Catalog TagSNP rs76452347 GCST006227 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
314 chr9 78505692 78505692 1 + C T rs76937529 78505692 - 78505672 78505712 41 GACCAGCGGGAGCGGTACAGGCAGCGACCGGGCGCCCCCTC GACCAGCGGGAGCGGTACAGACAGCGACCGGGCGCCCCCTC Direct Gain 0 0.956459403038025 Functional Gain 0.956459403038025 PCSK5 ENSG00000099139 UTR5 Human protein_coding chr9:78505692 chr9:78505692 . . 0 21 hm6Am_associated_SNPs_146865 0 30595370 Waist-hip ratio 5e-09 GWAS_Catalog TagSNP rs76937529 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
315 chr9 136243324 136243324 1 + C T rs3739893 136243324 - 136243304 136243344 41 GATCAGTAGCGACCGCGTACGGGCGAGCGTCCACCCCTGGC GATCAGTAGCGACCGCGTACAGGCGAGCGTCCACCCCTGGC Direct Gain 0 0.71830677986145 Functional Gain 0.71830677986145 STKLD1 ENSG00000198870 UTR5 Human protein_coding chr9:136243324 chr9:136243324 . . 0 21 hm6Am_associated_SNPs_147406 0 29296746 ADAMTS13 levels 1e-30 GWAS_Catalog TagSNP rs3739893 GCST005945 Genetic variants in ADAMTS13 as well as smoking are major determinants of plasma ADAMTS13 levels.
316 chr9 136307825 136307825 1 + C T rs41314453 136307825 - 136307805 136307845 41 GCACGCAGGCCTCTGGCCACGCTGGTGGCTGCTGGCTCCCT GCACGCAGGCCTCTGGCCACACTGGTGGCTGCTGGCTCCCT Direct Gain 0 0.893759369850159 Functional Gain 0.893759369850159 ADAMTS13 ENSG00000160323 CDS Human protein_coding chr9:136307825 chr9:136307825 nonsynonymous SNV 0.427 0 21 hm6Am_associated_SNPs_147418 1 25934476 ADAMTS13 activity 1e-63 GWAS_Catalog TagSNP rs41314453 GCST002881 Genetic variants in the ADAMTS13 and SUPT3H genes are associated with ADAMTS13 activity.
317 chr10 12875208 12875208 1 + C T rs10906233 12875208 - 12875188 12875228 41 CAGATGAGTGGGATGAGTACGGGGTAGGTAAACCGAGTCCG CAGATGAGTGGGATGAGTACAGGGTAGGTAAACCGAGTCCG Direct Gain 0 0.517352402210236 Functional Gain 0.517352402210236 CAMK1D ENSG00000183049 UTR3 Human protein_coding chr10:12875208 chr10:12875208 . . 0 21 hm6Am_associated_SNPs_147855 0 23568457 Eating disorders 4e-06 GWAS_Catalog TagSNP rs10906233 GCST001960 Genetic variants associated with disordered eating.
318 chr10 99359412 99359412 1 + C T rs7078003 99359412 - 99359392 99359432 41 GGAGGGGGGCGCAGAGAAAAGCAGGAGAGGGCAGCCGCCCC GGAGGGGGGCGCAGAGAAAAACAGGAGAGGGCAGCCGCCCC Direct Gain 0 0.930017292499542 Functional Gain 0.930017292499542 HOGA1 ENSG00000155252;ENSG00000241935;ENSG00000249967 intronic Human other chr10:99359412 chr10:99359412 . . 0 21 hm6Am_associated_SNPs_148304 1 27005778 Metabolite levels (small molecules and protein measures) 3e-10 GWAS_Catalog TagSNP rs7078003 GCST003666 Genome-wide study for circulating metabolites identifies 62 loci and reveals novel systemic effects of LPA.
319 chr10 104591393 104591393 1 + G T rs17115100 104591393 - 104591373 104591413 41 AGTACGAAGTCCCAGACCCACTTTTCCTCTTCCACTCTGGA AGTACGAAGTCCCAGACCCAATTTTCCTCTTCCACTCTGGA Direct Gain 0 0.91318154335022 Functional Gain 0.91318154335022 CYP17A1 ENSG00000148795 intronic Human protein_coding chr10:104591393 chr10:104591393 . . 0 21 hm6Am_associated_SNPs_148390 0 19915575 Parkinson's disease 7e-08 GWAS_Catalog TagSNP rs17115100 GCST000528 Genome-wide association study reveals genetic risk underlying Parkinson's disease.
320 chr11 1892562 1892562 1 + G T rs78405116 1892562 - 1892542 1892582 41 CTGTTTCACATCTCTGCCCCCATCTGCGGCGACCAGCCTGG CTGTTTCACATCTCTGCCCCAATCTGCGGCGACCAGCCTGG Direct Gain 0 0.573529362678528 Functional Gain 0.573529362678528 LSP1 ENSG00000130592 UTR5 Human protein_coding chr11:1892562 chr11:1892562 . . 0 21 hm6Am_associated_SNPs_148929 0 25710614 Milk allergy 2e-06 GWAS_Catalog TagSNP rs78405116 GCST002788 Genome-wide association study identifies peanut allergy-specific loci and evidence of epigenetic mediation in US children.
321 chr11 27679916 27679916 1 + C T rs6265 27679916 - 27679896 27679936 41 TGGCTGACACTTTCGAACACGTGATAGAAGAGCTGTTGGAT TGGCTGACACTTTCGAACACATGATAGAAGAGCTGTTGGAT Direct Gain 0 0.549150228500366 Functional Gain 0.549150228500366 BDNF ENSG00000176697 CDS Human protein_coding chr11:27679916 chr11:27679916 nonsynonymous SNV 0.982 3 21 hm6Am_associated_SNPs_149129 7 28892062 Body mass index 2e-51 GWAS_Catalog TagSNP rs6265 GCST004904 Genome-wide association study identifies 112 new loci for body mass index in the Japanese population.
322 chr11 45949534 45949534 1 + C T rs939105 45949534 - 45949514 45949554 41 AAGCGGTAGCGCAGGGTCTCGAATGCCGGCACCACCAGTGC AAGCGGTAGCGCAGGGTCTCAAATGCCGGCACCACCAGTGC Direct Gain 0 0.911315679550171 Functional Gain 0.911315679550171 LARGE2 ENSG00000165905 CDS Human protein_coding chr11:45949534 chr11:45949534 synonymous SNV . 0 21 hm6Am_associated_SNPs_149216 0 30595370 Height 4e-16 GWAS_Catalog TagSNP rs939105 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
323 chr11 47587452 47587452 1 + C T rs11537751 47587452 - 47587432 47587472 41 CTCGTCCTGTACCAGCTGCCGAGGCAAAGAGGTGGCTCAGC CTCGTCCTGTACCAGCTGCCAAGGCAAAGAGGTGGCTCAGC Direct Gain 0 0.612805128097534 Functional Gain 0.612805128097534 PTPMT1 ENSG00000110536 CDS Human protein_coding chr11:47587452 chr11:47587452 nonsynonymous SNV 0.988 3 21 hm6Am_associated_SNPs_149246 0 27618448 Hypertension 7e-08 GWAS_Catalog TagSNP rs11537751 GCST006229 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
324 chr11 65405600 65405600 1 + G T rs2306363 65405600 - 65405580 65405620 41 GCTGGGGTCCCGCTGCCGCTCTCCCGCTACCGCTCCCGGCG GCTGGGGTCCCGCTGCCGCTATCCCGCTACCGCTCCCGGCG Direct Gain 0 0.789365172386169 Functional Gain 0.789365172386169 SIPA1 ENSG00000213445 UTR5 Human protein_coding chr11:65405600 chr11:65405600 . . 0 21 hm6Am_associated_SNPs_149501 0 29912962 Systolic blood pressure x alcohol consumption interaction (2df test) 1e-20 GWAS_Catalog TagSNP rs2306363 GCST006434 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
325 chr11 68201295 68201295 1 + C T rs3736228 68201295 - 68201275 68201315 41 GGGCCTCACCGTCACAGTCCGCCTCGTCTGAGCGGTCCTGA GGGCCTCACCGTCACAGTCCACCTCGTCTGAGCGGTCCTGA Direct Gain 0 0.55380779504776 Functional Gain 0.55380779504776 LRP5 ENSG00000162337 CDS Human protein_coding chr11:68201295 chr11:68201295 nonsynonymous SNV 0.005 1 21 hm6Am_associated_SNPs_149646 1 18455228 Bone mineral density 6e-12 GWAS_Catalog TagSNP rs3736228 GCST000182 Bone mineral density, osteoporosis, and osteoporotic fractures: a genome-wide association study.
326 chr11 75274150 75274150 1 + G T rs590121 75274150 - 75274130 75274170 41 GTTTAAACCCTGCAGTTACTCCAAGAACCCTGTGGCAGTGG GTTTAAACCCTGCAGTTACTACAAGAACCCTGTGGCAGTGG Direct Gain 0 0.731315016746521 Functional Gain 0.731315016746521 SERPINH1 ENSG00000149257 UTR5 Human protein_coding chr11:75274150 chr11:75274150 . . 0 21 hm6Am_associated_SNPs_149808 0 29212778 Coronary artery disease 2e-10 GWAS_Catalog TagSNP rs590121 GCST005196 Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease.
327 chr11 89867872 89867872 1 + C T rs1892887 89867872 - 89867852 89867892 41 CATTCGCGAGCTTCGGGGCTGCAGAGAAACAGAGAGCGCGC CATTCGCGAGCTTCGGGGCTACAGAGAAACAGAGAGCGCGC Direct Gain 0 0.924105048179626 Functional Gain 0.924105048179626 NAALAD2 ENSG00000077616 UTR5 Human protein_coding chr11:89867872 chr11:89867872 . . 0 21 hm6Am_associated_SNPs_149874 0 17052657 Parkinson's disease 0.000160374 Johnson and O'Donnell TagSNP rs1892887 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
328 chr11 120998942 120998942 1 + C T rs10502247 120998942 - 120998922 120998962 41 GGCTTCTTCTTGTTGATGTCGATTTCCAAGTACTCTGGGCG GGCTTCTTCTTGTTGATGTCAATTTCCAAGTACTCTGGGCG Direct Gain 0 0.773888826370239 Functional Gain 0.773888826370239 TECTA ENSG00000109927 CDS Human protein_coding chr11:120998942 chr11:120998942 synonymous SNV . 0 21 hm6Am_associated_SNPs_150044 3 17554300 Multiple complex diseases 0.000334949 Johnson and O'Donnell TagSNP rs10502247 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
329 chr11 126310082 126310082 1 + A T rs878830 126310082 - 126310062 126310102 41 GGCTCTGACCAAATTCCGCATCCTAAGGGCAGAGGGGCACA GGCTCTGACCAAATTCCGCAACCTAAGGGCAGAGGGGCACA Direct Gain 0 0.609583735466003 Functional Gain 0.609583735466003 KIRREL3 ENSG00000149571 intronic Human protein_coding chr11:126310082 chr11:126310082 . . 0 21 hm6Am_associated_SNPs_150107 0 26528553 Gut microbiome composition (winter) 5e-06 GWAS_Catalog TagSNP rs878830 GCST003223 Genome-Wide Association Studies of the Human Gut Microbiota.
330 chr12 3393100 3393100 1 + C T rs67551338 3393100 - 3393080 3393120 41 GCCTGCTTCACGCTCCACCCGCCTCTCCCAGGCTCCTGTCC GCCTGCTTCACGCTCCACCCACCTCTCCCAGGCTCCTGTCC Direct Gain 0 0.754651665687561 Functional Gain 0.754651665687561 TSPAN9 ENSG00000011105 UTR3 Human protein_coding chr12:3393100 chr12:3393100 . . 0 21 hm6Am_associated_SNPs_150253 0 28452372 Glomerular filtration rate (creatinine) 2e-09 GWAS_Catalog TagSNP rs67551338 GCST004292 1000 Genomes-based meta-analysis identifies 10 novel loci for kidney function.
331 chr13 100518634 100518634 1 + C T rs41281112 100518634 - 100518614 100518654 41 GCCCATGGCGGCTCCTTCTCGTGACTGTCTAAGCAGCCCAG GCCCATGGCGGCTCCTTCTCATGACTGTCTAAGCAGCCCAG Direct Gain 0 0.582931399345398 Functional Gain 0.582931399345398 CLYBL ENSG00000125246 CDS Human protein_coding chr13:100518634 chr13:100518634 stopgain 0.101 1 21 hm6Am_associated_SNPs_151456 0 22367966 Vitamin B12 levels 9e-10 GWAS_Catalog TagSNP rs41281112 GCST001424 Genome-wide association study identifies novel loci associated with serum level of vitamin B12 in Chinese men.
332 chr14 23848311 23848311 1 + C T rs723840 23848311 - 23848291 23848331 41 AAAGCAGCAATGGCAGCTCCGTCCCGGGAGGTCACAGCTGC AAAGCAGCAATGGCAGCTCCATCCCGGGAGGTCACAGCTGC Direct Gain 0 0.920763611793518 Functional Gain 0.920763611793518 CMTM5 ENSG00000166091 CDS Human protein_coding chr14:23848311 chr14:23848311 synonymous SNV . 0 21 hm6Am_associated_SNPs_151640 0 31085060 Emotional lability in attention deficit hyperactivity disorder 4e-06 GWAS_Catalog TagSNP rs723840 GCST007880 Genome-wide analysis of emotional lability in adult attention deficit hyperactivity disorder (ADHD).
333 chr14 55227152 55227152 1 + G T rs149416017 55227152 - 55227132 55227172 41 CTCTGGCAGGGGGGCGACGGCCAGCTCCCCATCGCAGCTGC CTCTGGCAGGGGGGCGACGGACAGCTCCCCATCGCAGCTGC Direct Gain 0 0.935324311256409 Functional Gain 0.935324311256409 SAMD4A ENSG00000020577 CDS Human protein_coding chr14:55227152 chr14:55227152 nonsynonymous SNV 0.876 1 21 hm6Am_associated_SNPs_151771 0 28521775 Subclinical trait of interstitial lung disease (basilar percentage of high attenuation areas on CT scan) 3e-08 GWAS_Catalog TagSNP rs149416017 GCST004526 Genome-wide association study of subclinical interstitial lung disease in MESA.
334 chr14 75230953 75230953 1 + C T rs45599947 75230953 - 75230933 75230973 41 GGACAGTTGTCTTATTTCCAGGGGGGGCGGACGGTGGTGGT GGACAGTTGTCTTATTTCCAAGGGGGGCGGACGGTGGTGGT Direct Gain 0 0.534942269325256 Functional Gain 0.534942269325256 YLPM1 ENSG00000119596 CDS Human protein_coding chr14:75230953 chr14:75230953 nonsynonymous SNV 0.802 0 21 hm6Am_associated_SNPs_151933 0 30643256 Neuroticism 3e-08 GWAS_Catalog TagSNP rs45599947 GCST007339 Multivariate genome-wide analyses of the well-being spectrum.
335 chr14 93118229 93118229 1 + C T rs117068593 93118229 - 93118209 93118249 41 TGGGGGAGGGGGTGGTGGGCGGCGTGGGGCCCACCTGGAGG TGGGGGAGGGGGTGGTGGGCAGCGTGGGGCCCACCTGGAGG Direct Gain 0 0.827748775482178 Functional Gain 0.827748775482178 RIN3 ENSG00000100599 CDS Human protein_coding chr14:93118229 chr14:93118229 nonsynonymous SNV 0.123 3 21 hm6Am_associated_SNPs_152013 0 26634245 Post bronchodilator FEV1/FVC ratio 2e-08 GWAS_Catalog TagSNP rs117068593 GCST003264 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
336 chr14 105954705 105954705 1 + C T rs55633823 105954705 - 105954685 105954725 41 CTTTAGGCCCAAACATGGCTGCGTAGCAGGGGTGGTTGCAG CTTTAGGCCCAAACATGGCTACGTAGCAGGGGTGGTTGCAG Direct Gain 0 0.854806780815125 Functional Gain 0.854806780815125 CRIP1 ENSG00000213145;ENSG00000257341 CDS Human other chr14:105954705 chr14:105954705 nonsynonymous SNV 0.535 2 21 hm6Am_associated_SNPs_152297 0 30048462 Heel bone mineral density 3e-14 GWAS_Catalog TagSNP rs55633823 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
337 chr15 33954652 33954652 1 + C T rs4780144 33954652 - 33954632 33954672 41 GGACTCGTCCGGGAAGAGGCGGATATTCCTGGTGGTGCTGG GGACTCGTCCGGGAAGAGGCAGATATTCCTGGTGGTGCTGG Direct Gain 0 0.8820481300354 Functional Gain 0.8820481300354 RYR3 ENSG00000198838 CDS Human protein_coding chr15:33954652 chr15:33954652 nonsynonymous SNV 0.889 1 21 hm6Am_associated_SNPs_152403 0 25646338 Trans fatty acid levels 2e-06 GWAS_Catalog TagSNP rs4780144 GCST002721 Genetic loci associated with circulating phospholipid trans fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium.
338 chr15 41136885 41136885 1 + C T rs11549914 41136885 - 41136865 41136905 41 CAGGCAGTCGGCTCCCGCGGGCAGCCCAGGGGGCGCGGGCG CAGGCAGTCGGCTCCCGCGGACAGCCCAGGGGGCGCGGGCG Direct Gain 0 0.946001172065735 Functional Gain 0.946001172065735 SPINT1 ENSG00000166145 CDS Human protein_coding chr15:41136885 chr15:41136885 nonsynonymous SNV 0.383 0 21 hm6Am_associated_SNPs_152461 0 29875488 Blood protein levels 6e-19 GWAS_Catalog TagSNP rs11549914 GCST005806 Genomic atlas of the human plasma proteome.
339 chr15 41247859 41247859 1 + A T rs112036939 41247859 - 41247839 41247879 41 CTGAGGCCCACAGAGCTGCATGAAGTCTGCCAGACGCAGCA CTGAGGCCCACAGAGCTGCAAGAAGTCTGCCAGACGCAGCA Direct Gain 0 0.638328611850739 Functional Gain 0.638328611850739 CHAC1 ENSG00000128965 CDS Human protein_coding chr15:41247859 chr15:41247859 nonsynonymous SNV 0.976 0 21 hm6Am_associated_SNPs_152475 0 30595370 Menarche (age at onset) 7e-09 GWAS_Catalog TagSNP rs112036939 GCST007078 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
340 chr15 42861362 42861362 1 + C T rs12439377 42861362 - 42861342 42861382 41 GAGTATATCCTGAGGCAGTTGTTAGTATATCACTCTCTATT GAGTATATCCTGAGGCAGTTATTAGTATATCACTCTCTATT Direct Gain 0 0.798555254936218 Functional Gain 0.798555254936218 HAUS2 ENSG00000261822 ncRNA_intronic Human antisense chr15:42861362 chr15:42861362 . . 0 21 hm6Am_associated_SNPs_152510 0 17554300 Multiple complex diseases 0.000102984 Johnson and O'Donnell TagSNP rs12439377 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
341 chr15 74219546 74219546 1 + G T rs1048661 74219546 - 74219526 74219566 41 GGGAGACGGAGGTGCGGGCCCGGGCCATGCCCGTGCTGTCC GGGAGACGGAGGTGCGGGCCAGGGCCATGCCCGTGCTGTCC Direct Gain 0 0.978259742259979 Functional Gain 0.978259742259979 LOXL1 ENSG00000129038 CDS Human protein_coding chr15:74219546 chr15:74219546 nonsynonymous SNV 0.983 1 21 hm6Am_associated_SNPs_152715 1 17690259 Glaucoma 2.3e-12 Johnson and O'Donnell TagSNP rs1048661 . Common sequence variants in the LOXL1 gene confer susceptibility to exfoliation glaucoma.
342 chr16 716512 716512 1 + C T rs35506206 716512 - 716492 716532 41 GGAGGCCCAGACGCTGACCCGCTGGTCCCCACTGGCAGCCA GGAGGCCCAGACGCTGACCCACTGGTCCCCACTGGCAGCCA Direct Gain 0 0.830703020095825 Functional Gain 0.830703020095825 WDR90 ENSG00000161996 CDS Human protein_coding chr16:716512 chr16:716512 nonsynonymous SNV 0.526 3 21 hm6Am_associated_SNPs_153217 0 30595370 Mean corpuscular hemoglobin 4e-12 GWAS_Catalog TagSNP rs35506206 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
343 chr16 2222286 2222286 1 + C T rs11547311 2222286 - 2222266 2222306 41 CTGCCCGCTACCCGGCAGCCGTGCCGGCAGTGGATGAAGAG CTGCCCGCTACCCGGCAGCCATGCCGGCAGTGGATGAAGAG Direct Gain 0 0.792733430862427 Functional Gain 0.792733430862427 TRAF7 ENSG00000131653 CDS Human protein_coding chr16:2222286 chr16:2222286 synonymous SNV . 0 21 hm6Am_associated_SNPs_153419 0 28552196 Height 7e-07 GWAS_Catalog TagSNP rs11547311 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
344 chr16 4431767 4431767 1 + C T rs148092711 4431767 - 4431747 4431787 41 CACGCAGTTGAAGGGGTTGCGGGCAGCTGCCAGCAGCCGCA CACGCAGTTGAAGGGGTTGCAGGCAGCTGCCAGCAGCCGCA Direct Gain 0 0.637891232967377 Functional Gain 0.637891232967377 VASN ENSG00000168140 CDS Human protein_coding chr16:4431767 chr16:4431767 nonsynonymous SNV 0.995 2 21 hm6Am_associated_SNPs_153594 0 30598549 Heel bone mineral density 4e-14 GWAS_Catalog TagSNP rs148092711 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
345 chr16 11038360 11038360 1 + C T rs8054198 11038360 - 11038340 11038380 41 CGGCCGCCGCCGCGTGGGGCGCTGGGAAATGCAGTTCACCC CGGCCGCCGCCGCGTGGGGCACTGGGAAATGCAGTTCACCC Direct Gain 0 0.926856637001038 Functional Gain 0.926856637001038 CLEC16A ENSG00000038532 UTR5 Human protein_coding chr16:11038360 chr16:11038360 . . 0 21 hm6Am_associated_SNPs_153673 0 28714469 Systemic lupus erythematosus 2e-08 GWAS_Catalog TagSNP rs8054198 GCST005752 Transancestral mapping and genetic load in systemic lupus erythematosus.
346 chr16 28875204 28875204 1 + A T rs11864750 28875204 - 28875184 28875224 41 CGGCGGCGGCTCCCGCTCCCTGCGCCCCCACCCACTACGCG CGGCGGCGGCTCCCGCTCCCAGCGCCCCCACCCACTACGCG Direct Gain 0 0.962252259254456 Functional Gain 0.962252259254456 SH2B1 ENSG00000178188 UTR5 Human protein_coding chr16:28875204 chr16:28875204 . . 0 21 hm6Am_associated_SNPs_153878 0 30038396 Highest math class taken (MTAG) 7e-37 GWAS_Catalog TagSNP rs11864750 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
347 chr16 30785824 30785824 1 + C T rs11642862 30785824 - 30785804 30785844 41 TGGTCCTCATTTGTGAGCCAGTAGGCAGGGAGCGAGCCTTC TGGTCCTCATTTGTGAGCCAATAGGCAGGGAGCGAGCCTTC Direct Gain 0 0.886939644813538 Functional Gain 0.886939644813538 RNF40 ENSG00000103549 UTR3 Human protein_coding chr16:30785824 chr16:30785824 . . 0 21 hm6Am_associated_SNPs_153965 0 28928442 Tonsillectomy 2e-06 GWAS_Catalog TagSNP rs11642862 GCST005014 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
348 chr16 50705254 50705254 1 + C T rs59302410 50705254 - 50705234 50705274 41 TGAACTGCAAGCGGGCACTCGCCCATGTTTTAGGGCTGAAT TGAACTGCAAGCGGGCACTCACCCATGTTTTAGGGCTGAAT Direct Gain 0 0.581445276737213 Functional Gain 0.581445276737213 LOC101927272 ENSG00000260249 ncRNA_exonic Human antisense chr16:50705254 chr16:50705254 . . 0 21 hm6Am_associated_SNPs_154044 0 30048462 Heel bone mineral density 2e-19 GWAS_Catalog TagSNP rs59302410 GCST006433 Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
349 chr16 50745926 50745926 1 + C T rs2066844 50745926 - 50745906 50745946 41 GCGGGCACAGGCCTGGCGCCGGAGCAGGGCCTTCTCAGATG GCGGGCACAGGCCTGGCGCCAGAGCAGGGCCTTCTCAGATG Direct Gain 0 0.96026736497879 Functional Gain 0.96026736497879 NOD2 ENSG00000167207 CDS Human protein_coding chr16:50745926 chr16:50745926 nonsynonymous SNV 0.472 2 21 hm6Am_associated_SNPs_154047 5 29228715 Colorectal adenoma (advanced) 8e-06 GWAS_Catalog TagSNP rs2066844 GCST005153 Bayesian and frequentist analysis of an Austrian genome-wide association study of colorectal cancer and advanced adenomas.
350 chr16 67572130 67572130 1 + C T rs567068501 67572130 - 67572110 67572150 41 GCGACTCGGCCTCGGACTCAGCGTGGCCTCGGCTCGGCCCC GCGACTCGGCCTCGGACTCAACGTGGCCTCGGCTCGGCCCC Direct Gain 0 0.989253401756287 Functional Gain 0.989253401756287 RIPOR1 ENSG00000039523 UTR5 Human protein_coding chr16:67572130 chr16:67572130 . . 0 21 hm6Am_associated_SNPs_154199 0 30598549 Heel bone mineral density 5e-15 GWAS_Catalog TagSNP rs567068501 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
351 chr16 84698110 84698110 1 + C T rs16974367 84698110 - 84698090 84698130 41 AATATGAAGCGCAGGACGTCGTATGTAACTCATGAGGCACA AATATGAAGCGCAGGACGTCATATGTAACTCATGAGGCACA Direct Gain 0 0.728998780250549 Functional Gain 0.728998780250549 KLHL36 ENSG00000135686;ENSG00000103194 intergenic Human other chr16:84698110 chr16:84698110 . . 0 21 hm6Am_associated_SNPs_154367 0 17554300 Multiple complex diseases 0.000462206 Johnson and O'Donnell TagSNP rs16974367 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
352 chr16 87678441 87678441 1 + C T rs8051448 87678441 - 87678421 87678461 41 GTCATGCAGCCGTAGCCATGGCGCCGGTTGCTGGCCCACTC GTCATGCAGCCGTAGCCATGACGCCGGTTGCTGGCCCACTC Direct Gain 0 0.599066436290741 Functional Gain 0.599066436290741 JPH3 ENSG00000154118 CDS Human protein_coding chr16:87678441 chr16:87678441 synonymous SNV . 0 21 hm6Am_associated_SNPs_154440 0 29495422 Idiopathic dilated cardiomyopathy 8e-06 GWAS_Catalog TagSNP rs8051448 GCST005588 A Genome-Wide Association Study of Idiopathic Dilated Cardiomyopathy in African Americans.
353 chr16 89235401 89235401 1 + C T rs117156175 89235401 - 89235381 89235421 41 CTTAGGCCAGTCACAGCCCCGTTACCGAAGAGGCAGTGGGG CTTAGGCCAGTCACAGCCCCATTACCGAAGAGGCAGTGGGG Direct Gain 0 0.844732165336609 Functional Gain 0.844732165336609 LINC02138 ENSG00000205015 ncRNA_exonic Human lincRNA chr16:89235401 chr16:89235401 . . 0 21 hm6Am_associated_SNPs_154551 0 29739929 Low tan response 1e-173 GWAS_Catalog TagSNP rs117156175 GCST005897 Genome-wide association study in 176,678 Europeans reveals genetic loci for tanning response to sun exposure.
354 chr16 89985844 89985844 1 + G T rs1805005 89985844 - 89985824 89985864 41 GTTCTTGGCGATGGTGGCCACCACCAGCGCGTTCTCCACCA GTTCTTGGCGATGGTGGCCAACACCAGCGCGTTCTCCACCA Direct Gain 0 0.739806175231934 Functional Gain 0.739806175231934 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89985844 chr16:89985844 nonsynonymous SNV 0.718 3 21 hm6Am_associated_SNPs_154622 3 30531825 Red vs. brown/black hair color 3e-243 GWAS_Catalog TagSNP rs1805005 GCST006986 Genome-wide study of hair colour in UK Biobank explains most of the SNP heritability.
355 chr16 89986144 89986144 1 + C T rs1805008 89986144 - 89986124 89986164 41 CGCAACGGCTCGCCGCGCCCGCGGCAGGGTCACGATGCTGT CGCAACGGCTCGCCGCGCCCACGGCAGGGTCACGATGCTGT Direct Gain 0 0.923012137413025 Functional Gain 0.923012137413025 MC1R ENSG00000198211;ENSG00000258839 CDS Human other chr16:89986144 chr16:89986144 nonsynonymous SNV 0.000 1 21 hm6Am_associated_SNPs_154624 6 30038396 Educational attainment (MTAG) 2e-15 GWAS_Catalog TagSNP rs1805008 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
356 chr17 1673276 1673276 1 + C T rs1136287 1673276 - 1673256 1673296 41 GCACGTTGGTCGTGGGGCTCGTGCTGGATCGCACCCGGTAC GCACGTTGGTCGTGGGGCTCATGCTGGATCGCACCCGGTAC Direct Gain 0 0.568307816982269 Functional Gain 0.568307816982269 SERPINF1 ENSG00000132386 CDS Human protein_coding chr17:1673276 chr17:1673276 nonsynonymous SNV 0.003 1 21 hm6Am_associated_SNPs_154706 1 30072576 Blood protein levels 5e-49 GWAS_Catalog TagSNP rs1136287 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
357 chr17 7554772 7554772 1 + C T rs1642762 7554772 - 7554752 7554792 41 GAGAAGCGGGGGCGCCGCGCGCTGAAGCCCTCCACACACCC GAGAAGCGGGGGCGCCGCGCACTGAAGCCCTCCACACACCC Direct Gain 0 0.927137970924377 Functional Gain 0.927137970924377 ATP1B2 ENSG00000129244 UTR5 Human protein_coding chr17:7554772 chr17:7554772 . . 0 21 hm6Am_associated_SNPs_154896 0 29875488 Blood protein levels 2e-29 GWAS_Catalog TagSNP rs1642762 GCST005806 Genomic atlas of the human plasma proteome.
358 chr17 18064730 18064730 1 + C T rs8077577 18064730 - 18064710 18064750 41 AGGCCTGGGGTCCGGCTCACGTCTTGGAGGAAGCGAGTGAG AGGCCTGGGGTCCGGCTCACATCTTGGAGGAAGCGAGTGAG Direct Gain 0 0.908093929290771 Functional Gain 0.908093929290771 MYO15A ENSG00000091536 CDS Human protein_coding chr17:18064730 chr17:18064730 synonymous SNV . 0 21 hm6Am_associated_SNPs_155067 2 23251661 Obesity-related traits 4e-06 GWAS_Catalog TagSNP rs8077577 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
359 chr17 18923681 18923681 1 + C T rs117355297 18923681 - 18923661 18923701 41 AGGATGGCATTGAAGCCACAGACACGGGCCCAGAAGGCGTG AGGATGGCATTGAAGCCACAAACACGGGCCCAGAAGGCGTG Direct Gain 0 0.828185200691223 Functional Gain 0.828185200691223 SLC5A10 ENSG00000154025 CDS Human protein_coding chr17:18923681 chr17:18923681 synonymous SNV . 0 21 hm6Am_associated_SNPs_155097 0 28588231 1,5-anhydroglucitol levels 2e-17 GWAS_Catalog TagSNP rs117355297 GCST004643 Genome-wide association study of 1,5-anhydroglucitol identifies novel genetic loci linked to glucose metabolism.
360 chr17 38173637 38173637 1 + C T rs146890554 38173637 - 38173617 38173657 41 GCCAAGGGGATGCAGGGGCCGCTGTGCAGTCGGCTGAGGCC GCCAAGGGGATGCAGGGGCCACTGTGCAGTCGGCTGAGGCC Direct Gain 0 0.840031862258911 Functional Gain 0.840031862258911 CSF3 ENSG00000108342 UTR3 Human protein_coding chr17:38173637 chr17:38173637 . . 0 21 hm6Am_associated_SNPs_155326 0 27863252 Neutrophil percentage of white cells 1e-13 GWAS_Catalog TagSNP rs146890554 GCST004633 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
361 chr17 40716235 40716235 1 + C T rs668799 40716235 - 40716215 40716255 41 CCCTCAAAATGGCCTTCCCCGTCCCCCATCCACTCCCTCTG CCCTCAAAATGGCCTTCCCCATCCCCCATCCACTCCCTCTG Direct Gain 0 0.640372633934021 Functional Gain 0.640372633934021 COASY ENSG00000068120 intronic Human protein_coding chr17:40716235 chr17:40716235 . . 0 21 hm6Am_associated_SNPs_155373 0 31015401 Medication use (drugs used in diabetes) 7e-09 GWAS_Catalog TagSNP rs668799 GCST007923 Genome-wide association study of medication-use and associated disease in the UK Biobank.
362 chr17 40913366 40913366 1 + C T rs9892728 40913366 - 40913346 40913386 41 CCGCGCTCACCGCCCAGCAGGAGGAGGAGGCGGAGCGCTGC CCGCGCTCACCGCCCAGCAGAAGGAGGAGGCGGAGCGCTGC Direct Gain 0 0.520470321178436 Functional Gain 0.520470321178436 RAMP2 ENSG00000131477 CDS Human protein_coding chr17:40913366 chr17:40913366 synonymous SNV . 0 21 hm6Am_associated_SNPs_155386 0 30718926 Type 2 diabetes 4e-08 GWAS_Catalog TagSNP rs9892728 GCST007847 Identification of 28 new susceptibility loci for type 2 diabetes in the Japanese population.
363 chr17 41926126 41926126 1 + C T rs72836561 41926126 - 41926106 41926146 41 GAGCTCCTGGCGGCTGTCACGGATGGACACCCTGCCCTTCA GAGCTCCTGGCGGCTGTCACAGATGGACACCCTGCCCTTCA Direct Gain 0 0.645778119564056 Functional Gain 0.645778119564056 CD300LG ENSG00000161649 CDS Human protein_coding chr17:41926126 chr17:41926126 nonsynonymous SNV 0.046 3 21 hm6Am_associated_SNPs_155410 0 28270201 HDL cholesterol 2e-11 GWAS_Catalog TagSNP rs72836561 GCST004207 Exploration of haplotype research consortium imputation for genome-wide association studies in 20,032 Generation Scotland participants.
364 chr17 42857175 42857175 1 + C T rs143360647 42857175 - 42857155 42857195 41 GGCTGGATGGGGGCAGCCTCGTGGTTCAGGGCCGAGACGGT GGCTGGATGGGGGCAGCCTCATGGTTCAGGGCCGAGACGGT Direct Gain 0 0.836149752140045 Functional Gain 0.836149752140045 ADAM11 ENSG00000073670 UTR3 Human protein_coding chr17:42857175 chr17:42857175 . . 0 21 hm6Am_associated_SNPs_155449 0 30595370 Height 3e-08 GWAS_Catalog TagSNP rs143360647 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
365 chr17 43212963 43212963 1 + G T rs2291447 43212963 - 43212943 43212983 41 CTGTTTCACATTCGGCTTACCTACCTCAACCATTCAGCACA CTGTTTCACATTCGGCTTACATACCTCAACCATTCAGCACA Direct Gain 0 0.894956231117249 Functional Gain 0.894956231117249 ACBD4 ENSG00000181513 UTR5 Human protein_coding chr17:43212963 chr17:43212963 . . 0 21 hm6Am_associated_SNPs_155460 0 22566634 Economic and political preferences 2e-06 GWAS_Catalog TagSNP rs2291447 GCST001519 The genetic architecture of economic and political preferences.
366 chr17 47000251 47000251 1 + C T rs1058018 47000251 - 47000231 47000271 41 CGATCTTTGCAGGCCACCTCGTAGAAGTCGTAATACTCCAG CGATCTTTGCAGGCCACCTCATAGAAGTCGTAATACTCCAG Direct Gain 0 0.904669106006622 Functional Gain 0.904669106006622 UBE2Z ENSG00000159202 CDS Human protein_coding chr17:47000251 chr17:47000251 synonymous SNV . 0 21 hm6Am_associated_SNPs_155529 0 27362418 Type 2 diabetes 3e-08 GWAS_Catalog TagSNP rs1058018 GCST005716 A Powerful Procedure for Pathway-Based Meta-analysis Using Summary Statistics Identifies 43 Pathways Associated with Type II Diabetes in European Populations.
367 chr17 59485393 59485393 1 + C T rs2240736 59485393 - 59485373 59485413 41 TGGAAGAAACAGAACAAGACGAGGGTTAGACATCTTGCCTG TGGAAGAAACAGAACAAGACAAGGGTTAGACATCTTGCCTG Direct Gain 0 0.539236187934875 Functional Gain 0.539236187934875 TBX2 ENSG00000267280 ncRNA_intronic Human antisense chr17:59485393 chr17:59485393 . . 0 21 hm6Am_associated_SNPs_155676 0 28739976 Systolic blood pressure 4e-06 GWAS_Catalog TagSNP rs2240736 GCST004776 Novel Blood Pressure Locus and Gene Discovery Using Genome-Wide Association Study and Expression Data Sets From Blood and the Kidney.
368 chr17 75211208 75211208 1 + C T rs3744064 75211208 - 75211188 75211228 41 ACTAAGTTTCCACTCACCCCGTCCCCCCAGCACCCCCACCG ACTAAGTTTCCACTCACCCCATCCCCCCAGCACCCCCACCG Direct Gain 0 0.520953714847565 Functional Gain 0.520953714847565 SEC14L1 ENSG00000129657 UTR3 Human protein_coding chr17:75211208 chr17:75211208 . . 0 21 hm6Am_associated_SNPs_155958 0 19734545 Cognitive performance 7e-07 GWAS_Catalog TagSNP rs3744064 GCST000477 A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB.
369 chr17 78178893 78178893 1 + C T rs11652075 78178893 - 78178873 78178913 41 CCGGGCGGGTCGATGGGGCCGCACCAGGGTATAGGGCACCA CCGGGCGGGTCGATGGGGCCACACCAGGGTATAGGGCACCA Direct Gain 0 0.822802186012268 Functional Gain 0.822802186012268 CARD14 ENSG00000141527 CDS Human protein_coding chr17:78178893 chr17:78178893 nonsynonymous SNV 0.297 1 21 hm6Am_associated_SNPs_156095 1 23143594 Psoriasis 3e-08 GWAS_Catalog TagSNP rs11652075 GCST005527 Identification of 15 new psoriasis susceptibility loci highlights the role of innate immunity.
370 chr17 79090198 79090198 1 + C T rs62073016 79090198 - 79090178 79090218 41 CAGTGGGAGTGAGGGGCCCAGGAGAGCCCCACCGAGGGGCA CAGTGGGAGTGAGGGGCCCAAGAGAGCCCCACCGAGGGGCA Direct Gain 0 0.564109444618225 Functional Gain 0.564109444618225 BAIAP2 ENSG00000175866 UTR3 Human protein_coding chr17:79090198 chr17:79090198 . . 0 21 hm6Am_associated_SNPs_156168 0 30593698 Fat-free mass 6e-11 GWAS_Catalog TagSNP rs62073016 GCST007063 Genomics of body fat percentage may contribute to sex bias in anorexia nervosa.
371 chr17 79682051 79682051 1 + C T rs3204270 79682051 - 79682031 79682071 41 TAGAGTGCCAGGATGCCGTCGGTACGCACCACCCGCAGCGC TAGAGTGCCAGGATGCCGTCAGTACGCACCACCCGCAGCGC Direct Gain 0 0.947324395179749 Functional Gain 0.947324395179749 SLC25A10 ENSG00000183048;ENSG00000262660 CDS Human other chr17:79682051 chr17:79682051 stopgain . 0 21 hm6Am_associated_SNPs_156232 0 23259602 Dental caries 5e-06 GWAS_Catalog TagSNP rs3204270 GCST001786 Genome-wide association scan of dental caries in the permanent dentition.
372 chr19 579100 579100 1 + C T rs2283573 579100 - 579080 579120 41 TGAGCAGGGACCAGGGCATCGAGCTCTTGTAGCAGCCCCAG TGAGCAGGGACCAGGGCATCAAGCTCTTGTAGCAGCCCCAG Direct Gain 0 0.774836122989655 Functional Gain 0.774836122989655 BSG ENSG00000172270 intronic Human protein_coding chr19:579100 chr19:579100 . . 0 21 hm6Am_associated_SNPs_156657 0 17554300 Multiple complex diseases 5.01e-06 Johnson and O'Donnell TagSNP rs2283573 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
373 chr19 1026477 1026477 1 + G T rs4807440 1026477 - 1026457 1026497 41 GCGGCCGCGGACTTCCTGAGCCCCCTCGGTCGCCCCCGGAC GCGGCCGCGGACTTCCTGAGACCCCTCGGTCGCCCCCGGAC Direct Gain 0 0.582326829433441 Functional Gain 0.582326829433441 CNN2 ENSG00000064666 UTR5 Human protein_coding chr19:1026477 chr19:1026477 . . 0 21 hm6Am_associated_SNPs_156740 0 27863252 Monocyte count 3e-11 GWAS_Catalog TagSNP rs4807440 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
374 chr19 10397230 10397230 1 + C T rs75407602 10397230 - 10397210 10397250 41 GGGCAATGTTGCGAGACCCCGTCTCTGGAAAAAAAAAAAAA GGGCAATGTTGCGAGACCCCATCTCTGGAAAAAAAAAAAAA Direct Gain 0 0.791253805160522 Functional Gain 0.791253805160522 ICAM1 ENSG00000267607 ncRNA_exonic Human antisense chr19:10397230 chr19:10397230 . . 0 21 hm6Am_associated_SNPs_157248 0 29875488 Blood protein levels 8e-86 GWAS_Catalog TagSNP rs75407602 GCST005806 Genomic atlas of the human plasma proteome.
375 chr19 11227554 11227554 1 + C T rs1799898 11227554 - 11227534 11227574 41 AGTTTGGAGTCAACCCAGTAGAGGCGGCCACTGAGGAGATC AGTTTGGAGTCAACCCAGTAAAGGCGGCCACTGAGGAGATC Direct Gain 0 0.8938068151474 Functional Gain 0.8938068151474 LDLR ENSG00000130164 CDS Human protein_coding chr19:11227554 chr19:11227554 synonymous SNV . 0 21 hm6Am_associated_SNPs_157301 2 18159244 Early onset extreme obesity 0.0028 Johnson and O'Donnell TagSNP rs1799898 . Genome wide association (GWA) study for early onset extreme obesity supports the role of fat mass and obesity associated gene (FTO) variants.
376 chr19 11227602 11227602 1 + C T rs688 11227602 - 11227582 11227622 41 ATGGTCTTCCGGTTGCCCCCGTTGACATCGATGCTTGAGAT ATGGTCTTCCGGTTGCCCCCATTGACATCGATGCTTGAGAT Direct Gain 0 0.886471152305603 Functional Gain 0.886471152305603 LDLR ENSG00000130164 CDS Human protein_coding chr19:11227602 chr19:11227602 synonymous SNV . 0 21 hm6Am_associated_SNPs_157302 2 29507422 Total cholesterol levels 1e-25 GWAS_Catalog TagSNP rs688 GCST007143 A large electronic-health-record-based genome-wide study of serum lipids.
377 chr19 11350488 11350488 1 + C T rs2278426 11350488 - 11350468 11350508 41 GTTCCTGGCCTTTGTCAGCCGTCCCTCCGTGGTCCTGTACA GTTCCTGGCCTTTGTCAGCCATCCCTCCGTGGTCCTGTACA Direct Gain 0 0.889482736587524 Functional Gain 0.889482736587524 ANGPTL8 ENSG00000130173 CDS Human protein_coding chr19:11350488 chr19:11350488 nonsynonymous SNV 0.526 2 21 hm6Am_associated_SNPs_157307 0 23505323 HDL cholesterol 3e-09 GWAS_Catalog TagSNP rs2278426 GCST001904 Genomic study in Mexicans identifies a new locus for triglycerides and refines European lipid loci.
378 chr19 21666210 21666210 1 + C T rs2562456 21666210 - 21666190 21666230 41 TCCATGGGGACTTGGGAAAAGAAATCGGCCAGAGCCTCAAA TCCATGGGGACTTGGGAAAAAAAATCGGCCAGAGCCTCAAA Direct Gain 0 0.816873669624329 Functional Gain 0.816873669624329 LINC00664 ENSG00000268658 ncRNA_exonic Human lincRNA chr19:21666210 chr19:21666210 . . 0 21 hm6Am_associated_SNPs_157651 0 19207018 Pain 2e-10 GWAS_Catalog TagSNP rs2562456 GCST000326 Genome-wide association study of acute post-surgical pain in humans.
379 chr19 38778569 38778569 1 + C T rs141683432 38778569 - 38778549 38778589 41 CTTTAAGAACCTACCACTTGGGACAGAGGAATCCGCTGCAT CTTTAAGAACCTACCACTTGAGACAGAGGAATCCGCTGCAT Direct Gain 0 0.526131212711334 Functional Gain 0.526131212711334 SPINT2 ENSG00000167642 CDS Human protein_coding chr19:38778569 chr19:38778569 nonsynonymous SNV 0.989 0 21 hm6Am_associated_SNPs_157841 0 27989323 Stromal-cell-derived factor 1 alpha levels 1e-06 GWAS_Catalog TagSNP rs141683432 GCST004427 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
380 chr19 41305138 41305138 1 + G T rs184088518 41305138 - 41305118 41305158 41 TCCTCCGGCCCCGGCGCCGCCGTTTGTGCCAGCCGCCCTGC TCCTCCGGCCCCGGCGCCGCAGTTTGTGCCAGCCGCCCTGC Direct Gain 0 0.849686622619629 Functional Gain 0.849686622619629 RAB4B-EGLN2 ENSG00000269858 UTR5 Human protein_coding chr19:41305138 chr19:41305138 . . 0 21 hm6Am_associated_SNPs_157960 0 27863252 Hemoglobin concentration 4e-16 GWAS_Catalog TagSNP rs184088518 GCST004615 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
381 chr19 41306650 41306650 1 + C T rs61750953 41306650 - 41306630 41306670 41 TGGGGGTCCCACTCCCTGCCGAGGCCTCACTAGGCACTCCT TGGGGGTCCCACTCCCTGCCAAGGCCTCACTAGGCACTCCT Direct Gain 0 0.892486810684204 Functional Gain 0.892486810684204 EGLN2 ENSG00000269858 CDS Human protein_coding chr19:41306650 chr19:41306650 nonsynonymous SNV 0.678 1 21 hm6Am_associated_SNPs_157966 0 27863252 Hematocrit 6e-11 GWAS_Catalog TagSNP rs61750953 GCST004604 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
382 chr19 45147340 45147340 1 + G T rs11540084 45147340 - 45147320 45147360 41 TCTCCTCGCTTCCCGGCGCCCGCTCGCTCTGCCGCGGTCGC TCTCCTCGCTTCCCGGCGCCAGCTCGCTCTGCCGCGGTCGC Direct Gain 0 0.865952134132385 Functional Gain 0.865952134132385 PVR ENSG00000266903 ncRNA_intronic Human antisense chr19:45147340 chr19:45147340 . . 0 21 hm6Am_associated_SNPs_158054 0 27863252 Mean platelet volume 1e-17 GWAS_Catalog TagSNP rs11540084 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
383 chr19 45392254 45392254 1 + C T rs6857 45392254 - 45392234 45392274 41 GCTCACCCTGTCTGACCCTAGGCTGGGGCTGCTTGCTTGGT GCTCACCCTGTCTGACCCTAAGCTGGGGCTGCTTGCTTGGT Direct Gain 0 0.8117755651474 Functional Gain 0.8117755651474 NECTIN2 ENSG00000267282 ncRNA_intronic Human antisense chr19:45392254 chr19:45392254 . . 0 21 hm6Am_associated_SNPs_158070 0 23419831 Alzheimer's disease biomarkers 1e-10 GWAS_Catalog TagSNP rs6857 GCST001868 APOE and BCHE as modulators of cerebral amyloid deposition: a florbetapir PET genome-wide association study.
384 chr19 45412040 45412040 1 + C T rs769455 45412040 - 45412020 45412060 41 ATCGCGGAGGAGCCGCTTACGCAGCTTGCGCAGGTGGGAGG ATCGCGGAGGAGCCGCTTACACAGCTTGCGCAGGTGGGAGG Direct Gain 0 0.987003803253174 Functional Gain 0.987003803253174 APOE ENSG00000130203 CDS Human protein_coding chr19:45412040 chr19:45412040 nonsynonymous SNV 0.993 3 21 hm6Am_associated_SNPs_158076 2 29507422 Triglycerides 1e-09 GWAS_Catalog TagSNP rs769455 GCST007142 A large electronic-health-record-based genome-wide study of serum lipids.
385 chr19 49206603 49206603 1 + C T rs281377 49206603 - 49206583 49206623 41 TATTCCTCCTCCATCCAGTCGTTCAGGTGGTAGTTCTGCCA TATTCCTCCTCCATCCAGTCATTCAGGTGGTAGTTCTGCCA Direct Gain 0 0.854468464851379 Functional Gain 0.854468464851379 FUT2 ENSG00000176920 CDS Human protein_coding chr19:49206603 chr19:49206603 synonymous SNV . 0 21 hm6Am_associated_SNPs_158254 0 22001757 Liver enzyme levels (alkaline phosphatase) 1e-15 GWAS_Catalog TagSNP rs281377 GCST001276 Genome-wide association study identifies loci influencing concentrations of liver enzymes in plasma.
386 chr19 50016748 50016748 1 + C T rs59774409 50016748 - 50016728 50016768 41 CCGCCTGCAGCAGGGCCCTGGCCCGGAGCGGCCCTCACCTG CCGCCTGCAGCAGGGCCCTGACCCGGAGCGGCCCTCACCTG Direct Gain 0 0.511358261108398 Functional Gain 0.511358261108398 FCGRT ENSG00000104870 intronic Human protein_coding chr19:50016748 chr19:50016748 . . 0 21 hm6Am_associated_SNPs_158310 0 29507422 Triglycerides 8e-09 GWAS_Catalog TagSNP rs59774409 GCST007142 A large electronic-health-record-based genome-wide study of serum lipids.
387 chr19 50909765 50909765 1 + C T rs2230245 50909765 - 50909745 50909785 41 GCAGCAGGCACCTGCAGGTCGGTGATGATGCTGTGCTGCAC GCAGCAGGCACCTGCAGGTCAGTGATGATGCTGTGCTGCAC Direct Gain 0 0.97558867931366 Functional Gain 0.97558867931366 POLD1 ENSG00000062822 CDS Human protein_coding chr19:50909765 chr19:50909765 synonymous SNV . 0 21 hm6Am_associated_SNPs_158403 1 23251661 Obesity-related traits 6e-06 GWAS_Catalog TagSNP rs2230245 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
388 chr19 51228746 51228746 1 + C T rs13866 51228746 - 51228726 51228766 41 GCCGGGTGGTGGGATGGGCAGGGAGGCGGGGTACCGGCCCC GCCGGGTGGTGGGATGGGCAAGGAGGCGGGGTACCGGCCCC Direct Gain 0 0.700463056564331 Functional Gain 0.700463056564331 CLEC11A ENSG00000105472 UTR3 Human protein_coding chr19:51228746 chr19:51228746 . . 0 21 hm6Am_associated_SNPs_158420 0 30072576 Blood protein levels 4e-09 GWAS_Catalog TagSNP rs13866 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
389 chr19 51383200 51383200 1 + G T rs80050017 51383200 - 51383180 51383220 41 CAGGGGGGCTTCCTCATCCTCTCCCTTTCCCTCATCCCCTG CAGGGGGGCTTCCTCATCCTATCCCTTTCCCTCATCCCCTG Direct Gain 0 0.75806713104248 Functional Gain 0.75806713104248 KLK2 ENSG00000167751 UTR3 Human protein_coding chr19:51383200 chr19:51383200 . . 0 21 hm6Am_associated_SNPs_158429 0 26219847 Tandem gait 4e-07 GWAS_Catalog TagSNP rs80050017 GCST003055 Heritability and Genome-Wide Association Analyses of Human Gait Suggest Contribution of Common Variants.
390 chr19 55993436 55993436 1 + G T rs147110934 55993436 - 55993416 55993456 41 CCATCGCAGCGGTACACCAGCTCCACCGTGGTCTCCGCCGC CCATCGCAGCGGTACACCAGATCCACCGTGGTCTCCGCCGC Direct Gain 0 0.934132516384125 Functional Gain 0.934132516384125 ZNF628 ENSG00000197483 CDS Human protein_coding chr19:55993436 chr19:55993436 nonsynonymous SNV 0.952 0 21 hm6Am_associated_SNPs_158610 0 30593698 Fat-free mass 8e-09 GWAS_Catalog TagSNP rs147110934 GCST007063 Genomics of body fat percentage may contribute to sex bias in anorexia nervosa.
391 chr19 58992001 58992001 1 + C T rs58632700 58992001 - 58991981 58992021 41 GTCACTGCAGAAGTGACGCCGCTGGCCTGTGTGGCTCTTGC GTCACTGCAGAAGTGACGCCACTGGCCTGTGTGGCTCTTGC Direct Gain 0 0.690939784049988 Functional Gain 0.690939784049988 ZNF446 ENSG00000083838 CDS Human protein_coding chr19:58992001 chr19:58992001 nonsynonymous SNV 0.995 2 21 hm6Am_associated_SNPs_158746 0 23251661 Obesity-related traits 1e-07 GWAS_Catalog TagSNP rs58632700 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
392 chr20 4101800 4101800 1 + C T rs1741344 4101800 - 4101780 4101820 41 TCCAAGCTCGGAAATTCCACGGTCAACTCAGCTTCCAACTC TCCAAGCTCGGAAATTCCACAGTCAACTCAGCTTCCAACTC Direct Gain 0 0.554790496826172 Functional Gain 0.554790496826172 RNF24;SMOX ENSG00000205300;ENSG00000088826 intergenic Human other chr20:4101800 chr20:4101800 . . 0 21 hm6Am_associated_SNPs_158833 0 20881960 Height 3e-09 GWAS_Catalog TagSNP rs1741344 GCST000817 Hundreds of variants clustered in genomic loci and biological pathways affect human height.
393 chr20 8770822 8770822 1 + C T rs2294597 8770822 - 8770802 8770842 41 TTTACTTTGCGCTTCTTCTAGCTATAAGAAAGTTACAAGAA TTTACTTTGCGCTTCTTCTAACTATAAGAAAGTTACAAGAA Direct Gain 0 0.794487774372101 Functional Gain 0.794487774372101 PLCB1 ENSG00000182621 CDS Human protein_coding chr20:8770822 chr20:8770822 synonymous SNV . 0 21 hm6Am_associated_SNPs_158858 2 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.000717 Johnson and O'Donnell TagSNP rs2294597 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
394 chr20 29960787 29960787 1 + C T rs34247288 29960787 - 29960767 29960807 41 GATGTCGCAGGAACTCGCCTGTGGTCTTCATTGGATGGAAT GATGTCGCAGGAACTCGCCTATGGTCTTCATTGGATGGAAT Direct Gain 0 0.540747404098511 Functional Gain 0.540747404098511 DEFB118 ENSG00000131068 CDS Human protein_coding chr20:29960787 chr20:29960787 synonymous SNV . 0 21 hm6Am_associated_SNPs_158944 0 28644415 Prudent dietary pattern 2e-06 GWAS_Catalog TagSNP rs34247288 GCST004639 Genome-Wide Association Study of Dietary Pattern Scores.
395 chr20 62328742 62328742 1 + C T rs909341 62328742 - 62328722 62328762 41 TGGCACTGCTCTGAGCTGGAGCTGCTGGCTGAGAAGGTGCC TGGCACTGCTCTGAGCTGGAACTGCTGGCTGAGAAGGTGCC Direct Gain 0 0.783430576324463 Functional Gain 0.783430576324463 TNFRSF6B ENSG00000243509 CDS Human protein_coding chr20:62328742 chr20:62328742 synonymous SNV . 0 21 hm6Am_associated_SNPs_159425 0 25574825 Atopic dermatitis 8e-10 GWAS_Catalog TagSNP rs909341 GCST002737 Genome-wide comparative analysis of atopic dermatitis and psoriasis gives insight into opposing genetic mechanisms.
396 chr20 62729431 62729431 1 + C T rs2229205 62729431 - 62729411 62729451 41 AGGGCCCAGATGGCCACATTGACAGCCTGGGCTTTGCTGGA AGGGCCCAGATGGCCACATTAACAGCCTGGGCTTTGCTGGA Direct Gain 0 0.6071497797966 Functional Gain 0.6071497797966 OPRL1 ENSG00000125510 CDS Human protein_coding chr20:62729431 chr20:62729431 synonymous SNV . 0 21 hm6Am_associated_SNPs_159477 0 26112879 LDL peak particle diameter (total fat intake interaction) 7e-06 GWAS_Catalog TagSNP rs2229205 GCST002989 Interaction between Common Genetic Variants and Total Fat Intake on Low-Density Lipoprotein Peak Particle Diameter: A Genome-Wide Association Study.
397 chr21 37692507 37692507 1 + C T rs62229372 37692507 - 37692487 37692527 41 CGCAACCCGACTGGGAGGTGGCGGAACGACTGTGGAGCCCT CGCAACCCGACTGGGAGGTGACGGAACGACTGTGGAGCCCT Direct Gain 0 0.871366262435913 Functional Gain 0.871366262435913 MORC3 ENSG00000273199 ncRNA_exonic Human antisense chr21:37692507 chr21:37692507 . . 0 21 hm6Am_associated_SNPs_159542 0 30595370 Systolic blood pressure 2e-08 GWAS_Catalog TagSNP rs62229372 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
398 chr21 43442991 43442991 1 + C T rs118131263 43442991 - 43442971 43443011 41 GATTCTAGGCGTGAGCCTCCGCGCCCGGGCACAGGCTCTTT GATTCTAGGCGTGAGCCTCCACGCCCGGGCACAGGCTCTTT Direct Gain 0 0.536890625953674 Functional Gain 0.536890625953674 ZNF295-AS1 ENSG00000237232 ncRNA_exonic Human lincRNA chr21:43442991 chr21:43442991 . . 0 21 hm6Am_associated_SNPs_159600 0 28584286 Cognitive empathy 3e-06 GWAS_Catalog TagSNP rs118131263 GCST005755 Genome-wide meta-analysis of cognitive empathy: heritability, and correlates with sex, neuropsychiatric conditions and cognition.
399 chr21 47423482 47423482 1 + C T rs150432347 47423482 - 47423462 47423502 41 GCTCTGGGCGCTGCTGGCCCGTGCCGCTGTACTGCACCACC GCTCTGGGCGCTGCTGGCCCATGCCGCTGTACTGCACCACC Direct Gain 0 0.886414170265198 Functional Gain 0.886414170265198 COL6A1 ENSG00000142156 CDS Human protein_coding chr21:47423482 chr21:47423482 nonsynonymous SNV 0.001 1 21 hm6Am_associated_SNPs_159785 2 28234671 Systolic blood pressure 1e-07 GWAS_Catalog TagSNP rs150432347 GCST007829 Rare coding variants associated with blood pressure variation in 15 914 individuals of African ancestry.
400 chr22 19712094 19712094 1 + C T rs1059196 19712094 - 19712074 19712114 41 TTGGGCAGCGGAGGAGGCGGGGACCGGTCCAGGTTGGCGCG TTGGGCAGCGGAGGAGGCGGAGACCGGTCCAGGTTGGCGCG Direct Gain 0 0.918888092041016 Functional Gain 0.918888092041016 SEPT5-GP1BB ENSG00000184702;ENSG00000203618 UTR3 Human other chr22:19712094 chr22:19712094 . . 0 21 hm6Am_associated_SNPs_159907 0 27863252 Mean platelet volume 2e-21 GWAS_Catalog TagSNP rs1059196 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
401 chr22 19950235 19950235 1 + C T rs4633 19950235 - 19950215 19950255 41 GGCTCCGCATGCTGCAGCACGTGGTTCAGGATGCGCTGCTC GGCTCCGCATGCTGCAGCACATGGTTCAGGATGCGCTGCTC Direct Gain 0 0.57492470741272 Functional Gain 0.57492470741272 COMT ENSG00000093010 CDS Human protein_coding chr22:19950235 chr22:19950235 synonymous SNV . 0 21 hm6Am_associated_SNPs_159914 1 17634449 Coronary Artery Disease 0.001 Johnson and O'Donnell TagSNP rs4633 . Genomewide association analysis of coronary artery disease.
402 chr22 42666026 42666026 1 + C T rs187166731 42666026 - 42666006 42666046 41 GGAGGGAAGGTCTACCTGCTGGTCGCGCGAGGCCTTGGGTG GGAGGGAAGGTCTACCTGCTAGTCGCGCGAGGCCTTGGGTG Direct Gain 0 0.97184419631958 Functional Gain 0.97184419631958 OGFRP1 ENSG00000182057 ncRNA_exonic Human lincRNA chr22:42666026 chr22:42666026 . . 0 21 hm6Am_associated_SNPs_160518 0 27989323 Interleukin-1-receptor antagonist levels 5e-06 GWAS_Catalog TagSNP rs187166731 GCST004447 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
403 chr22 46722560 46722560 1 + C T rs6008700 46722560 - 46722540 46722580 41 ACCAATTTATTACCACCTTCGTGTCTTACCTCATTGCAGAG ACCAATTTATTACCACCTTCATGTCTTACCTCATTGCAGAG Direct Gain 0 0.795275449752808 Functional Gain 0.795275449752808 GTSE1 ENSG00000075218 intronic Human protein_coding chr22:46722560 chr22:46722560 . . 0 21 hm6Am_associated_SNPs_160611 0 17554300 Multiple complex diseases 0.000191459 Johnson and O'Donnell TagSNP rs6008700 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
404 chrX 150884620 150884620 1 + C T rs3810715 150884620 - 150884600 150884640 41 CCAGGGACATTTCCATCTCCGCCTTGGTGTTGGGAGGGCCT CCAGGGACATTTCCATCTCCACCTTGGTGTTGGGAGGGCCT Direct Gain 0 0.724370241165161 Functional Gain 0.724370241165161 FATE1 ENSG00000147378 CDS Human protein_coding chrX:150884620 chrX:150884620 nonsynonymous SNV 0.028 0 21 hm6Am_associated_SNPs_161174 0 17671248 Sporadic Amyotrophic Lateral Sclerosis (ALS) 0.01 Johnson and O'Donnell TagSNP rs3810715 . Whole-genome analysis of sporadic amyotrophic lateral sclerosis.