1 chr1 16259813 16259813 1 + A G rs848210 16259813 + 16259793 16259833 41 AGAGCCATGTCCCTGAATCCAACCAAGCTCAAGGTGAGAGT AGAGCCATGTCCCTGAATCCGACCAAGCTCAAGGTGAGAGT Direct Gain NA NA NA 0 0.909388780593872 Functional Gain 0.909388780593872 SPEN ENSG00000065526 CDS Human protein_coding chr1:16259813 chr1:16259813 nonsynonymous SNV 0.006 0 21 hm7G_associated_SNPs_1435 0 17463246 Multiple continuous traits in DGI samples 4.41e-05 Johnson and O'Donnell TagSNP rs848210 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
2 chr1 26646726 26646726 1 + A G rs1071849 26646726 + 26646706 26646746 41 CAGCCCCTCAGCATCCAGCAACATAAGCGGAGGCATTTTCC CAGCCCCTCAGCATCCAGCAGCATAAGCGGAGGCATTTTCC Direct Gain NA NA NA 0 0.735077083110809 Functional Gain 0.735077083110809 CD52 ENSG00000169442 CDS Human protein_coding chr1:26646726 chr1:26646726 nonsynonymous SNV 0.000 0 21 hm7G_associated_SNPs_1576 0 30595370 Eosinophil counts 1e-12 GWAS_Catalog TagSNP rs1071849 GCST007065 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
3 chr1 28793149 28793149 1 + C G rs61748637 28793149 + 28793129 28793169 41 GTCACCCCTTCCCCAGCACCCAGGACTCTGCCTGCTGCTCC GTCACCCCTTCCCCAGCACCGAGGACTCTGCCTGCTGCTCC Direct Gain NA NA NA 0 0.652840852737427 Functional Gain 0.652840852737427 PHACTR4 ENSG00000204138 CDS Human protein_coding chr1:28793149 chr1:28793149 synonymous SNV . 0 21 hm7G_associated_SNPs_1614 0 30578418 Pulse pressure 2e-11 GWAS_Catalog TagSNP rs61748637 GCST007269 Trans-ethnic association study of blood pressure determinants in over 750,000 individuals.
4 chr1 34663411 34663411 1 + C G rs1414474 34663411 + 34663391 34663431 41 CCTCCTCCTGCACGTCCTGACAAGCTCCCTGAGCTCCCTGC CCTCCTCCTGCACGTCCTGAGAAGCTCCCTGAGCTCCCTGC Direct Gain NA NA NA 0 0.844817399978638 Functional Gain 0.844817399978638 C1orf94 ENSG00000142698 CDS Human protein_coding chr1:34663411 chr1:34663411 nonsynonymous SNV 0.419 0 21 hm7G_associated_SNPs_1664 0 30487263 Proliferative diabetic retinopathy (vs NPDR and no DR) 1e-07 GWAS_Catalog TagSNP rs1414474 GCST007289 Multiethnic Genome-wide Association Study of Diabetic Retinopathy using Liability Threshold Modeling of Duration of Diabetes and Glycemic Control.
5 chr1 55512222 55512222 1 + C G rs67608943 55512222 + 55512202 55512242 41 AAGTTGCCCCATGTCGACTACATCGAGGAGGACTCCTCTGT AAGTTGCCCCATGTCGACTAGATCGAGGAGGACTCCTCTGT Direct Gain NA NA NA 0 0.942074835300446 Functional Gain 0.942074835300446 PCSK9 ENSG00000169174 CDS Human protein_coding chr1:55512222 chr1:55512222 stopgain 0.969 1 21 hm7G_associated_SNPs_1882 1 31217584 Low density lipoprotein cholesterol levels 5e-13 GWAS_Catalog TagSNP rs67608943 GCST008037 Genetic analyses of diverse populations improves discovery for complex traits.
6 chr1 62902874 62902874 1 + A G rs646179 62902874 + 62902854 62902894 41 GTAGTTGGTGTTGGTGCAAGACGGGAGCGAGCGGCGGTCGG GTAGTTGGTGTTGGTGCAAGGCGGGAGCGAGCGGCGGTCGG Direct Gain NA NA NA 0 0.649914383888245 Functional Gain 0.649914383888245 USP1 ENSG00000162607 UTR5 Human protein_coding chr1:62902874 chr1:62902874 . . 0 21 hm7G_associated_SNPs_1907 0 30595370 Red blood cell count 6e-14 GWAS_Catalog TagSNP rs646179 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
7 chr1 77094826 77094826 1 + A G rs676269 77094826 + 77094806 77094846 41 ATAGCTGCCTAGAATTGTTCAACAGTGAGTAACTTCCAGAA ATAGCTGCCTAGAATTGTTCGACAGTGAGTAACTTCCAGAA Direct Gain NA NA NA 0 0.598409056663513 Functional Gain 0.598409056663513 ST6GALNAC3 ENSG00000184005 UTR3 Human protein_coding chr1:77094826 chr1:77094826 . . 0 21 hm7G_associated_SNPs_1965 0 18282107 Schizophrenia 0.024735787 Johnson and O'Donnell TagSNP rs676269 . Genome-wide association identifies a common variant in the reelin gene that increases the risk of schizophrenia only in women.
8 chr1 113063771 113063771 1 + C G rs2273368 113063771 + 113063751 113063791 41 TTCTCTCTTTTTCTCTCTACCATTCTCAACCTGTATTGGAC TTCTCTCTTTTTCTCTCTACGATTCTCAACCTGTATTGGAC Direct Gain NA NA NA 0 0.685699582099915 Functional Gain 0.685699582099915 WNT2B ENSG00000134245 UTR3 Human protein_coding chr1:113063771 chr1:113063771 . . 0 21 hm7G_associated_SNPs_2136 0 30664634 Body fat distribution (trunk fat ratio) 1e-08 GWAS_Catalog TagSNP rs2273368 GCST007294 Genome-wide association study of body fat distribution identifies adiposity loci and sex-specific genetic effects.
9 chr1 114228200 114228200 1 + A G rs13524 114228200 + 114228180 114228220 41 CCACCTATTGTAACTATTCAAATAGAGCAAAATTAGGAGGC CCACCTATTGTAACTATTCAGATAGAGCAAAATTAGGAGGC Direct Gain NA NA NA 0 0.813490569591522 Functional Gain 0.813490569591522 MAGI3 ENSG00000081026 UTR3 Human protein_coding chr1:114228200 chr1:114228200 . . 0 21 hm7G_associated_SNPs_2143 0 17159887 Rheumatoid Arthritis 0.01 Johnson and O'Donnell TagSNP rs13524 . Genomic DNA pooling for whole-genome association scans in complex disease: empirical demonstration of efficacy in rheumatoid arthritis.
10 chr1 120267505 120267505 1 + C G rs483180 120267505 + 120267485 120267525 41 CTCACTCATCAAAGGTGCATCAAAACTAGGAAACACGCACA CTCACTCATCAAAGGTGCATGAAAACTAGGAAACACGCACA Direct Gain NA NA NA 0 0.504768371582031 Functional Gain 0.504768371582031 PHGDH ENSG00000092621 intronic Human protein_coding chr1:120267505 chr1:120267505 . . 0 21 hm7G_associated_SNPs_2196 0 28250457 Macular telangiectasia type 2 2e-14 GWAS_Catalog TagSNP rs483180 GCST004171 Genome-wide analyses identify common variants associated with macular telangiectasia type 2.
11 chr1 154990297 154990297 1 + C G rs2242194 154990297 + 154990277 154990317 41 GCAGGGGAAGGGGCTGCGGACCTGTGGGAAAGTGATCCCCT GCAGGGGAAGGGGCTGCGGAGCTGTGGGAAAGTGATCCCCT Direct Gain NA NA NA 0 0.56489086151123 Functional Gain 0.56489086151123 ZBTB7B ENSG00000160685 UTR3 Human protein_coding chr1:154990297 chr1:154990297 . . 0 21 hm7G_associated_SNPs_2351 0 26198764 Schizophrenia 2e-06 GWAS_Catalog TagSNP rs2242194 GCST003048 Genome-wide association study of schizophrenia in Ashkenazi Jews.
12 chr1 155006451 155006451 1 + C G rs76306191 155006451 + 155006431 155006471 41 CTCTCTTCTCTCACCAGAACCTTGTGTCCAAGGAGGTCCTT CTCTCTTCTCTCACCAGAACGTTGTGTCCAAGGAGGTCCTT Direct Gain NA NA NA 0 0.755720555782318 Functional Gain 0.755720555782318 DCST1 ENSG00000163357 UTR5 Human protein_coding chr1:155006451 chr1:155006451 . . 0 21 hm7G_associated_SNPs_2352 0 29782485 Height 3e-16 GWAS_Catalog TagSNP rs76306191 GCST005908 Evaluation and application of summary statistic imputation to discover new height-associated loci.
13 chr1 156629037 156629037 1 + A G rs11360 156629037 + 156629017 156629057 41 ACAACATGACGAGGGGTGGTACTGGAGTCCAGGTGACAGTT ACAACATGACGAGGGGTGGTGCTGGAGTCCAGGTGACAGTT Direct Gain NA NA NA 0 0.841584622859955 Functional Gain 0.841584622859955 BCAN ENSG00000229953 ncRNA_intronic Human antisense chr1:156629037 chr1:156629037 . . 0 21 hm7G_associated_SNPs_2383 0 17434096 Ischemic stroke 3.57e-05 Johnson and O'Donnell TagSNP rs11360 . A genome-wide genotyping study in patients with ischaemic stroke: initial analysis and data release.
14 chr1 156883546 156883546 1 + A G rs12137505 156883546 + 156883526 156883566 41 ATGGCCCAGGCCCATTCTACAATAAAGGTATGGGCACAGGG ATGGCCCAGGCCCATTCTACGATAAAGGTATGGGCACAGGG Direct Gain NA NA NA 0 0.937403976917267 Functional Gain 0.937403976917267 PEAR1 ENSG00000187800 CDS Human protein_coding chr1:156883546 chr1:156883546 nonsynonymous SNV 0.002 1 21 hm7G_associated_SNPs_2392 0 29875488 Blood protein levels 8e-19 GWAS_Catalog TagSNP rs12137505 GCST005806 Genomic atlas of the human plasma proteome.
15 chr1 171557600 171557600 1 + A G rs2421847 171557600 + 171557580 171557620 41 AGTTCCAGTCAGCCCCTGCCACTGTGAGAATGACACAACCA AGTTCCAGTCAGCCCCTGCCGCTGTGAGAATGACACAACCA Direct Gain NA NA NA 0 0.756945490837097 Functional Gain 0.756945490837097 PRRC2C ENSG00000117523 CDS Human protein_coding chr1:171557600 chr1:171557600 nonsynonymous SNV 0.998 0 21 hm7G_associated_SNPs_2527 0 23535033 Alzheimer's disease (cognitive decline) 9e-07 GWAS_Catalog TagSNP rs2421847 GCST001915 Genome-wide association study of the rate of cognitive decline in Alzheimer's disease.
16 chr1 180163390 180163390 1 + A G rs12371 180163390 + 180163370 180163410 41 AGCCATCCGAGGCTACGTGCACTACTTCTTCGGCTGCCGAG AGCCATCCGAGGCTACGTGCGCTACTTCTTCGGCTGCCGAG Direct Gain NA NA NA 0 0.616398513317108 Functional Gain 0.616398513317108 QSOX1 ENSG00000116260 CDS Human protein_coding chr1:180163390 chr1:180163390 nonsynonymous SNV 0.198 0 21 hm7G_associated_SNPs_2592 0 29875488 Blood protein levels 1e-60 GWAS_Catalog TagSNP rs12371 GCST005806 Genomic atlas of the human plasma proteome.
17 chr1 204948659 204948659 1 + A G rs6667532 204948659 + 204948639 204948679 41 AGCAGCCACCCCAGCCTCCCATCCGAGCGCTACCGAACCAG AGCAGCCACCCCAGCCTCCCGTCCGAGCGCTACCGAACCAG Direct Gain NA NA NA 0 0.728456735610962 Functional Gain 0.728456735610962 NFASC ENSG00000163531 CDS Human protein_coding chr1:204948659 chr1:204948659 synonymous SNV . 0 21 hm7G_associated_SNPs_2775 0 29875488 Blood protein levels 4e-100 GWAS_Catalog TagSNP rs6667532 GCST005806 Genomic atlas of the human plasma proteome.
18 chr1 206643772 206643772 1 + C G rs2297550 206643772 + 206643752 206643792 41 TTTAAGAGAGAAAGAGAGAGCGAGAGACGGAAATCAGGAAG TTTAAGAGAGAAAGAGAGAGGGAGAGACGGAAATCAGGAAG Direct Gain NA NA NA 0 0.556607127189636 Functional Gain 0.556607127189636 IKBKE ENSG00000143466 upstream Human other chr1:206643772 chr1:206643772 . . 0 21 hm7G_associated_SNPs_2808 0 27399966 Systemic lupus erythematosus 2e-07 GWAS_Catalog TagSNP rs2297550 GCST003622 Genome-wide association meta-analysis in Chinese and European individuals identifies ten new loci associated with systemic lupus erythematosus.
19 chr1 222923351 222923351 1 + A G rs6683071 222923351 + 222923331 222923371 41 TCACTTGGAGGCTGGGGTCCAAGAGTATGGAACCATACAAC TCACTTGGAGGCTGGGGTCCGAGAGTATGGAACCATACAAC Direct Gain NA NA NA 0 0.696631729602814 Functional Gain 0.696631729602814 FAM177B ENSG00000197520 CDS Human protein_coding chr1:222923351 chr1:222923351 nonsynonymous SNV 0.031 0 21 hm7G_associated_SNPs_2905 0 19734545 Cognitive performance 4e-06 GWAS_Catalog TagSNP rs6683071 GCST000477 A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB.
20 chr2 25042622 25042622 1 + A G rs7945 25042622 + 25042602 25042642 41 GCTGGGGACACTACAGGCACACACAGGAATAGCAGGGCCAC GCTGGGGACACTACAGGCACGCACAGGAATAGCAGGGCCAC Direct Gain NA NA NA 0 0.536207854747772 Functional Gain 0.536207854747772 ADCY3;CENPO ENSG00000138031;ENSG00000138092 UTR3 Human other chr2:25042622 chr2:25042622 . . 0 21 hm7G_associated_SNPs_3191 0 28552196 Height 3e-07 GWAS_Catalog TagSNP rs7945 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
21 chr2 28636740 28636740 1 + A G rs2279990 28636740 + 28636720 28636760 41 GAATCTTTCTGGCTGCTGGAATTGGAGATAGGATGTTTTGC GAATCTTTCTGGCTGCTGGAGTTGGAGATAGGATGTTTTGC Direct Gain NA NA NA 0 0.7137730717659 Functional Gain 0.7137730717659 FOSL2 ENSG00000075426 UTR3 Human protein_coding chr2:28636740 chr2:28636740 . . 0 21 hm7G_associated_SNPs_3244 0 26192919 Inflammatory bowel disease 3e-15 GWAS_Catalog TagSNP rs2279990 GCST003043 Association analyses identify 38 susceptibility loci for inflammatory bowel disease and highlight shared genetic risk across populations.
22 chr2 37000956 37000956 1 + C G rs140104536 37000956 + 37000936 37000976 41 CTCTGGTCCACTGCCACCTACACAAGCAGCCAAAACAGGCC CTCTGGTCCACTGCCACCTAGACAAGCAGCCAAAACAGGCC Direct Gain NA NA NA 0 0.652408540248871 Functional Gain 0.652408540248871 VIT ENSG00000205221 CDS Human protein_coding chr2:37000956 chr2:37000956 stopgain 0.029 0 21 hm7G_associated_SNPs_3289 0 29875488 Blood protein levels 1e-31 GWAS_Catalog TagSNP rs140104536 GCST005806 Genomic atlas of the human plasma proteome.
23 chr2 42981239 42981239 1 + A G rs930421 42981239 + 42981219 42981259 41 TGTTTTGTGGTTGGAGAGAAACTGGTGTTCTGCCCGGCTCT TGTTTTGTGGTTGGAGAGAAGCTGGTGTTCTGCCCGGCTCT Direct Gain NA NA NA 0 0.834779679775238 Functional Gain 0.834779679775238 MTA3 ENSG00000057935 UTR3 Human protein_coding chr2:42981239 chr2:42981239 . . 0 21 hm7G_associated_SNPs_3308 0 18821565 Attention deficit hyperactivity disorder 6e-06 GWAS_Catalog TagSNP rs930421 GCST000281 Genome-wide association scan of quantitative traits for attention deficit hyperactivity disorder identifies novel associations and confirms candidate gene associations.
24 chr2 44071743 44071743 1 + A G rs4148211 44071743 + 44071723 44071763 41 GGAGGTCAGAGACCTCAACTACCAGGTAGAGGCACGCCTGG GGAGGTCAGAGACCTCAACTGCCAGGTAGAGGCACGCCTGG Direct Gain NA NA NA 0 0.697808623313904 Functional Gain 0.697808623313904 ABCG8 ENSG00000143921 CDS Human protein_coding chr2:44071743 chr2:44071743 nonsynonymous SNV 0.991 2 21 hm7G_associated_SNPs_3317 2 17632509 Gallstone disease 0.04 Johnson and O'Donnell TagSNP rs4148211 . A genome-wide association scan identifies the hepatic cholesterol transporter ABCG8 as a susceptibility factor for human gallstone disease.
25 chr2 73161551 73161551 1 + A G rs2077586 73161551 + 73161531 73161571 41 GGGCCAGTGGGGGCTGGTAGAGCAAACGCGTTCAGGGCCTG GGGCCAGTGGGGGCTGGTAGGGCAAACGCGTTCAGGGCCTG Direct Gain NA NA NA 0 0.584100782871246 Functional Gain 0.584100782871246 EMX1 ENSG00000135638 UTR3 Human protein_coding chr2:73161551 chr2:73161551 . . 0 21 hm7G_associated_SNPs_3456 0 26198764 Schizophrenia 2e-07 GWAS_Catalog TagSNP rs2077586 GCST003048 Genome-wide association study of schizophrenia in Ashkenazi Jews.
26 chr2 97351840 97351840 1 + A G rs7599598 97351840 + 97351820 97351860 41 ACTGGCTGTACCGCCTCAACACCGTGCTCCCTGAGGTGGGT ACTGGCTGTACCGCCTCAACGCCGTGCTCCCTGAGGTGGGT Direct Gain NA NA NA 0 0.628982305526733 Functional Gain 0.628982305526733 FER1L5 ENSG00000249715 ncRNA_exonic Human protein_coding chr2:97351840 chr2:97351840 . 0.267 0 21 hm7G_associated_SNPs_3601 0 29912962 Diastolic blood pressure x alcohol consumption interaction (2df test) 1e-11 GWAS_Catalog TagSNP rs7599598 GCST006166 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
27 chr2 175529967 175529967 1 + C G rs72914576 175529967 + 175529947 175529987 41 GGTTTTTTGCTCCTGTTTTACTACGAAGCAAACACCTCGAC GGTTTTTTGCTCCTGTTTTAGTACGAAGCAAACACCTCGAC Direct Gain NA NA NA 0 0.586175203323364 Functional Gain 0.586175203323364 WIPF1 ENSG00000236449 ncRNA_exonic Human antisense chr2:175529967 chr2:175529967 . . 0 21 hm7G_associated_SNPs_3922 0 30595370 Systolic blood pressure 2e-11 GWAS_Catalog TagSNP rs72914576 GCST007087 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
28 chr2 201171191 201171191 1 + C G rs10931898 201171191 + 201171171 201171211 41 AAAGTGGGGTGGGAAAGGAGCTAGGGAGGGCGTGTGGAGGG AAAGTGGGGTGGGAAAGGAGGTAGGGAGGGCGTGTGGAGGG Direct Gain NA NA NA 0 0.780759572982788 Functional Gain 0.780759572982788 SPATS2L ENSG00000196141 UTR5 Human protein_coding chr2:201171191 chr2:201171191 . . 0 21 hm7G_associated_SNPs_3992 0 27046643 Reaction time 3e-08 GWAS_Catalog TagSNP rs10931898 GCST003499 Genome-wide association study of cognitive functions and educational attainment in UK Biobank (N=112 151).
29 chr3 14530721 14530721 1 + A G rs9036 14530721 + 14530701 14530741 41 TTTATGATATGATTCCCTGTATTTTGCAGGGGTTTTTTTCT TTTATGATATGATTCCCTGTGTTTTGCAGGGGTTTTTTTCT Direct Gain NA NA NA 0 0.734984517097473 Functional Gain 0.734984517097473 GRIP2;SLC6A6 ENSG00000144596 ncRNA_exonic Human protein_coding chr3:14530721 chr3:14530721 . . 0 21 hm7G_associated_SNPs_4452 0 19734545 Cognitive performance 3e-06 GWAS_Catalog TagSNP rs9036 GCST000477 A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB.
30 chr3 48282695 48282695 1 + A G rs9847953 48282695 + 48282675 48282715 41 GGGAGCAGCTACTGGGCTGGACTGCGGAAGGTGAGTCGGGG GGGAGCAGCTACTGGGCTGGGCTGCGGAAGGTGAGTCGGGG Direct Gain NA NA NA 0 0.864627838134766 Functional Gain 0.864627838134766 ZNF589 ENSG00000164048 CDS Human protein_coding chr3:48282695 chr3:48282695 nonsynonymous SNV 0.000 0 21 hm7G_associated_SNPs_4636 0 27618447 Systolic blood pressure 6e-08 GWAS_Catalog TagSNP rs9847953 GCST006021 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
31 chr3 49213637 49213637 1 + C G rs9586 49213637 + 49213617 49213657 41 GGCTGCCTTTAGGGTCCCTGCAGACCCAGGAGAGTTGAGAG GGCTGCCTTTAGGGTCCCTGGAGACCCAGGAGAGTTGAGAG Direct Gain NA NA NA 0 0.551926910877228 Functional Gain 0.551926910877228 KLHDC8B ENSG00000185909 UTR3 Human protein_coding chr3:49213637 chr3:49213637 . . 0 21 hm7G_associated_SNPs_4648 0 29500382 Feeling miserable 2e-08 GWAS_Catalog TagSNP rs9586 GCST006943 Item-level analyses reveal genetic heterogeneity in neuroticism.
32 chr3 49572140 49572140 1 + A G rs4625 49572140 + 49572120 49572160 41 TCCATCTGCATCTCTGTCCCATGACTCAGGGGCGCCCACTC TCCATCTGCATCTCTGTCCCGTGACTCAGGGGCGCCCACTC Direct Gain NA NA NA 0 0.86650562286377 Functional Gain 0.86650562286377 DAG1 ENSG00000173402 UTR3 Human protein_coding chr3:49572140 chr3:49572140 . . 0 21 hm7G_associated_SNPs_4652 1 29500382 Feeling fed-up 1e-10 GWAS_Catalog TagSNP rs4625 GCST006947 Item-level analyses reveal genetic heterogeneity in neuroticism.
33 chr3 51864849 51864849 1 + A G rs9866552 51864849 + 51864829 51864869 41 CATGGAGAACAGGCTGCACTACCCTAATAAATGTCTGACCA CATGGAGAACAGGCTGCACTGCCCTAATAAATGTCTGACCA Direct Gain NA NA NA 0 0.828334867954254 Functional Gain 0.828334867954254 IQCF3 ENSG00000229972 UTR3 Human protein_coding chr3:51864849 chr3:51864849 . . 0 21 hm7G_associated_SNPs_4682 0 17554300 Multiple complex diseases 7.92917e-05 Johnson and O'Donnell TagSNP rs9866552 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
34 chr3 113673125 113673125 1 + A G rs11921691 113673125 + 113673105 113673145 41 TGACCCCAAGGGCTCTTCCAAGATGCCAGCTGGAAGCCCCA TGACCCCAAGGGCTCTTCCAGGATGCCAGCTGGAAGCCCCA Direct Gain NA NA NA 0 0.842350125312805 Functional Gain 0.842350125312805 ZDHHC23 ENSG00000184307 CDS Human protein_coding chr3:113673125 chr3:113673125 nonsynonymous SNV 0.003 0 21 hm7G_associated_SNPs_4860 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0002378 Johnson and O'Donnell TagSNP rs11921691 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
35 chr3 119425349 119425349 1 + A G rs7644545 119425349 + 119425329 119425369 41 GCTCAAAAGGAGTTTTGTTCATAGGAGAGAAGAAAGTGTGT GCTCAAAAGGAGTTTTGTTCGTAGGAGAGAAGAAAGTGTGT Direct Gain NA NA NA 0 0.813086867332458 Functional Gain 0.813086867332458 MAATS1 ENSG00000183833 intronic Human protein_coding chr3:119425349 chr3:119425349 . . 0 21 hm7G_associated_SNPs_4884 0 18193043 Lipid level measurements 0.00079 Johnson and O'Donnell TagSNP rs7644545 . Newly identified loci that influence lipid concentrations and risk of coronary artery disease.
36 chr3 127872602 127872602 1 + A G rs11719546 127872602 + 127872582 127872622 41 GAGCCCGAGCCCGGCGAGCCACTGCTTCAGGTCACGCTGGT GAGCCCGAGCCCGGCGAGCCGCTGCTTCAGGTCACGCTGGT Direct Gain NA NA NA 0 0.640943646430969 Functional Gain 0.640943646430969 EEFSEC ENSG00000132394 CDS Human protein_coding chr3:127872602 chr3:127872602 synonymous SNV . 0 21 hm7G_associated_SNPs_4940 0 26634245 Post bronchodilator FEV1 3e-06 GWAS_Catalog TagSNP rs11719546 GCST003262 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
37 chr3 142652059 142652059 1 + A G rs9811066 142652059 + 142652039 142652079 41 TGCAAAAGGAGCAATTCAGCACTTGTCATGCAGATAAGAGG TGCAAAAGGAGCAATTCAGCGCTTGTCATGCAGATAAGAGG Direct Gain NA NA NA 0 0.738195180892944 Functional Gain 0.738195180892944 LOC100507389 ENSG00000243818 ncRNA_exonic Human antisense chr3:142652059 chr3:142652059 . . 0 21 hm7G_associated_SNPs_5055 0 29875488 Blood protein levels 3e-13 GWAS_Catalog TagSNP rs9811066 GCST005806 Genomic atlas of the human plasma proteome.
38 chr4 2903285 2903285 1 + A G rs17777307 2903285 + 2903265 2903305 41 AAATAAACTAGACAGCAATCACTAATCATAGTCCATGTTTT AAATAAACTAGACAGCAATCGCTAATCATAGTCCATGTTTT Direct Gain NA NA NA 0 0.529302954673767 Functional Gain 0.529302954673767 ADD1 ENSG00000087274 intronic Human protein_coding chr4:2903285 chr4:2903285 . . 0 21 hm7G_associated_SNPs_5379 0 17554300 Multiple complex diseases 0.00019709 Johnson and O'Donnell TagSNP rs17777307 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
39 chr4 24801834 24801834 1 + C G rs1799895 24801834 + 24801814 24801854 41 AGCACTCAGAGCGCAAGAAGCGGCGGCGCGAGAGCGAGTGC AGCACTCAGAGCGCAAGAAGGGGCGGCGCGAGAGCGAGTGC Direct Gain NA NA NA 0 0.60100907087326 Functional Gain 0.60100907087326 SOD3 ENSG00000109610 CDS Human protein_coding chr4:24801834 chr4:24801834 nonsynonymous SNV 0.997 1 21 hm7G_associated_SNPs_5528 1 29875488 Blood protein levels 4e-140 GWAS_Catalog TagSNP rs1799895 GCST005806 Genomic atlas of the human plasma proteome.
40 chr4 71201648 71201648 1 + T G rs2291182 71201648 + 71201628 71201668 41 CTACCGAGGGAGCCAGTATTTGGATGGAGAGAGATACTGCA CTACCGAGGGAGCCAGTATTGGGATGGAGAGAGATACTGCA Direct Gain NA NA NA 0 0.505428731441498 Functional Gain 0.505428731441498 CABS1 ENSG00000145309 CDS Human protein_coding chr4:71201648 chr4:71201648 nonsynonymous SNV 0.055 3 21 hm7G_associated_SNPs_5637 0 17486107 Bipolar disorder 0.011 Johnson and O'Donnell TagSNP rs2291182 . A genome-wide association study implicates diacylglycerol kinase eta (DGKH) and several other genes in the etiology of bipolar disorder.
41 chr4 153701130 153701130 1 + C G rs4619875 153701130 + 153701110 153701150 41 TCACTTCCGGCTTCGCTGCTCTTGGTTCTGGTTCTGGAGGC TCACTTCCGGCTTCGCTGCTGTTGGTTCTGGTTCTGGAGGC Direct Gain NA NA NA 0 0.76731264591217 Functional Gain 0.76731264591217 ARFIP1 ENSG00000164144 UTR5 Human protein_coding chr4:153701130 chr4:153701130 . . 0 21 hm7G_associated_SNPs_5930 0 29875488 Blood protein levels 7e-22 GWAS_Catalog TagSNP rs4619875 GCST005806 Genomic atlas of the human plasma proteome.
42 chr5 35670741 35670741 1 + A G rs6891905 35670741 + 35670721 35670761 41 GGCAAAATGAAAGAGGAGGAAGTCTGGGTTTTATGAATAGC GGCAAAATGAAAGAGGAGGAGGTCTGGGTTTTATGAATAGC Direct Gain NA NA NA 0 0.661726415157318 Functional Gain 0.661726415157318 SPEF2 ENSG00000152582 UTR3 Human protein_coding chr5:35670741 chr5:35670741 . . 0 21 hm7G_associated_SNPs_6160 0 30014611 Age at loss of ambulation in Duchenne muscular dystrophy 4e-06 GWAS_Catalog TagSNP rs6891905 GCST006286 Long-range genomic regulators of THBS1 and LTBP4 modify disease severity in Duchenne muscular dystrophy.
43 chr5 35877914 35877914 1 + A G rs10491434 35877914 + 35877894 35877934 41 AGACTGACTTCTAATGACTAACTCAAAGTCAAGGCAACTGA AGACTGACTTCTAATGACTAGCTCAAAGTCAAGGCAACTGA Direct Gain NA NA NA 0 0.936591267585754 Functional Gain 0.936591267585754 IL7R ENSG00000168685 UTR3 Human protein_coding chr5:35877914 chr5:35877914 . . 0 21 hm7G_associated_SNPs_6165 1 17554300 Multiple complex diseases 0.000736236 Johnson and O'Donnell TagSNP rs10491434 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
44 chr5 56178111 56178111 1 + A G rs3822625 56178111 + 56178091 56178131 41 CAGCGCAAGTTTTCTCTACAATTCCACAGAAACTGTCCTGA CAGCGCAAGTTTTCTCTACAGTTCCACAGAAACTGTCCTGA Direct Gain NA NA NA 0 0.606220901012421 Functional Gain 0.606220901012421 MAP3K1 ENSG00000095015 CDS Human protein_coding chr5:56178111 chr5:56178111 synonymous SNV . 0 21 hm7G_associated_SNPs_6206 0 24493630 Breast cancer (early onset) 5e-12 GWAS_Catalog TagSNP rs3822625 GCST002346 A genome-wide association study of early-onset breast cancer identifies PFKM as a novel breast cancer gene and supports a common genetic spectrum for breast cancer at any age.
45 chr5 81268070 81268070 1 + C G rs111549985 81268070 + 81268050 81268090 41 CAGCTCTCCTCCCCCTGGCCCCGTCGCCCCGCCCTCGCCGG CAGCTCTCCTCCCCCTGGCCGCGTCGCCCCGCCCTCGCCGG Direct Gain NA NA NA 0 0.759581089019775 Functional Gain 0.759581089019775 ATG10 ENSG00000152348 UTR5 Human protein_coding chr5:81268070 chr5:81268070 . . 0 21 hm7G_associated_SNPs_6327 0 29059683 Breast cancer 6e-12 GWAS_Catalog TagSNP rs111549985 GCST004988 Association analysis identifies 65 new breast cancer risk loci.
46 chr5 140023238 140023238 1 + C G rs17208187 140023238 + 140023218 140023258 41 GGCTGGGGCTGTCCAGAAAACCGAGGATGCAGGACTGGAGC GGCTGGGGCTGTCCAGAAAAGCGAGGATGCAGGACTGGAGC Direct Gain NA NA NA 0 0.775081932544708 Functional Gain 0.775081932544708 TMCO6 ENSG00000113119 CDS Human protein_coding chr5:140023238 chr5:140023238 nonsynonymous SNV 0.188 0 21 hm7G_associated_SNPs_6535 0 30072576 Blood protein levels 4e-12 GWAS_Catalog TagSNP rs17208187 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
47 chr5 150036119 150036119 1 + A G rs41364946 150036119 + 150036099 150036139 41 CGCTGCCGCCGCCACCGCCCATGTCTCCCTCGTGGAGCGAG CGCTGCCGCCGCCACCGCCCGTGTCTCCCTCGTGGAGCGAG Direct Gain NA NA NA 0 0.558581471443176 Functional Gain 0.558581471443176 SYNPO ENSG00000171992 CDS Human protein_coding chr5:150036119 chr5:150036119 nonsynonymous SNV 0.892 1 21 hm7G_associated_SNPs_6751 0 30595370 Red blood cell count 2e-09 GWAS_Catalog TagSNP rs41364946 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
48 chr5 158759900 158759900 1 + A G rs2546890 158759900 + 158759880 158759920 41 GGGCTCTGAATTGTCTTCCCACAGTGAAATCACTTGTCTAT GGGCTCTGAATTGTCTTCCCGCAGTGAAATCACTTGTCTAT Direct Gain NA NA NA 0 0.667606115341187 Functional Gain 0.667606115341187 LOC285626 ENSG00000249738 ncRNA_exonic Human antisense chr5:158759900 chr5:158759900 . . 0 21 hm7G_associated_SNPs_6800 0 22190364 Multiple sclerosis 8e-08 GWAS_Catalog TagSNP rs2546890 GCST001341 Genome-wide meta-analysis identifies novel multiple sclerosis susceptibility loci.
49 chr6 411064 411064 1 + A G rs872071 411064 + 411044 411084 41 ATGTAGCTGAAGTAGAGGGGACGTGAGAGAAGGGCCAGGCC ATGTAGCTGAAGTAGAGGGGGCGTGAGAGAAGGGCCAGGCC Direct Gain NA NA NA 0 0.946267604827881 Functional Gain 0.946267604827881 IRF4 ENSG00000137265 UTR3 Human protein_coding chr6:411064 chr6:411064 . . 0 21 hm7G_associated_SNPs_6977 0 24292274 Chronic lymphocytic leukemia 3e-16 GWAS_Catalog TagSNP rs872071 GCST002299 A genome-wide association study identifies multiple susceptibility loci for chronic lymphocytic leukemia.
50 chr6 12295876 12295876 1 + A G rs1629862 12295876 + 12295856 12295896 41 GAGTTCCTCAAGGCAGGGTCACATAGTGATGAAGGTTGGGA GAGTTCCTCAAGGCAGGGTCGCATAGTGATGAAGGTTGGGA Direct Gain NA NA NA 0 0.764952182769775 Functional Gain 0.764952182769775 EDN1 ENSG00000078401 intronic Human protein_coding chr6:12295876 chr6:12295876 . . 0 21 hm7G_associated_SNPs_7062 0 29212778 Coronary artery disease 2e-07 GWAS_Catalog TagSNP rs1629862 GCST005194 Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease.
51 chr6 26199903 26199903 1 + C G rs34961555 26199903 + 26199883 26199923 41 AGCCGCAAGGAGAGCTATTCCGTGTACGTGTACAAGGTGCT AGCCGCAAGGAGAGCTATTCGGTGTACGTGTACAAGGTGCT Direct Gain NA NA NA 0 0.720957338809967 Functional Gain 0.720957338809967 HIST1H2BF ENSG00000197846 CDS Human other chr6:26199903 chr6:26199903 synonymous SNV . 0 21 hm7G_associated_SNPs_7117 0 29326435 Intelligence (MTAG) 4e-10 GWAS_Catalog TagSNP rs34961555 GCST005316 A combined analysis of genetically correlated traits identifies 187 loci and a role for neurogenesis and myelination in intelligence.
52 chr6 26376868 26376868 1 + A G rs9393716 26376868 + 26376848 26376888 41 TCTGAGGACCAGAGGAGTGTACAGCGTGCTGAGGAGCCCCA TCTGAGGACCAGAGGAGTGTGCAGCGTGCTGAGGAGCCCCA Direct Gain NA NA NA 0 0.925423502922058 Functional Gain 0.925423502922058 BTN3A2 ENSG00000186470 UTR3 Human protein_coding chr6:26376868 chr6:26376868 . . 0 21 hm7G_associated_SNPs_7126 0 30643256 Neuroticism 2e-10 GWAS_Catalog TagSNP rs9393716 GCST007339 Multivariate genome-wide analyses of the well-being spectrum.
53 chr6 29080349 29080349 1 + A G rs3130764 29080349 + 29080329 29080369 41 ATGGTGCCATCGTCCGAGCTATACTGAGGATGCAGTCAACC ATGGTGCCATCGTCCGAGCTGTACTGAGGATGCAGTCAACC Direct Gain NA NA NA 0 0.946245908737183 Functional Gain 0.946245908737183 OR2J3 ENSG00000204701 CDS Human protein_coding chr6:29080349 chr6:29080349 nonsynonymous SNV 0.009 0 21 hm7G_associated_SNPs_7186 0 17827064 Amyotrophic Lateral Sclerosis (ALS) 0.0009075 Johnson and O'Donnell TagSNP rs3130764 . ITPR2 as a susceptibility gene in sporadic amyotrophic lateral sclerosis: a genome-wide association study.
54 chr6 30232250 30232250 1 + A G rs3130404 30232250 + 30232230 30232270 41 ATCATGTGGGCATAGGGCTCAAGTATGTGGGAAGGATTTTG ATCATGTGGGCATAGGGCTCGAGTATGTGGGAAGGATTTTG Direct Gain NA NA NA 0 0.840542852878571 Functional Gain 0.840542852878571 HLA-L ENSG00000243753 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr6:30232250 chr6:30232250 . . 0 21 hm7G_associated_SNPs_7260 0 17554300 Multiple complex diseases 1.27e-10 Johnson and O'Donnell TagSNP rs3130404 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
55 chr6 31473957 31473957 1 + C G rs3134900 31473957 + 31473937 31473977 41 GAGATTAGGGTCTGTGAGATCCATGAAGACAGCAGCACCAG GAGATTAGGGTCTGTGAGATGCATGAAGACAGCAGCACCAG Direct Gain NA NA NA 0 0.650415062904358 Functional Gain 0.650415062904358 MICB ENSG00000204516 CDS Human protein_coding chr6:31473957 chr6:31473957 nonsynonymous SNV 0.016 2 21 hm7G_associated_SNPs_7318 0 29875488 Blood protein levels 3e-101 GWAS_Catalog TagSNP rs3134900 GCST005806 Genomic atlas of the human plasma proteome.
56 chr6 31605448 31605448 1 + C G rs7889 31605448 + 31605428 31605468 41 GGGGTGGGCGGGGAGGGGTTCTGGGGCTGGGGCCTCACTTC GGGGTGGGCGGGGAGGGGTTGTGGGGCTGGGGCCTCACTTC Direct Gain NA NA NA 0 0.760952651500702 Functional Gain 0.760952651500702 PRRC2A ENSG00000204469 UTR3 Human protein_coding chr6:31605448 chr6:31605448 . . 0 21 hm7G_associated_SNPs_7331 0 30578418 Systolic blood pressure 4e-14 GWAS_Catalog TagSNP rs7889 GCST007267 Trans-ethnic association study of blood pressure determinants in over 750,000 individuals.
57 chr6 31729359 31729359 1 + A G rs707938 31729359 + 31729339 31729379 41 CTGAGCCTTGTTCAGCTACAACTGCTGCCACAAGGGCCCCT CTGAGCCTTGTTCAGCTACAGCTGCTGCCACAAGGGCCCCT Direct Gain NA NA NA 0 0.654591143131256 Functional Gain 0.654591143131256 MSH5 ENSG00000204410;ENSG00000255152 CDS Human other chr6:31729359 chr6:31729359 synonymous SNV . 0 21 hm7G_associated_SNPs_7338 1 30038396 Cognitive performance 4e-09 GWAS_Catalog TagSNP rs707938 GCST006572 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
58 chr6 31940897 31940897 1 + A G rs389884 31940897 + 31940877 31940917 41 ATAGAGAGAGGGAATGGTGTATTGGAGATAGTGGATGAGGC ATAGAGAGAGGGAATGGTGTGTTGGAGATAGTGGATGAGGC Direct Gain NA NA NA 0 0.876997590065002 Functional Gain 0.876997590065002 STK19 ENSG00000204344 intronic Human protein_coding chr6:31940897 chr6:31940897 . . 0 21 hm7G_associated_SNPs_7344 0 23263863 Hematology traits 2e-08 GWAS_Catalog TagSNP rs389884 GCST001779 GWAS of blood cell traits identifies novel associated loci and epistatic interactions in Caucasian and African-American children.
59 chr6 34824636 34824636 1 + A G rs11755393 34824636 + 34824616 34824656 41 GGGCAGACAGCCTGCCTTTCAGCCTCCAGCATGGAACCGCT GGGCAGACAGCCTGCCTTTCGGCCTCCAGCATGGAACCGCT Direct Gain NA NA NA 0 0.724686443805695 Functional Gain 0.724686443805695 UHRF1BP1 ENSG00000065060 CDS Human protein_coding chr6:34824636 chr6:34824636 nonsynonymous SNV 0.697 0 21 hm7G_associated_SNPs_7438 0 19838195 Systemic lupus erythematosus 2e-08 GWAS_Catalog TagSNP rs11755393 GCST004867 A large-scale replication study identifies TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10 as risk loci for systemic lupus erythematosus.
60 chr6 35056443 35056443 1 + A G rs2005 35056443 + 35056423 35056463 41 ACGTGGGGGCATAGGCTCCCACTGCCACCACCGCCATCGCC ACGTGGGGGCATAGGCTCCCGCTGCCACCACCGCCATCGCC Direct Gain NA NA NA 0 0.725315570831299 Functional Gain 0.725315570831299 ANKS1A ENSG00000064999 UTR3 Human protein_coding chr6:35056443 chr6:35056443 . . 0 21 hm7G_associated_SNPs_7443 0 23251661 Obesity-related traits 7e-06 GWAS_Catalog TagSNP rs2005 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
61 chr6 35263555 35263555 1 + A G rs1194 35263555 + 35263535 35263575 41 TCCTCAGGGGCCTGTGGCTGAAGAAAAGGTGCCCAGCCCCC TCCTCAGGGGCCTGTGGCTGGAGAAAAGGTGCCCAGCCCCC Direct Gain NA NA NA 0 0.824357628822327 Functional Gain 0.824357628822327 ZNF76 ENSG00000065029 UTR3 Human protein_coding chr6:35263555 chr6:35263555 . . 0 21 hm7G_associated_SNPs_7450 0 28714469 Systemic lupus erythematosus 5e-07 GWAS_Catalog TagSNP rs1194 GCST005752 Transancestral mapping and genetic load in systemic lupus erythematosus.
62 chr6 90315789 90315789 1 + A G rs3748085 90315789 + 90315769 90315809 41 GCCAGTCAGCCAAGCTGCTCATTAAAGCAGGAGCCAACGTG GCCAGTCAGCCAAGCTGCTCGTTAAAGCAGGAGCCAACGTG Direct Gain NA NA NA 0 0.934000015258789 Functional Gain 0.934000015258789 ANKRD6 ENSG00000135299 CDS Human protein_coding chr6:90315789 chr6:90315789 nonsynonymous SNV 0.991 0 21 hm7G_associated_SNPs_7748 0 17463246 Multiple continuous traits in DGI samples 0.0008674 Johnson and O'Donnell TagSNP rs3748085 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
63 chr6 142688969 142688969 1 + A G rs17280293 142688969 + 142688949 142688989 41 AAGGCCTATCATTTAACTCAAGTGCGAATGAGATGCATGTG AAGGCCTATCATTTAACTCAGGTGCGAATGAGATGCATGTG Direct Gain NA NA NA 0 0.643437027931213 Functional Gain 0.643437027931213 ADGRG6 ENSG00000112414 CDS Human protein_coding chr6:142688969 chr6:142688969 nonsynonymous SNV 0.941 0 21 hm7G_associated_SNPs_7907 0 30049742 Diffusing capacity of the lung for carbon monoxide traits 1e-10 GWAS_Catalog TagSNP rs17280293 GCST006473 Heritability and genome-wide association study of diffusing capacity of the lung.
64 chr6 150720571 150720571 1 + T G rs601223 150720571 + 150720551 150720591 41 TGGGACTGATAGGGTCACAGTTGCCAGGTTGGGAATGCTAG TGGGACTGATAGGGTCACAGGTGCCAGGTTGGGAATGCTAG Direct Gain NA NA NA 0 0.902925491333008 Functional Gain 0.902925491333008 IYD ENSG00000009765 UTR3 Human protein_coding chr6:150720571 chr6:150720571 . . 0 21 hm7G_associated_SNPs_7954 1 17554300 Multiple complex diseases 0.000231826 Johnson and O'Donnell TagSNP rs601223 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
65 chr6 151859314 151859314 1 + A G rs4870034 151859314 + 151859294 151859334 41 TTGAGAGACAGAGTTCAGGAACTAGAAGAAGAATCAGCAGC TTGAGAGACAGAGTTCAGGAGCTAGAAGAAGAATCAGCAGC Direct Gain NA NA NA 0 0.588806390762329 Functional Gain 0.588806390762329 CCDC170 ENSG00000120262 CDS Human protein_coding chr6:151859314 chr6:151859314 synonymous SNV . 0 21 hm7G_associated_SNPs_7964 0 30643258 Number of sexual partners 1e-10 GWAS_Catalog TagSNP rs4870034 GCST007326 Genome-wide association analyses of risk tolerance and risky behaviors in over 1 million individuals identify hundreds of loci and shared genetic influences.
66 chr6 151942194 151942194 1 + T G rs3757322 151942194 + 151942174 151942214 41 GAATATGATCTTTAGGGACTTCTAATGAAAAGGGTATATGA GAATATGATCTTTAGGGACTGCTAATGAAAAGGGTATATGA Direct Gain NA NA NA 0 0.932384252548218 Functional Gain 0.932384252548218 CCDC170 ENSG00000120262 UTR3 Human protein_coding chr6:151942194 chr6:151942194 . . 0 21 hm7G_associated_SNPs_7965 0 29058716 Breast Cancer in BRCA1 mutation carriers 3e-12 GWAS_Catalog TagSNP rs3757322 GCST005075 Identification of ten variants associated with risk of estrogen-receptor-negative breast cancer.
67 chr6 161127501 161127501 1 + A G rs73015965 161127501 + 161127481 161127521 41 CTTCACTGTTCAGTGTCACTAAGAAGCAGCTGGGAGCAGGA CTTCACTGTTCAGTGTCACTGAGAAGCAGCTGGGAGCAGGA Direct Gain NA NA NA 0 0.625616908073425 Functional Gain 0.625616908073425 PLG ENSG00000122194 CDS Human protein_coding chr6:161127501 chr6:161127501 nonsynonymous SNV 0.424 2 21 hm7G_associated_SNPs_8026 1 27182965 Childhood ear infection 4e-08 GWAS_Catalog TagSNP rs73015965 GCST003991 Detection and interpretation of shared genetic influences on 42 human traits.
68 chr7 2652222 2652222 1 + C G rs60525454 2652222 + 2652202 2652242 41 GGGGTGAGCTGTGGGCGGGGCGAGCTGTGGGTGGGGCCTAG GGGGTGAGCTGTGGGCGGGGGGAGCTGTGGGTGGGGCCTAG Direct Gain NA NA NA 0 0.871688961982727 Functional Gain 0.871688961982727 IQCE ENSG00000106012 UTR3 Human protein_coding chr7:2652222 chr7:2652222 . . 0 21 hm7G_associated_SNPs_8126 0 27015805 Parental extreme longevity (95 years and older) 9e-06 GWAS_Catalog TagSNP rs60525454 GCST003395 Human longevity is influenced by many genetic variants: evidence from 75,000 UK Biobank participants.
69 chr7 18767343 18767343 1 + A G rs1178127 18767343 + 18767323 18767363 41 GCCTCTGTTTTACCTCACCCAGCAATGGACCGCCCCCTCCA GCCTCTGTTTTACCTCACCCGGCAATGGACCGCCCCCTCCA Direct Gain NA NA NA 0 0.793532967567444 Functional Gain 0.793532967567444 HDAC9 ENSG00000048052 CDS Human protein_coding chr7:18767343 chr7:18767343 synonymous SNV . 0 21 hm7G_associated_SNPs_8248 1 28441456 Facial morphology (factor 12, vertical position of sublabial sulcus relative to central midface) 1e-06 GWAS_Catalog TagSNP rs1178127 GCST004316 Genome-wide association study of facial morphology reveals novel associations with FREM1 and PARK2.
70 chr7 29552463 29552463 1 + C G rs1420145 29552463 + 29552443 29552483 41 CCAAGCAAGTGCTAGAATTTCCTGGACTGCAGAGGATCGCT CCAAGCAAGTGCTAGAATTTGCTGGACTGCAGAGGATCGCT Direct Gain NA NA NA 0 0.78546130657196 Functional Gain 0.78546130657196 CHN2 ENSG00000106069 UTR3 Human protein_coding chr7:29552463 chr7:29552463 . . 0 21 hm7G_associated_SNPs_8317 0 17554300 Multiple complex diseases 0.000549394 Johnson and O'Donnell TagSNP rs1420145 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
71 chr7 44808091 44808091 1 + T G rs1050331 44808091 + 44808071 44808111 41 CTGCGCTCCCAAGTTCCCCTTCTCTGTGAAAGTGAAGAATT CTGCGCTCCCAAGTTCCCCTGCTCTGTGAAAGTGAAGAATT Direct Gain NA NA NA 0 0.886723875999451 Functional Gain 0.886723875999451 ZMIZ2 ENSG00000122515 UTR3 Human protein_coding chr7:44808091 chr7:44808091 . . 0 21 hm7G_associated_SNPs_8447 0 29942086 Intelligence 2e-09 GWAS_Catalog TagSNP rs1050331 GCST006250 Genome-wide association meta-analysis in 269,867 individuals identifies new genetic and functional links to intelligence.
72 chr7 50470604 50470604 1 + T G rs4132601 50470604 + 50470584 50470624 41 TCACAGAGAAAGATGCGCCTTATCCAAGTTAATATCTCTAA TCACAGAGAAAGATGCGCCTGATCCAAGTTAATATCTCTAA Direct Gain NA NA NA 0 0.816245377063751 Functional Gain 0.816245377063751 IKZF1 ENSG00000185811 UTR3 Human protein_coding chr7:50470604 chr7:50470604 . . 0 21 hm7G_associated_SNPs_8481 0 19684604 Acute lymphoblastic leukemia (childhood) 1e-19 GWAS_Catalog TagSNP rs4132601 GCST000463 Loci on 7p12.2, 10q21.2 and 14q11.2 are associated with risk of childhood acute lymphoblastic leukemia.
73 chr7 100458093 100458093 1 + C G rs7801190 100458093 + 100458073 100458113 41 CACTGGCACTTTTTGGGGTACACGGGCATTGTGCAGGGTTC CACTGGCACTTTTTGGGGTAGACGGGCATTGTGCAGGGTTC Direct Gain NA NA NA 0 0.541686415672302 Functional Gain 0.541686415672302 SLC12A9 ENSG00000146828 intronic Human protein_coding chr7:100458093 chr7:100458093 . . 0 21 hm7G_associated_SNPs_8746 0 21347282 Hypertension 3e-08 GWAS_Catalog TagSNP rs7801190 GCST000973 Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project.
74 chr7 120979089 120979089 1 + C G rs2707466 120979089 + 120979069 120979109 41 TATCCAGATATCAGACAAAACAAAGAGGAAAATGCGCAGGA TATCCAGATATCAGACAAAAGAAAGAGGAAAATGCGCAGGA Direct Gain NA NA NA 0 0.801231622695923 Functional Gain 0.801231622695923 WNT16 ENSG00000002745 CDS Human protein_coding chr7:120979089 chr7:120979089 nonsynonymous SNV 0.901 0 21 hm7G_associated_SNPs_8880 0 22792071 Cortical thickness 2e-10 GWAS_Catalog TagSNP rs2707466 GCST001593 WNT16 influences bone mineral density, cortical bone thickness, bone strength, and osteoporotic fracture risk.
75 chr7 138874416 138874416 1 + C G rs13233916 138874416 + 138874396 138874436 41 ATTTTGGACTTATCTGGTGCCTTTCTTCCAAAAATGCTCAG ATTTTGGACTTATCTGGTGCGTTTCTTCCAAAAATGCTCAG Direct Gain NA NA NA 0 0.706204533576965 Functional Gain 0.706204533576965 TTC26 ENSG00000105948 UTR3 Human protein_coding chr7:138874416 chr7:138874416 . . 0 21 hm7G_associated_SNPs_8990 0 30595370 Menarche (age at onset) 2e-10 GWAS_Catalog TagSNP rs13233916 GCST007078 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
76 chr7 142481867 142481867 1 + C G rs59320698 142481867 + 142481847 142481887 41 CCTTTAAAGATTACCAGCAACATGTTCTGTGTGGGCTTCCT CCTTTAAAGATTACCAGCAAGATGTTCTGTGTGGGCTTCCT Direct Gain NA NA NA 0 0.746968269348145 Functional Gain 0.746968269348145 PRSS3P2 ENSG00000250606 ncRNA_exonic Human other chr7:142481867 chr7:142481867 . . 0 21 hm7G_associated_SNPs_9029 0 28754779 Alcoholic chronic pancreatitis 2e-06 GWAS_Catalog TagSNP rs59320698 GCST004860 Genome-wide association study identifies inversion in the CTRB1-CTRB2 locus to modify risk for alcoholic and non-alcoholic chronic pancreatitis.
77 chr8 1873540 1873540 1 + C G rs2272613 1873540 + 1873520 1873560 41 CTCCTCGTCGGACACATGCCCGTGATGGTGGCCAAGCAGCA CTCCTCGTCGGACACATGCCGGTGATGGTGGCCAAGCAGCA Direct Gain NA NA NA 0 0.72746217250824 Functional Gain 0.72746217250824 ARHGEF10 ENSG00000104728 CDS Human protein_coding chr8:1873540 chr8:1873540 synonymous SNV . 0 21 hm7G_associated_SNPs_9231 0 29228715 Colorectal cancer 2e-06 GWAS_Catalog TagSNP rs2272613 GCST005150 Bayesian and frequentist analysis of an Austrian genome-wide association study of colorectal cancer and advanced adenomas.
78 chr8 9183596 9183596 1 + A G rs4841132 9183596 + 9183576 9183616 41 CTAGTCTACTCCAGGGCAGCATCCAGCTGGTGACCTGAGAG CTAGTCTACTCCAGGGCAGCGTCCAGCTGGTGACCTGAGAG Direct Gain NA NA NA 0 0.887323796749115 Functional Gain 0.887323796749115 LOC157273 ENSG00000254235 ncRNA_exonic Human lincRNA chr8:9183596 chr8:9183596 . . 0 21 hm7G_associated_SNPs_9268 0 27863252 Neutrophil percentage of white cells 3e-11 GWAS_Catalog TagSNP rs4841132 GCST004633 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
79 chr8 11619205 11619205 1 + C G rs13281294 11619205 + 11619185 11619225 41 AGAGCCCCCCAGCTCTCACTCGTGGACCAAGTGCATGGGAC AGAGCCCCCCAGCTCTCACTGGTGGACCAAGTGCATGGGAC Direct Gain NA NA NA 0 0.688260436058044 Functional Gain 0.688260436058044 C8orf49 ENSG00000255394 CDS Human lincRNA chr8:11619205 chr8:11619205 nonsynonymous SNV . 0 21 hm7G_associated_SNPs_9309 0 30038396 Self-reported math ability 1e-08 GWAS_Catalog TagSNP rs13281294 GCST006573 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
80 chr8 12870186 12870186 1 + C G rs12156420 12870186 + 12870166 12870206 41 CATGTAACGCAGGTTTTTCTCTTATAGGTTGTGGGACTGGA CATGTAACGCAGGTTTTTCTGTTATAGGTTGTGGGACTGGA Direct Gain NA NA NA 0 0.667450904846191 Functional Gain 0.667450904846191 KIAA1456 ENSG00000250305 intronic Human protein_coding chr8:12870186 chr8:12870186 . . 0 21 hm7G_associated_SNPs_9331 0 17554300 Multiple complex diseases 0.000428899 Johnson and O'Donnell TagSNP rs12156420 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
81 chr8 17886442 17886442 1 + C G rs188524320 17886442 + 17886422 17886462 41 AGGCCGAGGCGGGCAGATCACGAGGTCAAGAGATTGAGACC AGGCCGAGGCGGGCAGATCAGGAGGTCAAGAGATTGAGACC Direct Gain NA NA NA 0 0.598712384700775 Functional Gain 0.598712384700775 PCM1 ENSG00000078674 downstream Human protein_coding chr8:17886442 chr8:17886442 . . 0 21 hm7G_associated_SNPs_9356 0 26503814 Response to bronchodilator in chronic obstructive pulmonary disease (change in FEV1) 6e-07 GWAS_Catalog TagSNP rs188524320 GCST003830 A genome-wide analysis of the response to inhaled β2-agonists in chronic obstructive pulmonary disease.
82 chr8 42226805 42226805 1 + C G rs3136797 42226805 + 42226785 42226825 41 TTAGGGTGTTTGCCAGCTTCCCAGTAAAAATGATGAAAAAG TTAGGGTGTTTGCCAGCTTCGCAGTAAAAATGATGAAAAAG Direct Gain NA NA NA 0 0.590483129024506 Functional Gain 0.590483129024506 POLB ENSG00000070501 CDS Human protein_coding chr8:42226805 chr8:42226805 nonsynonymous SNV 0.978 1 21 hm7G_associated_SNPs_9513 0 30134803 Plasma parathyroid hormone levels 3e-06 GWAS_Catalog TagSNP rs3136797 GCST006431 Genome-wide meta-analysis identifies novel loci associated with parathyroid hormone level.
83 chr8 118185733 118185733 1 + A G rs11558471 118185733 + 118185713 118185753 41 AATTTAGATATTTACCTGCAAGAAGGAATAAAGCAGATGCA AATTTAGATATTTACCTGCAGGAAGGAATAAAGCAGATGCA Direct Gain NA NA NA 0 0.894887566566467 Functional Gain 0.894887566566467 SLC30A8 ENSG00000164756 UTR3 Human protein_coding chr8:118185733 chr8:118185733 . . 0 21 hm7G_associated_SNPs_9687 0 21873549 Proinsulin levels 3e-18 GWAS_Catalog TagSNP rs11558471 GCST001212 Genome-wide association identifies nine common variants associated with fasting proinsulin levels and provides new insights into the pathophysiology of type 2 diabetes.
84 chr8 135612745 135612745 1 + A G rs894344 135612745 + 135612725 135612765 41 GGAGTTGAGTAGTCACAGCCATCGGTGGGACACTTCAGCAA GGAGTTGAGTAGTCACAGCCGTCGGTGGGACACTTCAGCAA Direct Gain NA NA NA 0 0.718159317970276 Functional Gain 0.718159317970276 ZFAT ENSG00000066827 CDS Human protein_coding chr8:135612745 chr8:135612745 synonymous SNV . 0 21 hm7G_associated_SNPs_9743 0 28135244 Systolic blood pressure 3e-08 GWAS_Catalog TagSNP rs894344 GCST004279 Genome-wide association analysis identifies novel blood pressure loci and offers biological insights into cardiovascular risk.
85 chr9 5510644 5510644 1 + A G rs16923189 5510644 + 5510624 5510664 41 CATCCTCATATGTCCCAGCTAGAAAGAATCCTGGGTTGGAG CATCCTCATATGTCCCAGCTGGAAAGAATCCTGGGTTGGAG Direct Gain NA NA NA 0 0.635291218757629 Functional Gain 0.635291218757629 PDCD1LG2 ENSG00000197646 UTR5 Human protein_coding chr9:5510644 chr9:5510644 . . 0 21 hm7G_associated_SNPs_9902 0 28240269 Blood protein levels 2e-26 GWAS_Catalog TagSNP rs16923189 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
86 chr9 101915887 101915887 1 + C G rs41283642 101915887 + 101915867 101915907 41 TATGTTAAGTCCTAACACTACAGTAGAAGAATGGAAGCAGT TATGTTAAGTCCTAACACTAGAGTAGAAGAATGGAAGCAGT Direct Gain NA NA NA 0 0.850938320159912 Functional Gain 0.850938320159912 TGFBR1 ENSG00000106799 UTR3 Human protein_coding chr9:101915887 chr9:101915887 . . 0 21 hm7G_associated_SNPs_10219 0 30595370 Respiratory diseases 3e-09 GWAS_Catalog TagSNP rs41283642 GCST007076 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
87 chr9 111625629 111625629 1 + C G rs56031956 111625629 + 111625609 111625649 41 ACACCCAAACCGTGTCCTGCCTTAACAAGTGTGACATCGCC ACACCCAAACCGTGTCCTGCGTTAACAAGTGTGACATCGCC Direct Gain NA NA NA 0 0.507777094841003 Functional Gain 0.507777094841003 ACTL7A ENSG00000187003 CDS Human protein_coding chr9:111625629 chr9:111625629 nonsynonymous SNV 1.000 5 21 hm7G_associated_SNPs_10268 0 29064472 Pursuit maintenance gain 1e-07 GWAS_Catalog TagSNP rs56031956 GCST005024 Genome-wide association studies of smooth pursuit and antisaccade eye movements in psychotic disorders: findings from the B-SNIP study.
88 chr9 129461912 129461912 1 + A G rs3861878 129461912 + 129461892 129461932 41 GGTGTGGCTCGCAGATGAACAAGATGCAGGGCCTGCCTTGA GGTGTGGCTCGCAGATGAACGAGATGCAGGGCCTGCCTTGA Direct Gain NA NA NA 0 0.643672704696655 Functional Gain 0.643672704696655 LMX1B ENSG00000136944 UTR3 Human protein_coding chr9:129461912 chr9:129461912 . . 0 21 hm7G_associated_SNPs_10376 1 17554300 Multiple complex diseases 0.000221927 Johnson and O'Donnell TagSNP rs3861878 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
89 chr9 130487157 130487157 1 + T G rs77630455 130487157 + 130487137 130487177 41 TGCTGCAGGAGAAGATGGGCTTCTGCGAGCAGAGGCGCAAG TGCTGCAGGAGAAGATGGGCGTCTGCGAGCAGAGGCGCAAG Direct Gain NA NA NA 0 0.521944344043732 Functional Gain 0.521944344043732 TTC16 ENSG00000167094 CDS Human protein_coding chr9:130487157 chr9:130487157 nonsynonymous SNV 0.655 0 21 hm7G_associated_SNPs_10393 0 29064472 Pursuit maintenance gain 4e-07 GWAS_Catalog TagSNP rs77630455 GCST005024 Genome-wide association studies of smooth pursuit and antisaccade eye movements in psychotic disorders: findings from the B-SNIP study.
90 chr10 64564934 64564934 1 + C G rs10995311 64564934 + 64564914 64564954 41 ATCGCGACGCGGCTTCTGGCCCGGAGGCGCCGATGCAGCCG ATCGCGACGCGGCTTCTGGCGCGGAGGCGCCGATGCAGCCG Direct Gain NA NA NA 0 0.570431649684906 Functional Gain 0.570431649684906 ADO ENSG00000181915 CDS Human protein_coding chr10:64564934 chr10:64564934 nonsynonymous SNV 0.800 0 21 hm7G_associated_SNPs_10965 0 27618447 Diastolic blood pressure 1e-12 GWAS_Catalog TagSNP rs10995311 GCST006020 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
91 chr10 99969568 99969568 1 + A G rs11189513 99969568 + 99969548 99969588 41 AAAAGCAACTGAAACTTCTCACACAGAGGGAATTACTGCCA AAAAGCAACTGAAACTTCTCGCACAGAGGGAATTACTGCCA Direct Gain NA NA NA 0 0.624915778636932 Functional Gain 0.624915778636932 R3HCC1L ENSG00000166024 CDS Human protein_coding chr10:99969568 chr10:99969568 nonsynonymous SNV 0.036 0 21 hm7G_associated_SNPs_11225 0 30108127 Body mass index 6e-08 GWAS_Catalog TagSNP rs11189513 GCST006368 A Large Multi-ethnic Genome-Wide Association Study of Adult Body Mass Index Identifies Novel Loci.
92 chr10 104575870 104575870 1 + A G rs6892 104575870 + 104575850 104575890 41 CACGTTACCCTTTGTCAGTTATTGTGAATATGTGTATTTTA CACGTTACCCTTTGTCAGTTGTTGTGAATATGTGTATTTTA Direct Gain NA NA NA 0 0.559986054897308 Functional Gain 0.559986054897308 WBP1L ENSG00000166272 UTR3 Human protein_coding chr10:104575870 chr10:104575870 . . 0 21 hm7G_associated_SNPs_11296 0 31015462 Estimated glomerular filtration rate 1e-09 GWAS_Catalog TagSNP rs6892 GCST007876 Sex-specific and pleiotropic effects underlying kidney function identified from GWAS meta-analysis.
93 chr10 106039185 106039185 1 + A G rs156697 106039185 + 106039165 106039205 41 GATGTGGGAGAGAATGCACTAATCTGAAGGCAGCCCTGCGT GATGTGGGAGAGAATGCACTGATCTGAAGGCAGCCCTGCGT Direct Gain NA NA NA 0 0.978013753890991 Functional Gain 0.978013753890991 GSTO2 ENSG00000065621 CDS Human protein_coding chr10:106039185 chr10:106039185 nonsynonymous SNV 0.239 0 21 hm7G_associated_SNPs_11306 0 17903307 Pulmonary function phenotypes 9.78e-06 Johnson and O'Donnell TagSNP rs156697 . Framingham Heart Study genome-wide association: results for pulmonary function measures.
94 chr11 308180 308180 1 + A G rs10398 308180 + 308160 308200 41 ACCATCCCGGTAACCCGATCACCGCTGGTCACCATGAACCA ACCATCCCGGTAACCCGATCGCCGCTGGTCACCATGAACCA Direct Gain NA NA NA 0 0.714509844779968 Functional Gain 0.714509844779968 IFITM2 ENSG00000185201 UTR5 Human protein_coding chr11:308180 chr11:308180 . . 0 21 hm7G_associated_SNPs_11495 0 27863252 Monocyte percentage of white cells 9e-37 GWAS_Catalog TagSNP rs10398 GCST004609 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
95 chr11 823586 823586 1 + C G rs140201358 823586 + 823566 823606 41 CTGCGCTTTCTGCAGCGGAACGGTGCGCGGACCCGGGCGGG CTGCGCTTTCTGCAGCGGAAGGGTGCGCGGACCCGGGCGGG Direct Gain NA NA NA 0 0.669448614120483 Functional Gain 0.669448614120483 PNPLA2 ENSG00000177666 CDS Human protein_coding chr11:823586 chr11:823586 nonsynonymous SNV 0.597 1 21 hm7G_associated_SNPs_11532 1 30595370 Waist-hip ratio 6e-25 GWAS_Catalog TagSNP rs140201358 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
96 chr11 2167543 2167543 1 + T G rs1003483 2167543 + 2167523 2167563 41 ATTTTACAAACCCAGCTCCTTTCTCCAAGGGTCCTCAGAGC ATTTTACAAACCCAGCTCCTGTCTCCAAGGGTCCTCAGAGC Direct Gain NA NA NA 0 0.888977289199829 Functional Gain 0.888977289199829 IGF2-AS ENSG00000099869 ncRNA_exonic Human antisense chr11:2167543 chr11:2167543 . . 0 21 hm7G_associated_SNPs_11598 0 17052657 Parkinson's disease 9.67286e-05 Johnson and O'Donnell TagSNP rs1003483 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
97 chr11 2169774 2169774 1 + A G rs3741208 2169774 + 2169754 2169794 41 CGGTTGTTGCCTCTCCCGGCATTTCTCCTCAGTCTCCTGTC CGGTTGTTGCCTCTCCCGGCGTTTCTCCTCAGTCTCCTGTC Direct Gain NA NA NA 0 0.660731017589569 Functional Gain 0.660731017589569 IGF2-AS ENSG00000099869 ncRNA_exonic Human antisense chr11:2169774 chr11:2169774 . . 0 21 hm7G_associated_SNPs_11602 0 17554260 Type 1 diabetes 2e-07 GWAS_Catalog TagSNP rs3741208 GCST000038 Robust associations of four new chromosome regions from genome-wide analyses of type 1 diabetes.
98 chr11 4661285 4661285 1 + A G rs905871 4661285 + 4661265 4661305 41 TTGACCTAGTCCTCTCCTCTATCACCATGCCCAAGATGGCC TTGACCTAGTCCTCTCCTCTGTCACCATGCCCAAGATGGCC Direct Gain NA NA NA 0 0.686338543891907 Functional Gain 0.686338543891907 OR51D1 ENSG00000197428 CDS Human protein_coding chr11:4661285 chr11:4661285 nonsynonymous SNV 0.487 0 21 hm7G_associated_SNPs_11634 0 30643258 Smoking status (ever vs never smokers) 3e-08 GWAS_Catalog TagSNP rs905871 GCST007327 Genome-wide association analyses of risk tolerance and risky behaviors in over 1 million individuals identify hundreds of loci and shared genetic influences.
99 chr11 5010905 5010905 1 + A G rs2499953 5010905 + 5010885 5010925 41 TCCATCAATTTTTCCTGACCAAGAAGGAGTCGCCACTCCTT TCCATCAATTTTTCCTGACCGAGAAGGAGTCGCCACTCCTT Direct Gain NA NA NA 0 0.514716565608978 Functional Gain 0.514716565608978 MMP26 ENSG00000167346 CDS Human protein_coding chr11:5010905 chr11:5010905 nonsynonymous SNV 0.946 0 21 hm7G_associated_SNPs_11639 0 17293876 Type II Diabetes Mellitus 1.7e-05 Johnson and O'Donnell TagSNP rs2499953 . A genome-wide association study identifies novel risk loci for type 2 diabetes.
100 chr11 36458997 36458997 1 + A G rs62621409 36458997 + 36458977 36459017 41 TCTTCACTGAGACTCTCCCTACCCTGCAGGCAATATTTTAT TCTTCACTGAGACTCTCCCTGCCCTGCAGGCAATATTTTAT Direct Gain NA NA NA 0 0.603311777114868 Functional Gain 0.603311777114868 PRR5L ENSG00000135362 CDS Human protein_coding chr11:36458997 chr11:36458997 nonsynonymous SNV 0.999 3 21 hm7G_associated_SNPs_11853 0 30595370 Red blood cell count 1e-08 GWAS_Catalog TagSNP rs62621409 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
101 chr11 45827350 45827350 1 + A G rs3808976 45827350 + 45827330 45827370 41 GGTGACCCAGCTCCTCTGCTACCATGAATAGGGCCCCTCTG GGTGACCCAGCTCCTCTGCTGCCATGAATAGGGCCCCTCTG Direct Gain NA NA NA 0 0.973178803920746 Functional Gain 0.973178803920746 SLC35C1 ENSG00000181830 UTR5 Human protein_coding chr11:45827350 chr11:45827350 . . 0 21 hm7G_associated_SNPs_11891 2 17827064 Amyotrophic Lateral Sclerosis (ALS) 0.0007005 Johnson and O'Donnell TagSNP rs3808976 . ITPR2 as a susceptibility gene in sporadic amyotrophic lateral sclerosis: a genome-wide association study.
102 chr11 47183427 47183427 1 + C G rs117749721 47183427 + 47183407 47183447 41 AACTTCACTTAGGCCCCAAGCTGACAGACTGTGCTGAGGCC AACTTCACTTAGGCCCCAAGGTGACAGACTGTGCTGAGGCC Direct Gain NA NA NA 0 0.515603184700012 Functional Gain 0.515603184700012 C11orf49 ENSG00000149179 UTR3 Human protein_coding chr11:47183427 chr11:47183427 . . 0 21 hm7G_associated_SNPs_11919 0 30595370 Body mass index 4e-08 GWAS_Catalog TagSNP rs117749721 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
103 chr11 66299515 66299515 1 + A G rs8432 66299515 + 66299495 66299535 41 TGGCGGCCGCCTGAGACCTGAGCTGCTGTGAAAGCCCCTGC TGGCGGCCGCCTGAGACCTGGGCTGCTGTGAAAGCCCCTGC Direct Gain NA NA NA 0 0.517346501350403 Functional Gain 0.517346501350403 BBS1 ENSG00000174483;ENSG00000256349 UTR3 Human other chr11:66299515 chr11:66299515 . . 0 21 hm7G_associated_SNPs_12153 2 30595370 Mean corpuscular hemoglobin 7e-17 GWAS_Catalog TagSNP rs8432 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
104 chr11 118477367 118477367 1 + A G rs498872 118477367 + 118477347 118477387 41 CTCCCCAGCCAGTCTCCTGGACCAAGAGCTGGCTTTGCAAG CTCCCCAGCCAGTCTCCTGGGCCAAGAGCTGGCTTTGCAAG Direct Gain NA NA NA 0 0.759403228759766 Functional Gain 0.759403228759766 PHLDB1 ENSG00000019144 UTR5 Human protein_coding chr11:118477367 chr11:118477367 . . 0 21 hm7G_associated_SNPs_12494 0 21531791 Glioma 5e-11 GWAS_Catalog TagSNP rs498872 GCST001058 Chromosome 7p11.2 (EGFR) variation influences glioma risk.
105 chr11 122526601 122526601 1 + C G rs7128198 122526601 + 122526581 122526621 41 CACCAGGAAGCGTCAGAGTCCCGACACTGGGGAAGCTCGGA CACCAGGAAGCGTCAGAGTCGCGACACTGGGGAAGCTCGGA Direct Gain NA NA NA 0 0.504638850688934 Functional Gain 0.504638850688934 UBASH3B ENSG00000154127 UTR5 Human protein_coding chr11:122526601 chr11:122526601 . . 0 21 hm7G_associated_SNPs_12541 0 25961943 Cholesterol, total 4e-09 GWAS_Catalog TagSNP rs7128198 GCST002896 The impact of low-frequency and rare variants on lipid levels.
106 chr11 126225876 126225876 1 + C G rs112771035 126225876 + 126225856 126225896 41 CACGTGGGCGCAGCGCGGGTCGGGGTGGGGCTGCCACAGCC CACGTGGGCGCAGCGCGGGTGGGGGTGGGGCTGCCACAGCC Direct Gain NA NA NA 0 0.615176260471344 Functional Gain 0.615176260471344 ST3GAL4 ENSG00000110080 UTR5 Human protein_coding chr11:126225876 chr11:126225876 . . 0 21 hm7G_associated_SNPs_12597 0 31015401 Medication use (HMG CoA reductase inhibitors) 2e-10 GWAS_Catalog TagSNP rs112771035 GCST007931 Genome-wide association study of medication-use and associated disease in the UK Biobank.
107 chr11 129567902 129567902 1 + C G rs141697342 129567902 + 129567882 129567922 41 AATCCCAGCACTTTGGGAGGCTGAGGAGAGCAGATCACTTG AATCCCAGCACTTTGGGAGGGTGAGGAGAGCAGATCACTTG Direct Gain NA NA NA 0 0.589193642139435 Functional Gain 0.589193642139435 LINC01395;TMEM45B ENSG00000240121;ENSG00000255188 intergenic Human other chr11:129567902 chr11:129567902 . . 0 21 hm7G_associated_SNPs_12612 0 27126917 Night sleep phenotypes 1e-06 GWAS_Catalog TagSNP rs141697342 GCST003542 Genome-wide association analysis of actigraphic sleep phenotypes in the LIFE Adult Study.
108 chr12 6493351 6493351 1 + A G rs10849448 6493351 + 6493331 6493371 41 CCCACTTCCTGAGCTCCGCCATGGGAGCCCTGGAGGCCCGG CCCACTTCCTGAGCTCCGCCGTGGGAGCCCTGGAGGCCCGG Direct Gain NA NA NA 0 0.631763637065887 Functional Gain 0.631763637065887 LTBR ENSG00000111321 UTR5 Human protein_coding chr12:6493351 chr12:6493351 . . 0 21 hm7G_associated_SNPs_12753 0 27182965 Tonsillectomy 2e-35 GWAS_Catalog TagSNP rs10849448 GCST003995 Detection and interpretation of shared genetic influences on 42 human traits.
109 chr12 8291122 8291122 1 + T G rs1133104 8291122 + 8291102 8291142 41 AGGCCCCCATTGTGCACACATGGAGAGAACATGAGTCTCTC AGGCCCCCATTGTGCACACAGGGAGAGAACATGAGTCTCTC Direct Gain NA NA NA 0 0.619459688663483 Functional Gain 0.619459688663483 CLEC4A ENSG00000111729 UTR3 Human protein_coding chr12:8291122 chr12:8291122 . . 0 21 hm7G_associated_SNPs_12810 0 29855589 Velopharyngeal dysfunction 2e-08 GWAS_Catalog TagSNP rs1133104 GCST006280 GWAS reveals loci associated with velopharyngeal dysfunction.
110 chr12 10131684 10131684 1 + T G rs607567 10131684 + 10131664 10131704 41 GTATGTACTGCCCCTGTTTTTGTCAAGAGGAAGTATCTAGA GTATGTACTGCCCCTGTTTTGGTCAAGAGGAAGTATCTAGA Direct Gain NA NA NA 0 0.637099504470825 Functional Gain 0.637099504470825 CLEC12A ENSG00000172322 intronic Human protein_coding chr12:10131684 chr12:10131684 . . 0 21 hm7G_associated_SNPs_12843 0 17554300 Multiple complex diseases 0.000297352 Johnson and O'Donnell TagSNP rs607567 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
111 chr12 14587301 14587301 1 + A G rs3213764 14587301 + 14587281 14587321 41 AAGTAATGAAAAGGACAACAAACCTGAGGAAGAAGAGCAAG AAGTAATGAAAAGGACAACAGACCTGAGGAAGAAGAGCAAG Direct Gain NA NA NA 0 0.572212874889374 Functional Gain 0.572212874889374 ATF7IP ENSG00000171681 CDS Human protein_coding chr12:14587301 chr12:14587301 nonsynonymous SNV 0.997 1 21 hm7G_associated_SNPs_12889 0 23359319 Prostate-specific antigen levels 2e-09 GWAS_Catalog TagSNP rs3213764 GCST001799 Genome-wide association study identifies loci at ATF7IP and KLK2 associated with percentage of circulating free PSA.
112 chr12 26348429 26348429 1 + C G rs113819537 26348429 + 26348409 26348449 41 CGACCCCCCTCGAATCCCCCCTCTGCTGCGGGCTCCCCGTG CGACCCCCCTCGAATCCCCCGTCTGCTGCGGGCTCCCCGTG Direct Gain NA NA NA 0 0.852971196174622 Functional Gain 0.852971196174622 SSPN ENSG00000123096 UTR5 Human protein_coding chr12:26348429 chr12:26348429 . . 0 21 hm7G_associated_SNPs_12919 0 29892015 Atrial fibrillation 2e-09 GWAS_Catalog TagSNP rs113819537 GCST006061 Multi-ethnic genome-wide association study for atrial fibrillation.
113 chr12 57975700 57975700 1 + C G rs113247976 57975700 + 57975680 57975720 41 AGCCACATCTTCTGGCGGCCCCTTGGCTTCCTACCAGAAGG AGCCACATCTTCTGGCGGCCGCTTGGCTTCCTACCAGAAGG Direct Gain NA NA NA 0 0.542290687561035 Functional Gain 0.542290687561035 KIF5A ENSG00000155980 CDS Human protein_coding chr12:57975700 chr12:57975700 nonsynonymous SNV 0.851 1 21 hm7G_associated_SNPs_13157 1 29566793 Amyotrophic lateral sclerosis 7e-13 GWAS_Catalog TagSNP rs113247976 GCST005647 Genome-wide Analyses Identify KIF5A as a Novel ALS Gene.
114 chr12 64540960 64540960 1 + A G rs7131691 64540960 + 64540940 64540980 41 GGGTAACTGCTGCCCGCGTAATTAAATCAGTATTGTCCTTT GGGTAACTGCTGCCCGCGTAGTTAAATCAGTATTGTCCTTT Direct Gain NA NA NA 0 0.642371952533722 Functional Gain 0.642371952533722 SRGAP1 ENSG00000255629 ncRNA_intronic Human antisense chr12:64540960 chr12:64540960 . . 0 21 hm7G_associated_SNPs_13187 0 30038396 Highest math class taken (MTAG) 2e-08 GWAS_Catalog TagSNP rs7131691 GCST006568 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
115 chr13 31495835 31495835 1 + C G rs41433250 31495835 + 31495815 31495855 41 TGGTTTGGGCTCAGTAATTCCGTTGTAAAAGTAAATGGAAA TGGTTTGGGCTCAGTAATTCGGTTGTAAAAGTAAATGGAAA Direct Gain NA NA NA 0 0.619364857673645 Functional Gain 0.619364857673645 MEDAG ENSG00000102802 CDS Human protein_coding chr13:31495835 chr13:31495835 synonymous SNV . 0 21 hm7G_associated_SNPs_13745 0 26379185 Influenza A (H1N1) infection 2e-08 GWAS_Catalog TagSNP rs41433250 GCST003125 No Major Host Genetic Risk Factor Contributed to A(H1N1)2009 Influenza Severity.
116 chr13 43148546 43148546 1 + C G rs138818878 43148546 + 43148526 43148566 41 CCTGCACGCCCCGCCGCCGCCTGCGCCGCACCAGCCCCCTG CCTGCACGCCCCGCCGCCGCGTGCGCCGCACCAGCCCCCTG Direct Gain NA NA NA 0 0.628386914730072 Functional Gain 0.628386914730072 TNFSF11 ENSG00000120659 CDS Human protein_coding chr13:43148546 chr13:43148546 nonsynonymous SNV 0.014 0 21 hm7G_associated_SNPs_13805 1 30598549 Heel bone mineral density 6e-15 GWAS_Catalog TagSNP rs138818878 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
117 chr13 44457925 44457925 1 + A G rs3764147 44457925 + 44457905 44457945 41 AGACTCATCATTCCAATGACATCTGGATTATGGGAAGAAAG AGACTCATCATTCCAATGACGTCTGGATTATGGGAAGAAAG Direct Gain NA NA NA 0 0.776417970657349 Functional Gain 0.776417970657349 LACC1 ENSG00000179630 CDS Human protein_coding chr13:44457925 chr13:44457925 nonsynonymous SNV 0.753 0 21 hm7G_associated_SNPs_13809 0 21102463 Crohn's disease 1e-10 GWAS_Catalog TagSNP rs3764147 GCST000879 Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci.
118 chr14 63758432 63758432 1 + A G rs17100993 63758432 + 63758412 63758452 41 GAGCCATGATTTTTGAACCTAATTGAAAGAAAACCATCTGA GAGCCATGATTTTTGAACCTGATTGAAAGAAAACCATCTGA Direct Gain NA NA NA 0 0.627131760120392 Functional Gain 0.627131760120392 RHOJ ENSG00000126785 UTR3 Human protein_coding chr14:63758432 chr14:63758432 . . 0 21 hm7G_associated_SNPs_14274 0 17554300 Multiple complex diseases 0.000176523 Johnson and O'Donnell TagSNP rs17100993 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
119 chr15 74328576 74328576 1 + A G rs9479 74328576 + 74328556 74328596 41 TCACCCTTGCACTCTCCTGTATTCTGAGTCCCTGGCCAATA TCACCCTTGCACTCTCCTGTGTTCTGAGTCCCTGGCCAATA Direct Gain NA NA NA 0 0.70697695016861 Functional Gain 0.70697695016861 PML ENSG00000140464 UTR3 Human protein_coding chr15:74328576 chr15:74328576 . . 0 21 hm7G_associated_SNPs_15088 0 30595370 Red blood cell count 3e-13 GWAS_Catalog TagSNP rs9479 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
120 chr15 78556589 78556589 1 + C G rs12898295 78556589 + 78556569 78556609 41 CGGAAGGGCAAGGGGGCGGCCTCGGGGCGGCGGGACAGTTG CGGAAGGGCAAGGGGGCGGCGTCGGGGCGGCGGGACAGTTG Direct Gain NA NA NA 0 0.876752495765686 Functional Gain 0.876752495765686 DNAJA4 ENSG00000140403 UTR5 Human protein_coding chr15:78556589 chr15:78556589 . . 0 21 hm7G_associated_SNPs_15140 0 30038396 Self-reported math ability 2e-08 GWAS_Catalog TagSNP rs12898295 GCST006573 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
121 chr16 1306642 1306642 1 + C G rs61739908 1306642 + 1306622 1306662 41 TGCACTTCTGCGGGGGCTCCCTCATCCACCCCCAGTGGGTG TGCACTTCTGCGGGGGCTCCGTCATCCACCCCCAGTGGGTG Direct Gain NA NA NA 0 0.603505551815033 Functional Gain 0.603505551815033 TPSD1 ENSG00000095917 CDS Human protein_coding chr16:1306642 chr16:1306642 nonsynonymous SNV 0.983 5 21 hm7G_associated_SNPs_15459 0 30072576 Blood protein levels 2e-76 GWAS_Catalog TagSNP rs61739908 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
122 chr16 1682281 1682281 1 + A G rs3169425 1682281 + 1682261 1682301 41 AAGAAGAAAGGCAAGCCAGCAAGCATGGTGAAGAACAAGGA AAGAAGAAAGGCAAGCCAGCGAGCATGGTGAAGAACAAGGA Direct Gain NA NA NA 0 0.557201325893402 Functional Gain 0.557201325893402 CRAMP1 ENSG00000007545;ENSG00000261732 CDS Human other chr16:1682281 chr16:1682281 synonymous SNV . 0 21 hm7G_associated_SNPs_15478 0 17052657 Parkinson's disease 0.000184438 Johnson and O'Donnell TagSNP rs3169425 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
123 chr16 2758283 2758283 1 + T G rs77844870 2758283 + 2758263 2758303 41 CTCTCGCCGCTCTCTCATTTTCTTTGTATAACTATGCAGCC CTCTCGCCGCTCTCTCATTTGCTTTGTATAACTATGCAGCC Direct Gain NA NA NA 0 0.555698394775391 Functional Gain 0.555698394775391 KCTD5 ENSG00000167977 UTR3 Human protein_coding chr16:2758283 chr16:2758283 . . 0 21 hm7G_associated_SNPs_15558 0 30595370 Height 3e-16 GWAS_Catalog TagSNP rs77844870 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
124 chr16 15129970 15129970 1 + A G rs7200543 15129970 + 15129950 15129990 41 TTAGAAAAGGTGGAGCGCCTATCCAGTGGGCCGGAGCAGAT TTAGAAAAGGTGGAGCGCCTGTCCAGTGGGCCGGAGCAGAT Direct Gain NA NA NA 0 0.633043766021729 Functional Gain 0.633043766021729 PDXDC1 ENSG00000179889 CDS Human protein_coding chr16:15129970 chr16:15129970 synonymous SNV . 0 21 hm7G_associated_SNPs_15718 0 21886157 Metabolic traits 5e-16 GWAS_Catalog TagSNP rs7200543 GCST001217 Human metabolic individuality in biomedical and pharmaceutical research.
125 chr16 28883241 28883241 1 + A G rs7498665 28883241 + 28883221 28883261 41 CCATTGAAGAGGGACCCCCAACAGGGACAGTTCATCCCCTC CCATTGAAGAGGGACCCCCAGCAGGGACAGTTCATCCCCTC Direct Gain NA NA NA 0 0.578812062740326 Functional Gain 0.578812062740326 SH2B1 ENSG00000178188 CDS Human protein_coding chr16:28883241 chr16:28883241 nonsynonymous SNV 0.736 0 21 hm7G_associated_SNPs_15829 0 23563607 Obesity 5e-12 GWAS_Catalog TagSNP rs7498665 GCST001953 Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture.
126 chr16 30999142 30999142 1 + A G rs9938550 30999142 + 30999122 30999162 41 GGGAGCTGGAGCAGCGGGCAACCCTGATGGGCGGCCAGGTA GGGAGCTGGAGCAGCGGGCAGCCCTGATGGGCGGCCAGGTA Direct Gain NA NA NA 0 0.855007708072662 Functional Gain 0.855007708072662 HSD3B7 ENSG00000099377 CDS Human protein_coding chr16:30999142 chr16:30999142 nonsynonymous SNV 0.033 1 21 hm7G_associated_SNPs_15903 1 29500382 Irritable mood 6e-09 GWAS_Catalog TagSNP rs9938550 GCST006941 Item-level analyses reveal genetic heterogeneity in neuroticism.
127 chr16 58545426 58545426 1 + A G rs42945 58545426 + 58545406 58545446 41 CCACAGGCCTGCACCCACTCAGAGAGCAGCGAGGGGCTGGG CCACAGGCCTGCACCCACTCGGAGAGCAGCGAGGGGCTGGG Direct Gain NA NA NA 0 0.69377589225769 Functional Gain 0.69377589225769 NDRG4 ENSG00000103034 CDS Human protein_coding chr16:58545426 chr16:58545426 synonymous SNV . 0 21 hm7G_associated_SNPs_16039 0 29483656 Schizophrenia 2e-10 GWAS_Catalog TagSNP rs42945 GCST006803 Common schizophrenia alleles are enriched in mutation-intolerant genes and in regions under strong background selection.
128 chr16 67876823 67876823 1 + A G rs28647874 67876823 + 67876803 67876843 41 CAACAGCAGCAGCAGCAGCAACAGCAGCAGCAGCAGCAGCA CAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA Direct Gain NA NA NA 0 0.920998215675354 Functional Gain 0.920998215675354 THAP11 ENSG00000168286 CDS Human protein_coding chr16:67876823 chr16:67876823 synonymous SNV . 0 21 hm7G_associated_SNPs_16078 0 27863252 Red blood cell count 1e-15 GWAS_Catalog TagSNP rs28647874 GCST004601 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
129 chr16 70611562 70611562 1 + A G rs16970331 70611562 + 70611542 70611582 41 CACTCGGAATAAAGCGCACTATTGTCACTAGGTTGGCATTT CACTCGGAATAAAGCGCACTGTTGTCACTAGGTTGGCATTT Direct Gain NA NA NA 0 0.571193218231201 Functional Gain 0.571193218231201 SF3B3 ENSG00000260023 ncRNA_exonic Human other chr16:70611562 chr16:70611562 . . 0 21 hm7G_associated_SNPs_16139 0 17554300 Multiple complex diseases 0.000731174 Johnson and O'Donnell TagSNP rs16970331 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
130 chr16 84796603 84796603 1 + A G rs12932018 84796603 + 84796583 84796623 41 TGACCTTTTCAGGGTCGACAAGAAGATGCTGAGGAATACTT TGACCTTTTCAGGGTCGACAGGAAGATGCTGAGGAATACTT Direct Gain NA NA NA 0 0.65032970905304 Functional Gain 0.65032970905304 USP10 ENSG00000103194 CDS Human protein_coding chr16:84796603 chr16:84796603 synonymous SNV . 0 21 hm7G_associated_SNPs_16257 0 24009623 Response to mTOR inhibitor (everolimus) 6e-06 GWAS_Catalog TagSNP rs12932018 GCST002157 Genome-wide association study for biomarker identification of Rapamycin and Everolimus using a lymphoblastoid cell line system.
131 chr16 89300182 89300182 1 + A G rs200249085 89300182 + 89300162 89300202 41 CGCACTGCGTATGCAACTCAACTCGCACTGCGTATGCAACT CGCACTGCGTATGCAACTCAGCTCGCACTGCGTATGCAACT Direct Gain NA NA NA 0 0.50029331445694 Functional Gain 0.50029331445694 ZNF778;ANKRD11 ENSG00000170100;ENSG00000260637 intergenic Human other chr16:89300182 chr16:89300182 . . 0 21 hm7G_associated_SNPs_16374 0 27863252 Lymphocyte percentage of white cells 7e-10 GWAS_Catalog TagSNP rs200249085 GCST004632 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
132 chr17 1782952 1782952 1 + A G rs5030755 1782952 + 1782932 1782972 41 GGAATATCTACTTGATGGACACATCCGGGAAGGTGGTGACT GGAATATCTACTTGATGGACGCATCCGGGAAGGTGGTGACT Direct Gain NA NA NA 0 0.628176808357239 Functional Gain 0.628176808357239 RPA1 ENSG00000132383 CDS Human protein_coding chr17:1782952 chr17:1782952 nonsynonymous SNV 0.887 0 21 hm7G_associated_SNPs_16467 0 27863252 Mean corpuscular volume 9e-11 GWAS_Catalog TagSNP rs5030755 GCST004602 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
133 chr17 16229232 16229232 1 + A G rs15739 16229232 + 16229212 16229252 41 AAGCCTTGAAGGGTTTTCAGATCCAAGGAACAAAGGGGAAA AAGCCTTGAAGGGTTTTCAGGTCCAAGGAACAAAGGGGAAA Direct Gain NA NA NA 0 0.564868211746216 Functional Gain 0.564868211746216 PIGL ENSG00000108474 UTR3 Human protein_coding chr17:16229232 chr17:16229232 . . 0 21 hm7G_associated_SNPs_16676 1 30038396 Educational attainment (MTAG) 2e-08 GWAS_Catalog TagSNP rs15739 GCST006571 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
134 chr17 43716885 43716885 1 + A G rs413778 43716885 + 43716865 43716905 41 ACACTGGAGCTGGTGAGTCAAAGTAAGTATAAGTGGGGAGC ACACTGGAGCTGGTGAGTCAGAGTAAGTATAAGTGGGGAGC Direct Gain NA NA NA 0 0.795249879360199 Functional Gain 0.795249879360199 LINC02210 ENSG00000204650 ncRNA_exonic Human transcribed_unitary_pseudogene chr17:43716885 chr17:43716885 . . 0 21 hm7G_associated_SNPs_16990 0 17554300 Multiple complex diseases 0.000144205 Johnson and O'Donnell TagSNP rs413778 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
135 chr17 43719143 43719143 1 + A G rs393152 43719143 + 43719123 43719163 41 AGAAGGAATGAGGAGAGGATATGAGGAAAGAGCCACAGCAC AGAAGGAATGAGGAGAGGATGTGAGGAAAGAGCCACAGCAC Direct Gain NA NA NA 0 0.781755864620209 Functional Gain 0.781755864620209 LINC02210 ENSG00000204650 ncRNA_exonic Human transcribed_unitary_pseudogene chr17:43719143 chr17:43719143 . . 0 21 hm7G_associated_SNPs_16991 0 19915575 Parkinson's disease 2e-16 GWAS_Catalog TagSNP rs393152 GCST000528 Genome-wide association study reveals genetic risk underlying Parkinson's disease.
136 chr17 43923683 43923683 1 + A G rs12185268 43923683 + 43923663 43923703 41 TGCAAGTCTGCTCCCGTCAGATCTACTTCGTGGCCTGCACC TGCAAGTCTGCTCCCGTCAGGTCTACTTCGTGGCCTGCACC Direct Gain NA NA NA 0 0.629445791244507 Functional Gain 0.629445791244507 SPPL2C ENSG00000185294 CDS Human protein_coding chr17:43923683 chr17:43923683 nonsynonymous SNV 0.002 0 21 hm7G_associated_SNPs_16995 0 21738487 Parkinson's disease 3e-14 GWAS_Catalog TagSNP rs12185268 GCST001126 Web-based genome-wide association study identifies two novel loci and a substantial genetic component for Parkinson's disease.
137 chr17 57287454 57287454 1 + A G rs6503905 57287454 + 57287434 57287474 41 CGAGACCTTCTAATGGGAGCATCAGCCTGGATGGGCTCTGA CGAGACCTTCTAATGGGAGCGTCAGCCTGGATGGGCTCTGA Direct Gain NA NA NA 0 0.594221353530884 Functional Gain 0.594221353530884 SMG8 ENSG00000167447 CDS Human protein_coding chr17:57287454 chr17:57287454 synonymous SNV . 0 21 hm7G_associated_SNPs_17128 0 23620142 Circulating myeloperoxidase levels (plasma) 3e-12 GWAS_Catalog TagSNP rs6503905 GCST001980 Genome-wide and gene-centric analyses of circulating myeloperoxidase levels in the charge and care consortia.
138 chr17 80685426 80685426 1 + A G rs1046875 80685426 + 80685406 80685446 41 CTGCTCATAGGTACCTTTCCACTGCCTCCTCCCTGCTCTCC CTGCTCATAGGTACCTTTCCGCTGCCTCCTCCCTGCTCTCC Direct Gain NA NA NA 0 0.673235356807709 Functional Gain 0.673235356807709 FN3KRP ENSG00000141560 UTR3 Human protein_coding chr17:80685426 chr17:80685426 . . 0 21 hm7G_associated_SNPs_17470 0 24647736 Glycated hemoglobin levels 4e-17 GWAS_Catalog TagSNP rs1046875 GCST002390 Multiple nonglycemic genomic loci are newly associated with blood level of glycated hemoglobin in East Asians.
139 chr18 33557466 33557466 1 + A G rs2276314 33557466 + 33557446 33557486 41 AGAGCAATCCTGCCACTCCTACAAGTAAACTCAGCCTGAAG AGAGCAATCCTGCCACTCCTGCAAGTAAACTCAGCCTGAAG Direct Gain NA NA NA 0 0.680157899856567 Functional Gain 0.680157899856567 C18orf21 ENSG00000141428 CDS Human protein_coding chr18:33557466 chr18:33557466 nonsynonymous SNV 0.001 0 21 hm7G_associated_SNPs_17642 0 27506219 Endometriosis 7e-06 GWAS_Catalog TagSNP rs2276314 GCST003819 Pooling-Based Genome-Wide Association Study Identifies Risk Loci in the Pathogenesis of Ovarian Endometrioma in Chinese Han Women.
140 chr18 51797332 51797332 1 + A G rs3730682 51797332 + 51797312 51797352 41 TGTTGGTTTGTTTGTTTTAAATGTAAGGGCATGCTGCTTAG TGTTGGTTTGTTTGTTTTAAGTGTAAGGGCATGCTGCTTAG Direct Gain NA NA NA 0 0.531031489372253 Functional Gain 0.531031489372253 POLI ENSG00000101751 intronic Human protein_coding chr18:51797332 chr18:51797332 . . 0 21 hm7G_associated_SNPs_17699 0 25903422 Psoriasis 2e-07 GWAS_Catalog TagSNP rs3730682 GCST002874 Genome-wide meta-analysis identifies multiple novel associations and ethnic heterogeneity of psoriasis susceptibility.
141 chr18 61442619 61442619 1 + A G rs12964116 61442619 + 61442599 61442639 41 ACAGTGCTGTGCTCTGAGTCATAGGGAAGCCATCCCAGAAG ACAGTGCTGTGCTCTGAGTCGTAGGGAAGCCATCCCAGAAG Direct Gain NA NA NA 0 0.589744448661804 Functional Gain 0.589744448661804 SERPINB7 ENSG00000166396 intronic Human protein_coding chr18:61442619 chr18:61442619 . . 0 21 hm7G_associated_SNPs_17759 0 29051540 Food allergy 2e-08 GWAS_Catalog TagSNP rs12964116 GCST004979 Genome-wide association study identifies the SERPINB gene cluster as a susceptibility locus for food allergy.
142 chr18 61654297 61654297 1 + A G rs3169983 61654297 + 61654277 61654317 41 CAGACTTTTCTGGAATGTCAACTGAGAAGAATGTGCCTCTG CAGACTTTTCTGGAATGTCAGCTGAGAAGAATGTGCCTCTG Direct Gain NA NA NA 0 0.914349913597107 Functional Gain 0.914349913597107 SERPINB8 ENSG00000166401 CDS Human protein_coding chr18:61654297 chr18:61654297 nonsynonymous SNV 0.997 0 21 hm7G_associated_SNPs_17763 0 17554300 Multiple complex diseases 0.000481397 Johnson and O'Donnell TagSNP rs3169983 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
143 chr19 2232221 2232221 1 + A G rs740406 2232221 + 2232201 2232241 41 GAATTGATAGGAACCCTAAAAACTAGGATACCCCCTCCTCG GAATTGATAGGAACCCTAAAGACTAGGATACCCCCTCCTCG Direct Gain NA NA NA 0 0.823570251464844 Functional Gain 0.823570251464844 DOT1L ENSG00000104885 UTR3 Human protein_coding chr19:2232221 chr19:2232221 . . 0 21 hm7G_associated_SNPs_17915 0 27841878 Pulse pressure 4e-08 GWAS_Catalog TagSNP rs740406 GCST007096 Genome-wide association analyses using electronic health records identify new loci influencing blood pressure variation.
144 chr19 3179517 3179517 1 + C G rs61731111 3179517 + 3179497 3179537 41 AGGCCCCACGCCCAGCGGCCCGCCGCAAGGCCCGCCGCCTG AGGCCCCACGCCCAGCGGCCGGCCGCAAGGCCCGCCGCCTG Direct Gain NA NA NA 0 0.818621516227722 Functional Gain 0.818621516227722 S1PR4 ENSG00000125910 CDS Human protein_coding chr19:3179517 chr19:3179517 nonsynonymous SNV 0.933 1 21 hm7G_associated_SNPs_17950 0 27863252 Eosinophil percentage of granulocytes 1e-18 GWAS_Catalog TagSNP rs61731111 GCST004617 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
145 chr19 10742170 10742170 1 + A G rs2288904 10742170 + 10742150 10742190 41 GGGAGTGGCTGAGGTGCTTCAAGATGGTGACTGCCCTGCTG GGGAGTGGCTGAGGTGCTTCGAGATGGTGACTGCCCTGCTG Direct Gain NA NA NA 0 0.829814434051514 Functional Gain 0.829814434051514 SLC44A2 ENSG00000129353 CDS Human protein_coding chr19:10742170 chr19:10742170 nonsynonymous SNV 0.843 0 21 hm7G_associated_SNPs_18112 0 24076602 Multiple sclerosis 2e-11 GWAS_Catalog TagSNP rs2288904 GCST005531 Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis.
146 chr19 10913354 10913354 1 + C G rs17265047 10913354 + 10913334 10913374 41 CCTTCAGGACTTCTCAGAGCCTTTAGCGACCAGTGTGCAGC CCTTCAGGACTTCTCAGAGCGTTTAGCGACCAGTGTGCAGC Direct Gain NA NA NA 0 0.512987971305847 Functional Gain 0.512987971305847 DNM2 ENSG00000079805 intronic Human protein_coding chr19:10913354 chr19:10913354 . . 0 21 hm7G_associated_SNPs_18127 0 17463246 Multiple continuous traits in DGI samples 0.0004273 Johnson and O'Donnell TagSNP rs17265047 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
147 chr19 32896716 32896716 1 + C G rs10405382 32896716 + 32896696 32896736 41 CGGTTCTGCCCTCCTTGTACCCGCGGCGCGCTGCGGCCCGT CGGTTCTGCCCTCCTTGTACGCGCGGCGCGCTGCGGCCCGT Direct Gain NA NA NA 0 0.683818221092224 Functional Gain 0.683818221092224 DPY19L3 ENSG00000178904 UTR5 Human protein_coding chr19:32896716 chr19:32896716 . . 0 21 hm7G_associated_SNPs_18398 0 29942085 Depressed affect 7e-11 GWAS_Catalog TagSNP rs10405382 GCST006475 Meta-analysis of genome-wide association studies for neuroticism in 449,484 individuals identifies novel genetic loci and pathways.
148 chr19 39873858 39873858 1 + T G rs140996761 39873858 + 39873838 39873878 41 TCCCACCCAGACTGCCCGGTTCCTGGGCCTGACCTGGAGAT TCCCACCCAGACTGCCCGGTGCCTGGGCCTGACCTGGAGAT Direct Gain NA NA NA 0 0.572316646575928 Functional Gain 0.572316646575928 SAMD4B ENSG00000179134 CDS Human protein_coding chr19:39873858 chr19:39873858 synonymous SNV 0.995 0 21 hm7G_associated_SNPs_18562 0 27989323 Interleukin-16 levels 7e-06 GWAS_Catalog TagSNP rs140996761 GCST004430 Genome-wide Association Study Identifies 27 Loci Influencing Concentrations of Circulating Cytokines and Growth Factors.
149 chr19 41263403 41263403 1 + A G rs2230694 41263403 + 41263383 41263423 41 GGTTTCCCTTTCTATGACAAACCTATGGTGAGCATTGCGGG GGTTTCCCTTTCTATGACAAGCCTATGGTGAGCATTGCGGG Direct Gain NA NA NA 0 0.77788370847702 Functional Gain 0.77788370847702 SNRPA ENSG00000077312 CDS Human protein_coding chr19:41263403 chr19:41263403 synonymous SNV . 0 21 hm7G_associated_SNPs_18595 0 28240269 Blood protein levels 1e-68 GWAS_Catalog TagSNP rs2230694 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
150 chr19 45405062 45405062 1 + A G rs1038026 45405062 + 45405042 45405082 41 AAAAAAAAAGTAGGTAGAGCAGCCAGGCGTGGTGACTCACG AAAAAAAAAGTAGGTAGAGCGGCCAGGCGTGGTGACTCACG Direct Gain NA NA NA 0 0.662520945072174 Functional Gain 0.662520945072174 TOMM40 ENSG00000130204 UTR3 Human protein_coding chr19:45405062 chr19:45405062 . . 0 21 hm7G_associated_SNPs_18707 0 29507422 Low density lipoprotein cholesterol levels 6e-10 GWAS_Catalog TagSNP rs1038026 GCST007141 A large electronic-health-record-based genome-wide study of serum lipids.
151 chr19 49206417 49206417 1 + A G rs492602 49206417 + 49206397 49206437 41 GGGATGTGGACGATCAATGCAATAGGCCGCCTGGGGAACCA GGGATGTGGACGATCAATGCGATAGGCCGCCTGGGGAACCA Direct Gain NA NA NA 0 0.90214478969574 Functional Gain 0.90214478969574 FUT2 ENSG00000176920 CDS Human protein_coding chr19:49206417 chr19:49206417 synonymous SNV . 0 21 hm7G_associated_SNPs_18834 0 20686565 Cholesterol, total 2e-10 GWAS_Catalog TagSNP rs492602 GCST000760 Biological, clinical and population relevance of 95 loci for blood lipids.
152 chr20 4680251 4680251 1 + A G rs1799990 4680251 + 4680231 4680271 41 TGGGGGGCCTTGGCGGCTACATGCTGGGAAGTGCCATGAGC TGGGGGGCCTTGGCGGCTACGTGCTGGGAAGTGCCATGAGC Direct Gain NA NA NA 0 0.68954473733902 Functional Gain 0.68954473733902 PRNP ENSG00000171867 CDS Human protein_coding chr20:4680251 chr20:4680251 nonsynonymous SNV 1.000 1 21 hm7G_associated_SNPs_19333 7 22210626 Prion diseases 7e-07 GWAS_Catalog TagSNP rs1799990 GCST001366 Genome-wide association study in multiple human prion diseases suggests genetic risk factors additional to PRNP.
153 chr20 25206654 25206654 1 + A G rs1044573 25206654 + 25206634 25206674 41 GGCAGAGCTCCCCTTCCTGCAAGAGTCTGGGAGGCGGTGCA GGCAGAGCTCCCCTTCCTGCGAGAGTCTGGGAGGCGGTGCA Direct Gain NA NA NA 0 0.932474076747894 Functional Gain 0.932474076747894 ENTPD6 ENSG00000197586 UTR3 Human protein_coding chr20:25206654 chr20:25206654 . . 0 21 hm7G_associated_SNPs_19401 0 22036096 Allergic rhinitis 1e-06 GWAS_Catalog TagSNP rs1044573 GCST001310 A genome-wide meta-analysis of genetic variants associated with allergic rhinitis and grass sensitization and their interaction with birth order.
154 chr20 36921510 36921510 1 + A G rs4287822 36921510 + 36921490 36921530 41 CGTGCATCCCCCACATATACACAGAAACTCACGGGCGTTAT CGTGCATCCCCCACATATACGCAGAAACTCACGGGCGTTAT Direct Gain NA NA NA 0 0.68604576587677 Functional Gain 0.68604576587677 LOC149684;BPI ENSG00000206249 ncRNA_intronic Human antisense chr20:36921510 chr20:36921510 . . 0 21 hm7G_associated_SNPs_19506 0 29875488 Blood protein levels 2e-51 GWAS_Catalog TagSNP rs4287822 GCST005806 Genomic atlas of the human plasma proteome.
155 chr20 48507912 48507912 1 + A G rs13433386 48507912 + 48507892 48507932 41 TCCTCTGTCTAACGCCCTCCATTTCACGCCCTCCATCTCAC TCCTCTGTCTAACGCCCTCCGTTTCACGCCCTCCATCTCAC Direct Gain NA NA NA 0 0.739065647125244 Functional Gain 0.739065647125244 SLC9A8 ENSG00000197818 UTR3 Human protein_coding chr20:48507912 chr20:48507912 . . 0 21 hm7G_associated_SNPs_19645 0 17554300 Multiple complex diseases 0.000384907 Johnson and O'Donnell TagSNP rs13433386 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
156 chr20 53267111 53267111 1 + C G rs2023454 53267111 + 53267091 53267131 41 ACAGCAAGGGAAATGACGACCAAGAGAAGAAGCTTAAAGTC ACAGCAAGGGAAATGACGACGAAGAGAAGAAGCTTAAAGTC Direct Gain NA NA NA 0 0.724238336086273 Functional Gain 0.724238336086273 DOK5 ENSG00000101134 UTR3 Human protein_coding chr20:53267111 chr20:53267111 . . 0 21 hm7G_associated_SNPs_19655 0 20215924 Functional MRI 5e-07 GWAS_Catalog TagSNP rs2023454 GCST000556 A genome-wide association study of amygdala activation in youths with and without bipolar disorder.
157 chr20 58896715 58896715 1 + A G rs6027506 58896715 + 58896695 58896735 41 ACAATGACTTTGCAATCATAACAAGCAAAATGTTCTAAACA ACAATGACTTTGCAATCATAGCAAGCAAAATGTTCTAAACA Direct Gain NA NA NA 0 0.527512311935425 Functional Gain 0.527512311935425 MIR646HG ENSG00000228340 ncRNA_exonic Human lincRNA chr20:58896715 chr20:58896715 . . 0 21 hm7G_associated_SNPs_19709 0 23028342 Type 1 diabetes nephropathy 5e-06 GWAS_Catalog TagSNP rs6027506 GCST001688 New susceptibility loci associated with kidney disease in type 1 diabetes.
158 chr22 24582041 24582041 1 + A G rs8141797 24582041 + 24582021 24582061 41 CGGCACCAACTTCACATTCAATGGGCGCGGAGAGTACGTGC CGGCACCAACTTCACATTCAGTGGGCGCGGAGAGTACGTGC Direct Gain NA NA NA 0 0.509718894958496 Functional Gain 0.509718894958496 SUSD2 ENSG00000099994 CDS Human protein_coding chr22:24582041 chr22:24582041 nonsynonymous SNV 0.070 0 21 hm7G_associated_SNPs_20246 0 23624525 Amyotrophic lateral sclerosis 2e-09 GWAS_Catalog TagSNP rs8141797 GCST001981 Genome-wide association analyses in Han Chinese identify two new susceptibility loci for amyotrophic lateral sclerosis.
159 chr22 32445946 32445946 1 + A G rs17683011 32445946 + 32445926 32445966 41 TCAGGCTATGTTTTCCACCAATCGTGGGACTGTTGGAGGCT TCAGGCTATGTTTTCCACCAGTCGTGGGACTGTTGGAGGCT Direct Gain NA NA NA 0 0.653006613254547 Functional Gain 0.653006613254547 SLC5A1 ENSG00000100170 CDS Human protein_coding chr22:32445946 chr22:32445946 nonsynonymous SNV 0.999 1 21 hm7G_associated_SNPs_20371 2 29093273 GLP-1 levels in response to oral glucose tolerance test (120 minutes) 4e-08 GWAS_Catalog TagSNP rs17683011 GCST005165 Genetic determinants of circulating GIP and GLP-1 concentrations.
160 chr22 37678551 37678551 1 + A G rs3213556 37678551 + 37678531 37678571 41 TCCTTGCCGGGCCAGCCCGAACAGCAGCTGGGTCGGCAAGC TCCTTGCCGGGCCAGCCCGAGCAGCAGCTGGGTCGGCAAGC Direct Gain NA NA NA 0 0.776308238506317 Functional Gain 0.776308238506317 CYTH4 ENSG00000100055 UTR5 Human protein_coding chr22:37678551 chr22:37678551 . . 0 21 hm7G_associated_SNPs_20412 0 17052657 Parkinson's disease 0.000661504 Johnson and O'Donnell TagSNP rs3213556 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
161 chr22 38328597 38328597 1 + A G rs34834842 38328597 + 38328577 38328617 41 CATCCCTGAGGAGGACATCCATGGAGAGATGGATACCATTG CATCCCTGAGGAGGACATCCGTGGAGAGATGGATACCATTG Direct Gain NA NA NA 0 0.8987797498703 Functional Gain 0.8987797498703 MICALL1 ENSG00000100139 CDS Human protein_coding chr22:38328597 chr22:38328597 nonsynonymous SNV 0.929 0 21 hm7G_associated_SNPs_20456 0 27863252 Platelet distribution width 7e-18 GWAS_Catalog TagSNP rs34834842 GCST004616 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
162 chr22 39477566 39477566 1 + A G rs8177832 39477566 + 39477546 39477586 41 TAAATATTATATATTACTGCACATCATGCTGGGGGAGATTC TAAATATTATATATTACTGCGCATCATGCTGGGGGAGATTC Direct Gain NA NA NA 0 0.637011885643005 Functional Gain 0.637011885643005 APOBEC3G ENSG00000239713 CDS Human protein_coding chr22:39477566 chr22:39477566 nonsynonymous SNV 0.000 0 21 hm7G_associated_SNPs_20481 0 17641165 HIV-1 disease progression 0.031 Johnson and O'Donnell TagSNP rs8177832 . A whole-genome association study of major determinants for host control of HIV-1.
163 chr22 39770597 39770597 1 + A G rs4821888 39770597 + 39770577 39770617 41 GTACCCCCTGCACAGAGTCTACAGAGGGCTGTCCCGGCCAT GTACCCCCTGCACAGAGTCTGCAGAGGGCTGTCCCGGCCAT Direct Gain NA NA NA 0 0.787015557289124 Functional Gain 0.787015557289124 SYNGR1 ENSG00000100321 CDS Human protein_coding chr22:39770597 chr22:39770597 nonsynonymous SNV . 0 21 hm7G_associated_SNPs_20483 0 29942086 Intelligence 4e-08 GWAS_Catalog TagSNP rs4821888 GCST006250 Genome-wide association meta-analysis in 269,867 individuals identifies new genetic and functional links to intelligence.
164 chr22 50655722 50655722 1 + C G rs144505070 50655722 + 50655702 50655742 41 GGCCACGGAAGCCGACGGGGCGGACGGCAGGCAGCGCTCCT GGCCACGGAAGCCGACGGGGGGGACGGCAGGCAGCGCTCCT Direct Gain NA NA NA 0 0.625788390636444 Functional Gain 0.625788390636444 SELENOO ENSG00000073169 CDS Human protein_coding chr22:50655722 chr22:50655722 unknown 0.002 0 21 hm7G_associated_SNPs_20647 0 29559957 Serum uric acid levels 8e-07 GWAS_Catalog TagSNP rs144505070 GCST005557 Heritability and Genome-Wide Association Analyses of Serum Uric Acid in Middle and Old-Aged Chinese Twins.
165 chr1 9305445 9305445 1 + A C rs34603401 9305445 - 9305425 9305465 41 TGTTGATGTTGCGGGCAATGTCTTCATAGGCGAAGGGTGGC TGTTGATGTTGCGGGCAATGGCTTCATAGGCGAAGGGTGGC Direct Gain NA NA NA 0 0.702956557273865 Functional Gain 0.702956557273865 H6PD ENSG00000049239 CDS Human protein_coding chr1:9305445 chr1:9305445 nonsynonymous SNV 0.949 3 21 hm7G_associated_SNPs_54379 0 29875488 Blood protein levels 1e-126 GWAS_Catalog TagSNP rs34603401 GCST005806 Genomic atlas of the human plasma proteome.
166 chr1 11839998 11839998 1 + T C rs4846044 11839998 - 11839978 11840018 41 GCCCCGCTCCTGGGCCCACCACTCCACCAGCCGTGACTGCA GCCCCGCTCCTGGGCCCACCGCTCCACCAGCCGTGACTGCA Direct Gain NA NA NA 0 0.874128758907318 Functional Gain 0.874128758907318 C1orf167 ENSG00000215910 CDS Human protein_coding chr1:11839998 chr1:11839998 nonsynonymous SNV 0.000 0 21 hm7G_associated_SNPs_54412 0 29912962 Diastolic blood pressure x alcohol consumption interaction (2df test) 7e-17 GWAS_Catalog TagSNP rs4846044 GCST006166 Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
167 chr1 23697617 23697617 1 + T C rs638722 23697617 - 23697597 23697637 41 GCAGGCCTGAGGAATAAAAGAAACAGCAAGAAGACAAAGAA GCAGGCCTGAGGAATAAAAGGAACAGCAAGAAGACAAAGAA Direct Gain NA NA NA 0 0.566383302211761 Functional Gain 0.566383302211761 ZNF436-AS1 ENSG00000249087 UTR3 Human antisense chr1:23697617 chr1:23697617 . . 0 21 hm7G_associated_SNPs_54568 0 30643258 Adventurousness 4e-09 GWAS_Catalog TagSNP rs638722 GCST007324 Genome-wide association analyses of risk tolerance and risky behaviors in over 1 million individuals identify hundreds of loci and shared genetic influences.
168 chr1 26146514 26146514 1 + G C rs1127818 26146514 - 26146494 26146534 41 AGAACCTTTCTCACCTCAAGCTCGGGCTCCCGGACTCTCTC AGAACCTTTCTCACCTCAAGGTCGGGCTCCCGGACTCTCTC Direct Gain NA NA NA 0 0.863261103630066 Functional Gain 0.863261103630066 LOC646471 ENSG00000117640;ENSG00000223474 UTR5;UTR3 Human other chr1:26146514 chr1:26146514 . . 0 21 hm7G_associated_SNPs_54599 0 30595370 Red blood cell count 9e-15 GWAS_Catalog TagSNP rs1127818 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
169 chr1 44440769 44440769 1 + G C rs2286241 44440769 - 44440749 44440789 41 CCGGCCTCACCCACGGCCAGCGCGCAGGCCCAGAAGGCCAC CCGGCCTCACCCACGGCCAGGGCGCAGGCCCAGAAGGCCAC Direct Gain NA NA NA 0 0.537203967571259 Functional Gain 0.537203967571259 ATP6V0B ENSG00000117410 CDS Human protein_coding chr1:44440769 chr1:44440769 synonymous SNV . 0 21 hm7G_associated_SNPs_54750 0 29875488 Blood protein levels 3e-38 GWAS_Catalog TagSNP rs2286241 GCST005806 Genomic atlas of the human plasma proteome.
170 chr1 53581670 53581670 1 + A C rs3820201 53581670 - 53581650 53581690 41 GCTTTGGGGAAAAATCCTTTTGTCAACAAAGCAAAGCACAA GCTTTGGGGAAAAATCCTTTGGTCAACAAAGCAAAGCACAA Direct Gain NA NA NA 0 0.81647801399231 Functional Gain 0.81647801399231 SLC1A7 ENSG00000235563 ncRNA_exonic Human antisense chr1:53581670 chr1:53581670 . . 0 21 hm7G_associated_SNPs_54808 0 22745009 Hippocampal atrophy 1e-06 GWAS_Catalog TagSNP rs3820201 GCST001530 Multiple loci influencing hippocampal degeneration identified by genome scan.
171 chr1 154988957 154988957 1 + A C rs2242195 154988957 - 154988937 154988977 41 GCAGCAGCGGTAGAGGGTGGTGGGTAGTGGGGTGGTGCATC GCAGCAGCGGTAGAGGGTGGGGGGTAGTGGGGTGGTGCATC Direct Gain NA NA NA 0 0.746543407440186 Functional Gain 0.746543407440186 ZBTB7B ENSG00000160685 CDS Human protein_coding chr1:154988957 chr1:154988957 synonymous SNV . 0 21 hm7G_associated_SNPs_55142 0 30595370 Body mass index 1e-08 GWAS_Catalog TagSNP rs2242195 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
172 chr1 176812620 176812620 1 + T C rs2294494 176812620 - 176812600 176812640 41 GTTGACTGGCTGACAGCCACACTTGGAACAGGCATGTGTGG GTTGACTGGCTGACAGCCACGCTTGGAACAGGCATGTGTGG Direct Gain NA NA NA 0 0.766419649124146 Functional Gain 0.766419649124146 PAPPA2 ENSG00000116183 UTR3 Human protein_coding chr1:176812620 chr1:176812620 . . 0 21 hm7G_associated_SNPs_55291 0 17554300 Multiple complex diseases 0.000779398 Johnson and O'Donnell TagSNP rs2294494 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
173 chr1 207262791 207262791 1 + A C rs79737422 207262791 - 207262771 207262811 41 ATAGATCTTCTAACACTGCTTAAGACCAACCTAACCACCTC ATAGATCTTCTAACACTGCTGAAGACCAACCTAACCACCTC Direct Gain NA NA NA 0 0.532511293888092 Functional Gain 0.532511293888092 C4BPB ENSG00000123843 UTR5 Human protein_coding chr1:207262791 chr1:207262791 . . 0 21 hm7G_associated_SNPs_55484 0 28552196 Hip circumference 4e-06 GWAS_Catalog TagSNP rs79737422 GCST008162 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
174 chr1 221053545 221053545 1 + T C rs12141189 221053545 - 221053525 221053565 41 ATGGTGGTGGTAGGCGGCTGAGAGCGGAGACAGCCGCTGCG ATGGTGGTGGTAGGCGGCTGGGAGCGGAGACAGCCGCTGCG Direct Gain NA NA NA 0 0.697762072086334 Functional Gain 0.697762072086334 HLX ENSG00000136630 CDS Human protein_coding chr1:221053545 chr1:221053545 nonsynonymous SNV 0.980 0 21 hm7G_associated_SNPs_55535 0 30595370 Lung function (FVC) 4e-12 GWAS_Catalog TagSNP rs12141189 GCST007081 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
175 chr2 26915624 26915624 1 + G C rs12476527 26915624 - 26915604 26915644 41 GCGCTCGCCGCTCTCCGCGCCGGGCACCCGCTCAGCGCCCG GCGCTCGCCGCTCTCCGCGCGGGGCACCCGCTCAGCGCCCG Direct Gain NA NA NA 0 0.591322720050812 Functional Gain 0.591322720050812 KCNK3 ENSG00000171303 UTR5 Human protein_coding chr2:26915624 chr2:26915624 . . 0 21 hm7G_associated_SNPs_55786 0 29531354 Stroke 6e-08 GWAS_Catalog TagSNP rs12476527 GCST005838 Multiancestry genome-wide association study of 520,000 subjects identifies 32 loci associated with stroke and stroke subtypes.
176 chr2 27730940 27730940 1 + T C rs1260326 27730940 - 27730920 27730960 41 GTCACGGCTGGACTCTCACCAGCAAGGTCTGACCCACGGTG GTCACGGCTGGACTCTCACCGGCAAGGTCTGACCCACGGTG Direct Gain NA NA NA 0 0.532787442207336 Functional Gain 0.532787442207336 GCKR ENSG00000084734 CDS Human protein_coding chr2:27730940 chr2:27730940 nonsynonymous SNV 0.412 0 21 hm7G_associated_SNPs_55805 1 21943158 Cardiovascular disease risk factors 2e-08 GWAS_Catalog TagSNP rs1260326 GCST001247 Genetic variants in LPL, OASL and TOMM40/APOE-C1-C2-C4 genes are associated with multiple cardiovascular-related traits.
177 chr2 44502788 44502788 1 + A C rs3738985 44502788 - 44502768 44502808 41 TTCAGGTTGTCTGTTGAGCTTCCTGGATCCGGGGTCTGCTC TTCAGGTTGTCTGTTGAGCTGCCTGGATCCGGGGTCTGCTC Direct Gain NA NA NA 0 0.90426778793335 Functional Gain 0.90426778793335 SLC3A1 ENSG00000138079 CDS Human protein_coding chr2:44502788 chr2:44502788 synonymous SNV . 0 21 hm7G_associated_SNPs_55874 1 17998437 Alzheimer's disease 0.000369 Johnson and O'Donnell TagSNP rs3738985 . Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.
178 chr2 48822540 48822540 1 + T C rs7574549 48822540 - 48822520 48822560 41 AGACCTGTCCTAAAACCGCTATTCAGAAGTCATTTCCACTC AGACCTGTCCTAAAACCGCTGTTCAGAAGTCATTTCCACTC Direct Gain NA NA NA 0 0.660600960254669 Functional Gain 0.660600960254669 STON1 ENSG00000243244 UTR3 Human protein_coding chr2:48822540 chr2:48822540 . . 0 21 hm7G_associated_SNPs_55902 0 27846281 Hepcidin/ferritin ratio 5e-06 GWAS_Catalog TagSNP rs7574549 GCST003944 Meta-GWAS and Meta-Analysis of Exome Array Studies Do Not Reveal Genetic Determinants of Serum Hepcidin.
179 chr2 177053426 177053426 1 + A C rs150457564 177053426 - 177053406 177053446 41 GCGCCGCTCCGCCAGCCCTCTCTACCCGAGCTGCCCTCTCC GCGCCGCTCCGCCAGCCCTCGCTACCCGAGCTGCCCTCTCC Direct Gain NA NA NA 0 0.798790812492371 Functional Gain 0.798790812492371 HAGLR ENSG00000224189 ncRNA_intronic Human antisense chr2:177053426 chr2:177053426 . . 0 21 hm7G_associated_SNPs_56326 0 31015462 Estimated glomerular filtration rate 1e-14 GWAS_Catalog TagSNP rs150457564 GCST007876 Sex-specific and pleiotropic effects underlying kidney function identified from GWAS meta-analysis.
180 chr3 10885920 10885920 1 + T C rs2304725 10885920 - 10885900 10885940 41 CCGATGTGCTCGATCCCGTCAGAGATGGCCAGGACCCGGTG CCGATGTGCTCGATCCCGTCGGAGATGGCCAGGACCCGGTG Direct Gain NA NA NA 0 0.68315863609314 Functional Gain 0.68315863609314 SLC6A11 ENSG00000132164 CDS Human protein_coding chr3:10885920 chr3:10885920 synonymous SNV . 0 21 hm7G_associated_SNPs_56685 0 25221879 Pulmonary function in asthmatics 3e-06 GWAS_Catalog TagSNP rs2304725 GCST002608 Genome-wide interrogation of longitudinal FEV1 in children with asthma.
181 chr3 12848822 12848822 1 + T C rs11718898 12848822 - 12848802 12848842 41 CCTGGTACTCCTTCACTTTGACCACCAGAGGACCCAGGCTG CCTGGTACTCCTTCACTTTGGCCACCAGAGGACCCAGGCTG Direct Gain NA NA NA 0 0.500435888767242 Functional Gain 0.500435888767242 CAND2 ENSG00000144712 CDS Human protein_coding chr3:12848822 chr3:12848822 nonsynonymous SNV 0.995 0 21 hm7G_associated_SNPs_56695 0 30595370 Waist-hip ratio 2e-15 GWAS_Catalog TagSNP rs11718898 GCST007067 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
182 chr3 49706736 49706736 1 + G C rs56176327 49706736 - 49706716 49706756 41 GATTCCTTTTTACCTGCTGTCCTGGACAGAGAAAACTGCAG GATTCCTTTTTACCTGCTGTGCTGGACAGAGAAAACTGCAG Direct Gain NA NA NA 0 0.883108019828796 Functional Gain 0.883108019828796 BSN ENSG00000164061 UTR3 Human protein_coding chr3:49706736 chr3:49706736 . . 0 21 hm7G_associated_SNPs_56859 0 29326435 Intelligence (MTAG) 2e-09 GWAS_Catalog TagSNP rs56176327 GCST005316 A combined analysis of genetically correlated traits identifies 187 loci and a role for neurogenesis and myelination in intelligence.
183 chr3 153839866 153839866 1 + G C rs12493885 153839866 - 153839846 153839886 41 CGGCTTGCTCCGGCCCAGAACCTGGTGGGGCTGAGGAATCG CGGCTTGCTCCGGCCCAGAAGCTGGTGGGGCTGAGGAATCG Direct Gain NA NA NA 0 0.757427632808685 Functional Gain 0.757427632808685 ARHGEF26 ENSG00000114790 CDS Human protein_coding chr3:153839866 chr3:153839866 nonsynonymous SNV 0.966 0 21 hm7G_associated_SNPs_57177 0 28714975 Coronary artery disease (myocardial infarction, percutaneous transluminal coronary angioplasty, coronary artery bypass grafting, angina or chromic ischemic heart disease) 3e-08 GWAS_Catalog TagSNP rs12493885 GCST004787 Association analyses based on false discovery rate implicate new loci for coronary artery disease.
184 chr4 90757840 90757840 1 + T C rs2245801 90757840 - 90757820 90757860 41 GAAATCCTGGAGAACGCCGGATGGGAGACGAATGGTCGTGG GAAATCCTGGAGAACGCCGGGTGGGAGACGAATGGTCGTGG Direct Gain NA NA NA 0 0.708130955696106 Functional Gain 0.708130955696106 SNCA-AS1 ENSG00000247775 ncRNA_exonic Human antisense chr4:90757840 chr4:90757840 . . 0 21 hm7G_associated_SNPs_57726 0 29875488 Blood protein levels 1e-16 GWAS_Catalog TagSNP rs2245801 GCST005806 Genomic atlas of the human plasma proteome.
185 chr4 187122355 187122355 1 + T C rs3736456 187122355 - 187122335 187122375 41 GAGCCCCTGCCATCACCTCTACAGTCTTCATTGGCGTTCAT GAGCCCCTGCCATCACCTCTGCAGTCTTCATTGGCGTTCAT Direct Gain NA NA NA 0 0.697663068771362 Functional Gain 0.697663068771362 CYP4V2 ENSG00000145476 CDS Human protein_coding chr4:187122355 chr4:187122355 synonymous SNV . 0 21 hm7G_associated_SNPs_57920 3 17486107 Bipolar disorder 0.0048 Johnson and O'Donnell TagSNP rs3736456 . A genome-wide association study implicates diacylglycerol kinase eta (DGKH) and several other genes in the etiology of bipolar disorder.
186 chr5 59825300 59825300 1 + T C rs26949 59825300 - 59825280 59825320 41 TTCTTTCATTCTTTTATACCATCTCAGAGGGCTGTAACAAT TTCTTTCATTCTTTTATACCGTCTCAGAGGGCTGTAACAAT Direct Gain NA NA NA 0 0.735659778118134 Functional Gain 0.735659778118134 PART1 ENSG00000152931 ncRNA_exonic Human lincRNA chr5:59825300 chr5:59825300 . . 0 21 hm7G_associated_SNPs_58069 0 29326435 Intelligence (MTAG) 6e-09 GWAS_Catalog TagSNP rs26949 GCST005316 A combined analysis of genetically correlated traits identifies 187 loci and a role for neurogenesis and myelination in intelligence.
187 chr5 74656539 74656539 1 + T C rs12916 74656539 - 74656519 74656559 41 ATCCATTTTCAACTGGCAGGAGTGAGGGAGAAGGTCAATTG ATCCATTTTCAACTGGCAGGGGTGAGGGAGAAGGTCAATTG Direct Gain NA NA NA 0 0.896973252296448 Functional Gain 0.896973252296448 HMGCR ENSG00000113161 UTR3 Human protein_coding chr5:74656539 chr5:74656539 . . 0 21 hm7G_associated_SNPs_58112 0 20686565 LDL cholesterol 5e-45 GWAS_Catalog TagSNP rs12916 GCST000759 Biological, clinical and population relevance of 95 loci for blood lipids.
188 chr5 140801104 140801104 1 + T C rs11167744 140801104 - 140801084 140801124 41 GAGAAGTTCCATATTTAAAAAACAGGAGGACACCGTCTCAC GAGAAGTTCCATATTTAAAAGACAGGAGGACACCGTCTCAC Direct Gain NA NA NA 0 0.645705580711365 Functional Gain 0.645705580711365 PCDHGA11 ENSG00000253873 CDS Human protein_coding chr5:140801104 chr5:140801104 nonsynonymous SNV 0.975 0 21 hm7G_associated_SNPs_58400 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.0002476 Johnson and O'Donnell TagSNP rs11167744 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
189 chr5 176815124 176815124 1 + T C rs5030873 176815124 - 176815104 176815144 41 TCAGGAGCATCACGGCCACCATGGATGTTGAAGGAGGCCAC TCAGGAGCATCACGGCCACCGTGGATGTTGAAGGAGGCCAC Direct Gain NA NA NA 0 0.545165002346039 Functional Gain 0.545165002346039 SLC34A1 ENSG00000131183 CDS Human protein_coding chr5:176815124 chr5:176815124 synonymous SNV . 0 21 hm7G_associated_SNPs_58591 1 31015462 Creatinine levels 1e-20 GWAS_Catalog TagSNP rs5030873 GCST007877 Sex-specific and pleiotropic effects underlying kidney function identified from GWAS meta-analysis.
190 chr5 180661980 180661980 1 + T C rs17714046 180661980 - 180661960 180662000 41 CAGACCTGTTGGACAGACATAGTAGGTGAGAGAAGGCTGAG CAGACCTGTTGGACAGACATGGTAGGTGAGAGAAGGCTGAG Direct Gain NA NA NA 0 0.825798511505127 Functional Gain 0.825798511505127 TRIM41 ENSG00000146063 CDS Human protein_coding chr5:180661980 chr5:180661980 nonsynonymous SNV 0.604 0 21 hm7G_associated_SNPs_58635 0 30595370 Hair color 1e-10 GWAS_Catalog TagSNP rs17714046 GCST007082 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
191 chr6 10528794 10528794 1 + T C rs560194 10528794 - 10528774 10528814 41 CCTGTTCCCACCATGAAATTACAAGTGGGTGAGGTGACCAT CCTGTTCCCACCATGAAATTGCAAGTGGGTGAGGTGACCAT Direct Gain NA NA NA 0 0.643854081630707 Functional Gain 0.643854081630707 GCNT2 ENSG00000111846 UTR5 Human protein_coding chr6:10528794 chr6:10528794 . . 0 21 hm7G_associated_SNPs_58707 0 17052657 Parkinson's disease 0.000305453 Johnson and O'Donnell TagSNP rs560194 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
192 chr6 10723449 10723449 1 + A C rs1045911 10723449 - 10723429 10723469 41 TCACGAAGGCCCCGGCTGTCTACAAGGGCGCGCAAGCCGCA TCACGAAGGCCCCGGCTGTCGACAAGGGCGCGCAAGCCGCA Direct Gain NA NA NA 0 0.941993772983551 Functional Gain 0.941993772983551 TMEM14C ENSG00000111843 UTR5 Human protein_coding chr6:10723449 chr6:10723449 . . 0 21 hm7G_associated_SNPs_58710 0 30595370 Mean corpuscular hemoglobin 9e-10 GWAS_Catalog TagSNP rs1045911 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
193 chr6 28060239 28060239 1 + T C rs13197574 28060239 - 28060219 28060259 41 TTTATTCCCTTTGAGATTTAATAGTCAAGGCTGCAGCTGTT TTTATTCCCTTTGAGATTTAGTAGTCAAGGCTGCAGCTGTT Direct Gain NA NA NA 0 0.517134070396423 Functional Gain 0.517134070396423 ZSCAN12P1 ENSG00000219891 ncRNA_exonic Human transcribed_unprocessed_pseudogene chr6:28060239 chr6:28060239 . . 0 21 hm7G_associated_SNPs_58798 0 26651848 Sarcoidosis (Lofgren's syndrome vs non-Lofgren's syndrome) 3e-17 GWAS_Catalog TagSNP rs13197574 GCST005541 High-Density Genetic Mapping Identifies New Susceptibility Variants in Sarcoidosis Phenotypes and Shows Genomic-driven Phenotypic Differences.
194 chr6 29911228 29911228 1 + A C rs9256983 29911228 - 29911208 29911248 41 AGGCTCTCAACTGCTCCGCCTCATGGGCCGCCTCCCACTTG AGGCTCTCAACTGCTCCGCCGCATGGGCCGCCTCCCACTTG Direct Gain NA NA NA 0 0.801456451416016 Functional Gain 0.801456451416016 HLA-A ENSG00000206503 CDS Human protein_coding chr6:29911228 chr6:29911228 nonsynonymous SNV 0.000 0 21 hm7G_associated_SNPs_58848 0 28928442 Pneumonia 5e-06 GWAS_Catalog TagSNP rs9256983 GCST005009 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
195 chr6 30116160 30116160 1 + G C rs1573298 30116160 - 30116140 30116180 41 CACCTTTGCCTTATTCCATTCATTAGAAGCAAGTCACAGAT CACCTTTGCCTTATTCCATTGATTAGAAGCAAGTCACAGAT Direct Gain NA NA NA 0 0.895835876464844 Functional Gain 0.895835876464844 TRIM40 ENSG00000204614 UTR3 Human protein_coding chr6:30116160 chr6:30116160 . . 0 21 hm7G_associated_SNPs_58856 0 17554300 Multiple complex diseases 5.46e-12 Johnson and O'Donnell TagSNP rs1573298 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
196 chr6 30313340 30313340 1 + G C rs6986 30313340 - 30313320 30313360 41 GAGCACTCACGTCTCTGGCGCTGGGTGCAGGTGAGGCCCGG GAGCACTCACGTCTCTGGCGGTGGGTGCAGGTGAGGCCCGG Direct Gain NA NA NA 0 0.731249749660492 Functional Gain 0.731249749660492 RPP21;TRIM39-RPP21 ENSG00000241370;ENSG00000248167 CDS Human other chr6:30313340 chr6:30313340 nonsynonymous SNV 1.000 2 21 hm7G_associated_SNPs_58859 0 29255261 Neuroticism 8e-09 GWAS_Catalog TagSNP rs6986 GCST005232 Association analysis in over 329,000 individuals identifies 116 independent variants influencing neuroticism.
197 chr6 30921882 30921882 1 + T C rs3757340 30921882 - 30921862 30921902 41 AATAAGGTGAAATGGCCATAAGAAGAGAGAGAGAAAATCCA AATAAGGTGAAATGGCCATAGGAAGAGAGAGAGAAAATCCA Direct Gain NA NA NA 0 0.916652381420135 Functional Gain 0.916652381420135 HCG21 ENSG00000233529 ncRNA_intronic Human antisense chr6:30921882 chr6:30921882 . . 0 21 hm7G_associated_SNPs_58882 0 17554300 Multiple complex diseases 6.33e-06 Johnson and O'Donnell TagSNP rs3757340 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
198 chr6 43412865 43412865 1 + T C rs2125739 43412865 - 43412845 43412885 41 TGGGCAGTGGGAACACTGGGATGCTGGGTGGTGAGGAGGGG TGGGCAGTGGGAACACTGGGGTGCTGGGTGGTGAGGAGGGG Direct Gain NA NA NA 0 0.793364882469177 Functional Gain 0.793364882469177 ABCC10 ENSG00000124574 CDS Human protein_coding chr6:43412865 chr6:43412865 nonsynonymous SNV 0.993 1 21 hm7G_associated_SNPs_59131 0 30072576 Blood protein levels 8e-08 GWAS_Catalog TagSNP rs2125739 GCST006585 Co-regulatory networks of human serum proteins link genetics to disease.
199 chr6 50683009 50683009 1 + T C rs78648104 50683009 - 50682989 50683029 41 GTGCTGAAACTCGTAATGGAAGGACTGGTGGTGGAGCGGGG GTGCTGAAACTCGTAATGGAGGGACTGGTGGTGGAGCGGGG Direct Gain NA NA NA 0 0.63868659734726 Functional Gain 0.63868659734726 TFAP2D ENSG00000008197 CDS Human protein_coding chr6:50683009 chr6:50683009 nonsynonymous SNV 1.000 1 21 hm7G_associated_SNPs_59164 0 28135244 Systolic blood pressure 1e-08 GWAS_Catalog TagSNP rs78648104 GCST004279 Genome-wide association analysis identifies novel blood pressure loci and offers biological insights into cardiovascular risk.
200 chr6 117996631 117996631 1 + T C rs80196932 117996631 - 117996611 117996651 41 AGCCCCGCCCCCAGTAGTACATGGACAGTTCCGATTGGCCA AGCCCCGCCCCCAGTAGTACGTGGACAGTTCCGATTGGCCA Direct Gain NA NA NA 0 0.533590614795685 Functional Gain 0.533590614795685 NUS1 ENSG00000153989 upstream Human protein_coding chr6:117996631 chr6:117996631 . . 0 21 hm7G_associated_SNPs_59291 0 30718926 Type 2 diabetes 8e-12 GWAS_Catalog TagSNP rs80196932 GCST007847 Identification of 28 new susceptibility loci for type 2 diabetes in the Japanese population.
201 chr6 158480144 158480144 1 + A C rs1750034 158480144 - 158480124 158480164 41 GCTGTCCCCCATGACCCAAATCGTGGAAAATGAGCCTGGGT GCTGTCCCCCATGACCCAAAGCGTGGAAAATGAGCCTGGGT Direct Gain NA NA NA 0 0.940717101097107 Functional Gain 0.940717101097107 SYNJ2 ENSG00000078269 intronic Human protein_coding chr6:158480144 chr6:158480144 . . 0 21 hm7G_associated_SNPs_59422 0 28881265 Endometriosis 7e-07 GWAS_Catalog TagSNP rs1750034 GCST004873 New variants near RHOJ and C2, HLA-DRA region and susceptibility to endometriosis in the Polish population-The genome-wide association study.
202 chr7 18706703 18706703 1 + T C rs17348528 18706703 - 18706683 18706723 41 CTGTATTCCTAATATGTTCAATTGCAACCTACACAATAACC CTGTATTCCTAATATGTTCAGTTGCAACCTACACAATAACC Direct Gain NA NA NA 0 0.50249856710434 Functional Gain 0.50249856710434 HDAC9 ENSG00000048052 UTR3 Human protein_coding chr7:18706703 chr7:18706703 . . 0 21 hm7G_associated_SNPs_59606 0 30595370 Balding type 1 2e-17 GWAS_Catalog TagSNP rs17348528 GCST007038 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
203 chr7 65617595 65617595 1 + T C rs875971 65617595 - 65617575 65617615 41 GTGGAGGAAATCTTTCAAGCACAGAGGGGTCCGCGGTCACT GTGGAGGAAATCTTTCAAGCGCAGAGGGGTCCGCGGTCACT Direct Gain NA NA NA 0 0.798400580883026 Functional Gain 0.798400580883026 CRCP ENSG00000234185 ncRNA_intronic Human antisense chr7:65617595 chr7:65617595 . . 0 21 hm7G_associated_SNPs_59785 0 21223598 Aortic root size 4e-06 GWAS_Catalog TagSNP rs875971 GCST000943 Genome-wide joint SNP and CNV analysis of aortic root diameter in African Americans: the HyperGEN study.
204 chr7 99971834 99971834 1 + A C rs1859788 99971834 - 99971814 99971854 41 TGTGCTGTAGAAGGACTGCCTGTGGAAGTGGCCCCGTCTCC TGTGCTGTAGAAGGACTGCCGGTGGAAGTGGCCCCGTCTCC Direct Gain NA NA NA 0 0.815887808799744 Functional Gain 0.815887808799744 PILRA ENSG00000085514 CDS Human protein_coding chr7:99971834 chr7:99971834 synonymous SNV . 0 21 hm7G_associated_SNPs_59916 0 29777097 Family history of Alzheimer's disease 2e-10 GWAS_Catalog TagSNP rs1859788 GCST005921 GWAS on family history of Alzheimer's disease.
205 chr7 105671267 105671267 1 + T C rs10270308 105671267 - 105671247 105671287 41 CCTGGATCTATGGCTTCTCCATCAAAGATAGTGTTCATCTG CCTGGATCTATGGCTTCTCCGTCAAAGATAGTGTTCATCTG Direct Gain NA NA NA 0 0.732094645500183 Functional Gain 0.732094645500183 CDHR3 ENSG00000128536 CDS Human protein_coding chr7:105671267 chr7:105671267 synonymous SNV . 0 21 hm7G_associated_SNPs_60013 0 20833655 Warfarin maintenance dose 6e-06 GWAS_Catalog TagSNP rs10270308 GCST000792 Genome-wide association study identifies genetic determinants of warfarin responsiveness for Japanese.
206 chr7 141491066 141491066 1 + G C rs2234017 141491066 - 141491046 141491086 41 TCCTGACCACACTTTTCTTCCCAGATCATGGGCCCCAGCAT TCCTGACCACACTTTTCTTCGCAGATCATGGGCCCCAGCAT Direct Gain NA NA NA 0 0.831051111221313 Functional Gain 0.831051111221313 TAS2R5 ENSG00000127366 UTR3 Human protein_coding chr7:141491066 chr7:141491066 . . 0 21 hm7G_associated_SNPs_60144 0 27770636 Late-onset Alzheimer's disease 7e-06 GWAS_Catalog TagSNP rs2234017 GCST003815 Two novel loci, COBL and SLC10A2, for Alzheimer's disease in African Americans.
207 chr8 17500223 17500223 1 + T C rs4705 17500223 - 17500203 17500243 41 TATCCTGCATCAATCGTCTCAAAGTCTTCCACTGTAATGAC TATCCTGCATCAATCGTCTCGAAGTCTTCCACTGTAATGAC Direct Gain NA NA NA 0 0.561039805412292 Functional Gain 0.561039805412292 PDGFRL ENSG00000104213 CDS Human protein_coding chr8:17500223 chr8:17500223 synonymous SNV . 0 21 hm7G_associated_SNPs_60424 0 26528553 Gut microbiome composition (summer) 4e-06 GWAS_Catalog TagSNP rs4705 GCST003221 Genome-Wide Association Studies of the Human Gut Microbiota.
208 chr8 22462852 22462852 1 + T C rs11778693 22462852 - 22462832 22462872 41 CTGGCGGGGTGAGGGGCTCGAGAGAGCCCCGATGACATTCC CTGGCGGGGTGAGGGGCTCGGGAGAGCCCCGATGACATTCC Direct Gain NA NA NA 0 0.590692758560181 Functional Gain 0.590692758560181 CCAR2 ENSG00000158941 UTR5 Human protein_coding chr8:22462852 chr8:22462852 . . 0 21 hm7G_associated_SNPs_60467 0 26242244 Exploratory eye movement dysfunction in schizophrenia (cognitive search score) 4e-06 GWAS_Catalog TagSNP rs11778693 GCST003064 Association of chromosome 5q21.3 polymorphisms with the exploratory eye movement dysfunction in schizophrenia.
209 chr8 67579795 67579795 1 + T C rs7840192 67579795 - 67579775 67579815 41 CCTAAGGAGGAAGTGCAGCTAGACGCACCGCACGGCATCCT CCTAAGGAGGAAGTGCAGCTGGACGCACCGCACGGCATCCT Direct Gain NA NA NA 0 0.722861647605896 Functional Gain 0.722861647605896 C8orf44;C8orf44-SGK3 ENSG00000175073;ENSG00000213865;ENSG00000270024 upstream Human other chr8:67579795 chr8:67579795 . . 0 21 hm7G_associated_SNPs_60599 0 17463246 Multiple continuous traits in DGI samples 0.00078 Johnson and O'Donnell TagSNP rs7840192 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
210 chr8 123986649 123986649 1 + A C rs2833 123986649 - 123986629 123986669 41 CTAGCGTTTGACTTGTGCGGTGTACTCAAATGGGGGGCAGT CTAGCGTTTGACTTGTGCGGGGTACTCAAATGGGGGGCAGT Direct Gain NA NA NA 0 0.556592047214508 Functional Gain 0.556592047214508 ZHX2 ENSG00000178764 UTR3 Human protein_coding chr8:123986649 chr8:123986649 . . 0 21 hm7G_associated_SNPs_60697 0 17052657 Parkinson's disease 0.000201545 Johnson and O'Donnell TagSNP rs2833 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
211 chr8 133023163 133023163 1 + G C rs4736529 133023163 - 133023143 133023183 41 TTAGGCTTTACAAATCATATCCTGAGGTCTTCATGCGCCGA TTAGGCTTTACAAATCATATGCTGAGGTCTTCATGCGCCGA Direct Gain NA NA NA 0 0.659410119056702 Functional Gain 0.659410119056702 EFR3A ENSG00000132294 UTR3 Human protein_coding chr8:133023163 chr8:133023163 . . 0 21 hm7G_associated_SNPs_60717 0 17634449 Coronary Artery Disease 0.000597 Johnson and O'Donnell TagSNP rs4736529 . Genomewide association analysis of coronary artery disease.
212 chr8 144682311 144682311 1 + G C rs3210186 144682311 - 144682291 144682331 41 GCAGGGGCGGAGGCCCAGCCCCACGGGGGCCAGAGCAGGAA GCAGGGGCGGAGGCCCAGCCGCACGGGGGCCAGAGCAGGAA Direct Gain NA NA NA 0 0.952024579048157 Functional Gain 0.952024579048157 TIGD5 ENSG00000179886 UTR3 Human protein_coding chr8:144682311 chr8:144682311 . . 0 21 hm7G_associated_SNPs_60753 0 28957414 Red cell distribution width 1e-13 GWAS_Catalog TagSNP rs3210186 GCST006804 Red blood cell distribution width: Genetic evidence for aging pathways in 116,666 volunteers.
213 chr9 22029547 22029547 1 + T C rs564398 22029547 - 22029527 22029567 41 CATACCACACCCTAACTACCACAAAGAAAGTCATGGGGGCC CATACCACACCCTAACTACCGCAAAGAAAGTCATGGGGGCC Direct Gain NA NA NA 0 0.785473346710205 Functional Gain 0.785473346710205 CDKN2B-AS1 ENSG00000240498 ncRNA_exonic Human antisense chr9:22029547 chr9:22029547 . . 0 21 hm7G_associated_SNPs_60871 0 17463249 Type 2 diabetes 1e-06 GWAS_Catalog TagSNP rs564398 GCST000025 Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes.
214 chr9 102861613 102861613 1 + T C rs7024375 102861613 - 102861593 102861633 41 CCCTCCTGCCGGGCCGGTACACTATATCCAGCCAGGTCAGA CCCTCCTGCCGGGCCGGTACGCTATATCCAGCCAGGTCAGA Direct Gain NA NA NA 0 0.630227327346802 Functional Gain 0.630227327346802 INVS ENSG00000119509 UTR5 Human protein_coding chr9:102861613 chr9:102861613 . . 0 21 hm7G_associated_SNPs_61079 0 28928442 Chickenpox 4e-06 GWAS_Catalog TagSNP rs7024375 GCST004999 Genome-wide association and HLA region fine-mapping studies identify susceptibility loci for multiple common infections.
215 chr9 136328657 136328657 1 + T C rs3124765 136328657 - 136328637 136328677 41 ATCATCCACACGCCGGCCGCAATGTTCAGAGGGTGGATGGT ATCATCCACACGCCGGCCGCGATGTTCAGAGGGTGGATGGT Direct Gain NA NA NA 0 0.748167872428894 Functional Gain 0.748167872428894 CACFD1 ENSG00000160325 CDS Human protein_coding chr9:136328657 chr9:136328657 synonymous SNV . 0 21 hm7G_associated_SNPs_61299 0 29059683 Breast cancer 2e-06 GWAS_Catalog TagSNP rs3124765 GCST004988 Association analysis identifies 65 new breast cancer risk loci.
216 chr10 64564892 64564892 1 + G C rs2236295 64564892 - 64564872 64564912 41 GGAAGCGCCGCGGCCGCCCCCGCTGCCCCGGAAGGTGAGGC GGAAGCGCCGCGGCCGCCCCGGCTGCCCCGGAAGGTGAGGC Direct Gain NA NA NA 0 0.606875419616699 Functional Gain 0.606875419616699 ADO ENSG00000181915 CDS Human protein_coding chr10:64564892 chr10:64564892 nonsynonymous SNV 0.998 0 21 hm7G_associated_SNPs_61607 0 28437668 Venlafaxine response in generalised anxiety disorder (remitters vs non-remitters after 12 weeks) 5e-06 GWAS_Catalog TagSNP rs2236295 GCST004274 Genome-wide association study of treatment response to venlafaxine XR in generalized anxiety disorder.
217 chr10 64566572 64566572 1 + T C rs10995312 64566572 - 64566552 64566592 41 TAAATATAGGGAATGCAACAACTGGCTAGGAGTGTTTTACA TAAATATAGGGAATGCAACAGCTGGCTAGGAGTGTTTTACA Direct Gain NA NA NA 0 0.591570794582367 Functional Gain 0.591570794582367 ADO ENSG00000181915 UTR3 Human protein_coding chr10:64566572 chr10:64566572 . . 0 21 hm7G_associated_SNPs_61608 0 17554300 Multiple complex diseases 0.000231302 Johnson and O'Donnell TagSNP rs10995312 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
218 chr10 71392692 71392692 1 + T C rs1052152 71392692 - 71392672 71392712 41 GGCTCCACAGCATGGTTGCCAAGATGCCACTGCGGAAAGCC GGCTCCACAGCATGGTTGCCGAGATGCCACTGCGGAAAGCC Direct Gain NA NA NA 0 0.917592346668243 Functional Gain 0.917592346668243 C10orf35 ENSG00000171224 CDS Human protein_coding chr10:71392692 chr10:71392692 synonymous SNV . 0 21 hm7G_associated_SNPs_61634 0 17554300 Multiple complex diseases 0.000247322 Johnson and O'Donnell TagSNP rs1052152 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
219 chr10 73121945 73121945 1 + T C rs1084004 73121945 - 73121925 73121965 41 GTGGTCCACAGTGAGCCCGAACCCTTGTTGAGGGACTCGAT GTGGTCCACAGTGAGCCCGAGCCCTTGTTGAGGGACTCGAT Direct Gain NA NA NA 0 0.593482971191406 Functional Gain 0.593482971191406 SLC29A3 ENSG00000198246 CDS Human protein_coding chr10:73121945 chr10:73121945 synonymous SNV . 0 21 hm7G_associated_SNPs_61654 2 23251661 Obesity-related traits 8e-07 GWAS_Catalog TagSNP rs1084004 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
220 chr10 101287944 101287944 1 + A C rs11190137 101287944 - 101287924 101287964 41 GCTGATTTTTAGTAGTGGGGTAACAGAGAAAGAAATGTGGT GCTGATTTTTAGTAGTGGGGGAACAGAGAAAGAAATGTGGT Direct Gain NA NA NA 0 0.856942534446716 Functional Gain 0.856942534446716 LINC01475 ENSG00000228778 ncRNA_exonic Human lincRNA chr10:101287944 chr10:101287944 . . 0 21 hm7G_associated_SNPs_61806 0 17554300 Multiple complex diseases 0.000290287 Johnson and O'Donnell TagSNP rs11190137 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
221 chr10 115805056 115805056 1 + G C rs1801253 115805056 - 115805036 115805076 41 GCGCGCGCAGCAGAGCAGTCCCTGGAAGGCCTTGCGGAAGT GCGCGCGCAGCAGAGCAGTCGCTGGAAGGCCTTGCGGAAGT Direct Gain NA NA NA 0 0.796207129955292 Functional Gain 0.796207129955292 ADRB1 ENSG00000043591 CDS Human protein_coding chr10:115805056 chr10:115805056 nonsynonymous SNV 0.989 0 21 hm7G_associated_SNPs_61892 1 27618447 Systolic blood pressure 1e-10 GWAS_Catalog TagSNP rs1801253 GCST006021 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
222 chr11 308314 308314 1 + T C rs14408 308314 - 308294 308334 41 GGATGTGGATCACGGTGGACATCGGGGGAGCAGGGTTGTGG GGATGTGGATCACGGTGGACGTCGGGGGAGCAGGGTTGTGG Direct Gain NA NA NA 0 0.930737376213074 Functional Gain 0.930737376213074 IFITM2 ENSG00000185201 CDS Human protein_coding chr11:308314 chr11:308314 nonsynonymous SNV 0.000 0 21 hm7G_associated_SNPs_62024 0 27863252 Granulocyte count 8e-48 GWAS_Catalog TagSNP rs14408 GCST004614 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
223 chr11 309127 309127 1 + A C rs1059091 309127 - 309107 309147 41 GACCAACACTGGGATGATGATGAGCAGAATGGTCATGAAGA GACCAACACTGGGATGATGAGGAGCAGAATGGTCATGAAGA Direct Gain NA NA NA 0 0.827259361743927 Functional Gain 0.827259361743927 IFITM2 ENSG00000185201 CDS Human protein_coding chr11:309127 chr11:309127 nonsynonymous SNV 0.001 1 21 hm7G_associated_SNPs_62025 0 30595370 Eosinophil counts 3e-52 GWAS_Catalog TagSNP rs1059091 GCST007065 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
224 chr11 838722 838722 1 + T C rs6762 838722 - 838702 838742 41 CTGCCCCGCAGAGGCACATGAACAGGGCAGTGCACAGTGAC CTGCCCCGCAGAGGCACATGGACAGGGCAGTGCACAGTGAC Direct Gain NA NA NA 0 0.628753304481506 Functional Gain 0.628753304481506 CD151 ENSG00000177697 UTR3 Human protein_coding chr11:838722 chr11:838722 . . 0 21 hm7G_associated_SNPs_62048 0 27863252 Mean platelet volume 8e-09 GWAS_Catalog TagSNP rs6762 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
225 chr11 1483177 1483177 1 + T C rs1881505 1483177 - 1483157 1483197 41 CTGGCGCTGCCGCCCGCTACAAGACACCGCCCCTCTGCCCC CTGGCGCTGCCGCCCGCTACGAGACACCGCCCCTCTGCCCC Direct Gain NA NA NA 0 0.796309113502502 Functional Gain 0.796309113502502 BRSK2 ENSG00000174672 UTR3 Human protein_coding chr11:1483177 chr11:1483177 . . 0 21 hm7G_associated_SNPs_62100 0 30595370 Body mass index 8e-09 GWAS_Catalog TagSNP rs1881505 GCST007039 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
226 chr11 17667439 17667439 1 + G C rs11024357 17667439 - 17667419 17667459 41 CCTGCACTGTATAGGGCACCCAGGTGGCATTGGTGGCACAG CCTGCACTGTATAGGGCACCGAGGTGGCATTGGTGGCACAG Direct Gain NA NA NA 0 0.83031177520752 Functional Gain 0.83031177520752 OTOG ENSG00000188162 CDS Human protein_coding chr11:17667439 chr11:17667439 nonsynonymous SNV 0.998 0 21 hm7G_associated_SNPs_62233 1 17434096 Ischemic stroke 2.48e-05 Johnson and O'Donnell TagSNP rs11024357 . A genome-wide genotyping study in patients with ischaemic stroke: initial analysis and data release.
227 chr11 57365723 57365723 1 + T C rs28362944 57365723 - 57365703 57365743 41 CTGGGCGGCGACGTCAGCGGACCTGCGGAGCCAGCCAGCCT CTGGGCGGCGACGTCAGCGGGCCTGCGGAGCCAGCCAGCCT Direct Gain NA NA NA 0 0.73221230506897 Functional Gain 0.73221230506897 SERPING1 ENSG00000149131 CDS Human protein_coding chr11:57365723 chr11:57365723 nonsynonymous SNV 0.537 2 21 hm7G_associated_SNPs_62388 1 23251661 Obesity-related traits 9e-06 GWAS_Catalog TagSNP rs28362944 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
228 chr11 57463500 57463500 1 + T C rs1783978 57463500 - 57463480 57463520 41 CTTACCCTCATTAGTAGCCAAGCCGAGGTGTGTTCGCAACC CTTACCCTCATTAGTAGCCAGGCCGAGGTGTGTTCGCAACC Direct Gain NA NA NA 0 0.641465783119202 Functional Gain 0.641465783119202 ZDHHC5 ENSG00000156599 CDS Human protein_coding chr11:57463500 chr11:57463500 synonymous SNV . 0 21 hm7G_associated_SNPs_62391 0 30038396 Educational attainment (years of education) 2e-11 GWAS_Catalog TagSNP rs1783978 GCST006442 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
229 chr11 61551356 61551356 1 + T C rs174535 61551356 - 61551336 61551376 41 AGGTGCAGTGGGGTGCCACTACTGACAGGGATGTGGTAGGT AGGTGCAGTGGGGTGCCACTGCTGACAGGGATGTGGTAGGT Direct Gain NA NA NA 0 0.916895866394043 Functional Gain 0.916895866394043 MYRF ENSG00000124920 CDS Human protein_coding chr11:61551356 chr11:61551356 synonymous SNV . 0 21 hm7G_associated_SNPs_62452 0 26974007 Chronic inflammatory diseases (ankylosing spondylitis, Crohn's disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy) 2e-11 GWAS_Catalog TagSNP rs174535 GCST005537 Analysis of five chronic inflammatory diseases identifies 27 new associations and highlights disease-specific patterns at shared loci.
230 chr11 62380732 62380732 1 + T C rs4387351 62380732 - 62380712 62380752 41 TCCCATCTCTGCCCAAGGGAATGCAGAGGTGTCAGGGATGG TCCCATCTCTGCCCAAGGGAGTGCAGAGGTGTCAGGGATGG Direct Gain NA NA NA 0 0.535808682441711 Functional Gain 0.535808682441711 ROM1 ENSG00000149489 UTR5 Human protein_coding chr11:62380732 chr11:62380732 . . 0 21 hm7G_associated_SNPs_62464 0 30621171 Serum bilirubin levels in metabolic syndrome 1e-06 GWAS_Catalog TagSNP rs4387351 GCST007018 Genome-Wide Association Study (GWAS) on Bilirubin Concentrations in Subjects with Metabolic Syndrome: Sex-Specific GWAS Analysis and Gene-Diet Interactions in a Mediterranean Population.
231 chr11 65601560 65601560 1 + G C rs17854357 65601560 - 65601540 65601580 41 TTCTCTACCTTGCCCTCCTTCCCAACCTCCGCATACGTCTC TTCTCTACCTTGCCCTCCTTGCCAACCTCCGCATACGTCTC Direct Gain NA NA NA 0 0.665882349014282 Functional Gain 0.665882349014282 SNX32 ENSG00000172803 CDS Human protein_coding chr11:65601560 chr11:65601560 synonymous SNV . 0 21 hm7G_associated_SNPs_62536 0 30595370 Menarche (age at onset) 2e-08 GWAS_Catalog TagSNP rs17854357 GCST007078 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
232 chr11 66328095 66328095 1 + T C rs1815739 66328095 - 66328075 66328115 41 CATGATGGCACCTCGCTCTCAGTCAGCCTCGGGCAGTGTTG CATGATGGCACCTCGCTCTCGGTCAGCCTCGGGCAGTGTTG Direct Gain NA NA NA 0 0.548718333244324 Functional Gain 0.548718333244324 ACTN3 ENSG00000248746 CDS Human protein_coding chr11:66328095 chr11:66328095 unknown . 0 21 hm7G_associated_SNPs_62547 3 29875488 Blood protein levels 8e-12 GWAS_Catalog TagSNP rs1815739 GCST005806 Genomic atlas of the human plasma proteome.
233 chr11 68846399 68846399 1 + A C rs35264875 68846399 - 68846379 68846419 41 GGCAAAGACCTTGAGCAGCATCTCCAACAGGTAGTACACAA GGCAAAGACCTTGAGCAGCAGCTCCAACAGGTAGTACACAA Direct Gain NA NA NA 0 0.615399539470673 Functional Gain 0.615399539470673 TPCN2 ENSG00000162341 CDS Human protein_coding chr11:68846399 chr11:68846399 nonsynonymous SNV 0.986 1 21 hm7G_associated_SNPs_62583 0 18488028 Blond vs. brown hair color 4e-30 GWAS_Catalog TagSNP rs35264875 GCST000194 Two newly identified genetic determinants of pigmentation in Europeans.
234 chr11 94865334 94865334 1 + T C rs586421 94865334 - 94865314 94865354 41 CAGACTAGAAAATCAGCTCCATAATGAGGAAGAGGCTAATC CAGACTAGAAAATCAGCTCCGTAATGAGGAAGAGGCTAATC Direct Gain NA NA NA 0 0.958290219306946 Functional Gain 0.958290219306946 ENDOD1 ENSG00000149218 UTR3 Human protein_coding chr11:94865334 chr11:94865334 . . 0 21 hm7G_associated_SNPs_62729 0 17846125 Type II Diabetes Mellitus 0.004 Johnson and O'Donnell TagSNP rs586421 . A search for variants associated with young-onset type 2 diabetes in American Indians in a 100K genotyping array.
235 chr11 118355642 118355642 1 + A C rs9332801 118355642 - 118355622 118355662 41 AAGCAAACCACCCTGGGTGTTATAGGAACAGAAGTCAAGAT AAGCAAACCACCCTGGGTGTGATAGGAACAGAAGTCAAGAT Direct Gain NA NA NA 0 0.512634813785553 Functional Gain 0.512634813785553 KMT2A ENSG00000118058 CDS Human protein_coding chr11:118355642 chr11:118355642 synonymous SNV . 0 21 hm7G_associated_SNPs_62817 1 30643256 Depressive symptoms 2e-08 GWAS_Catalog TagSNP rs9332801 GCST007340 Multivariate genome-wide analyses of the well-being spectrum.
236 chr12 3049698 3049698 1 + T C rs998814 3049698 - 3049678 3049718 41 CATTCTCAAGGTTTGGATACATTCTGGGAAGGGTGAACTGG CATTCTCAAGGTTTGGATACGTTCTGGGAAGGGTGAACTGG Direct Gain NA NA NA 0 0.882309079170227 Functional Gain 0.882309079170227 TULP3 ENSG00000078246 CDS Human protein_coding chr12:3049698 chr12:3049698 nonsynonymous SNV 0.001 1 21 hm7G_associated_SNPs_62984 0 17052657 Parkinson's disease 0.000190252 Johnson and O'Donnell TagSNP rs998814 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
237 chr12 3387697 3387697 1 + T C rs16930370 3387697 - 3387677 3387717 41 ATGACAATGGTGCCTATGGCAATGACCAGGTTGGCTGCAGA ATGACAATGGTGCCTATGGCGATGACCAGGTTGGCTGCAGA Direct Gain NA NA NA 0 0.864227950572968 Functional Gain 0.864227950572968 TSPAN9 ENSG00000011105 CDS Human protein_coding chr12:3387697 chr12:3387697 synonymous SNV . 0 21 hm7G_associated_SNPs_62985 0 30595370 Height 3e-17 GWAS_Catalog TagSNP rs16930370 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
238 chr12 56863770 56863770 1 + G C rs2657880 56863770 - 56863750 56863790 41 GAAAGGATTTACTCTTCAGCCATCTGGTAGAGCCCCAAGAA GAAAGGATTTACTCTTCAGCGATCTGGTAGAGCCCCAAGAA Direct Gain NA NA NA 0 0.785313248634338 Functional Gain 0.785313248634338 SPRYD4 ENSG00000176422 UTR3 Human protein_coding chr12:56863770 chr12:56863770 . 0.030 0 21 hm7G_associated_SNPs_63287 0 22916037 Metabolite levels 7e-30 GWAS_Catalog TagSNP rs2657880 GCST001639 Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis.
239 chr12 72080272 72080272 1 + T C rs2304269 72080272 - 72080252 72080292 41 CCTACTGGCGGAGAGCTCCAATTCATATGGGCGTGGTCAAC CCTACTGGCGGAGAGCTCCAGTTCATATGGGCGTGGTCAAC Direct Gain NA NA NA 0 0.643778502941132 Functional Gain 0.643778502941132 TMEM19 ENSG00000139291 UTR5 Human protein_coding chr12:72080272 chr12:72080272 . . 0 21 hm7G_associated_SNPs_63366 0 28232668 Nonsyndromic cleft lip with cleft palate 1e-12 GWAS_Catalog TagSNP rs2304269 GCST004166 Genome-wide analyses of non-syndromic cleft lip with palate identify 14 novel loci and genetic heterogeneity.
240 chr12 108644189 108644189 1 + T C rs9739493 108644189 - 108644169 108644209 41 ATACAGTTTCAAAACATAGAAAGGCAGGAGAACACAAAGGC ATACAGTTTCAAAACATAGAGAGGCAGGAGAACACAAAGGC Direct Gain NA NA NA 0 0.541339874267578 Functional Gain 0.541339874267578 WSCD2 ENSG00000075035 UTR3 Human protein_coding chr12:108644189 chr12:108644189 . . 0 21 hm7G_associated_SNPs_63505 0 18003638 Hypertension 0.008 Johnson and O'Donnell TagSNP rs9739493 . High-density association study and nomination of susceptibility genes for hypertension in the Japanese National Project.
241 chr12 111786892 111786892 1 + T C rs7398833 111786892 - 111786872 111786912 41 TCTGTACCATGCTACATCTCATATAGGACGGTTGGGCCACG TCTGTACCATGCTACATCTCGTATAGGACGGTTGGGCCACG Direct Gain NA NA NA 0 0.796624004840851 Functional Gain 0.796624004840851 CUX2 ENSG00000111249 UTR3 Human protein_coding chr12:111786892 chr12:111786892 . . 0 21 hm7G_associated_SNPs_63530 0 17554300 Multiple complex diseases 4.6e-07 Johnson and O'Donnell TagSNP rs7398833 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
242 chr12 121177272 121177272 1 + G C rs3916 121177272 - 121177252 121177292 41 TCCCGCGCCTTCCCGCAGTCCTGGGGCAGTCCGCCGCGGGC TCCCGCGCCTTCCCGCAGTCGTGGGGCAGTCCGCCGCGGGC Direct Gain NA NA NA 0 0.622880697250366 Functional Gain 0.622880697250366 ACADS ENSG00000122971 UTR3 Human protein_coding chr12:121177272 chr12:121177272 . . 0 21 hm7G_associated_SNPs_63571 2 24586186 Urinary metabolites (H-NMR features) 2e-22 GWAS_Catalog TagSNP rs3916 GCST002364 Genome-wide association study of metabolic traits reveals novel gene-metabolite-disease links.
243 chr13 95280833 95280833 1 + T C rs187295598 95280833 - 95280813 95280853 41 GCAGAATACTAGTCATTTCCAATGAGACTAGGTACAAAAGA GCAGAATACTAGTCATTTCCGATGAGACTAGGTACAAAAGA Direct Gain NA NA NA 0 0.578925967216492 Functional Gain 0.578925967216492 GPR180 ENSG00000152749 UTR3 Human protein_coding chr13:95280833 chr13:95280833 . . 0 21 hm7G_associated_SNPs_63843 0 27770636 Late-onset Alzheimer's disease 6e-06 GWAS_Catalog TagSNP rs187295598 GCST003815 Two novel loci, COBL and SLC10A2, for Alzheimer's disease in African Americans.
244 chr14 21570273 21570273 1 + T C rs745696 21570273 - 21570253 21570293 41 TTCTTCCCTCTCACCTTCCAAAGGCGGGGTGCTCTGCGAAG TTCTTCCCTCTCACCTTCCAGAGGCGGGGTGCTCTGCGAAG Direct Gain NA NA NA 0 0.763267278671265 Functional Gain 0.763267278671265 TMEM253 ENSG00000232070 CDS Human protein_coding chr14:21570273 chr14:21570273 synonymous SNV . 0 21 hm7G_associated_SNPs_63953 0 17554300 Multiple complex diseases 0.000906435 Johnson and O'Donnell TagSNP rs745696 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
245 chr14 55818403 55818403 1 + T C rs35070799 55818403 - 55818383 55818423 41 GCTCTCTGCTCATACAATCAACAGCATCTGTGGGCAATTCA GCTCTCTGCTCATACAATCAGCAGCATCTGTGGGCAATTCA Direct Gain NA NA NA 0 0.768964529037476 Functional Gain 0.768964529037476 FBXO34 ENSG00000178974 CDS Human protein_coding chr14:55818403 chr14:55818403 nonsynonymous SNV 0.126 0 21 hm7G_associated_SNPs_64093 0 28240269 Blood protein levels 5e-16 GWAS_Catalog TagSNP rs35070799 GCST004365 Connecting genetic risk to disease end points through the human blood plasma proteome.
246 chr14 74551970 74551970 1 + G C rs2239557 74551970 - 74551950 74551990 41 CCAAATAGAGATAAGGAAGGCACAGGGCGACCCCCCTGTCC CCAAATAGAGATAAGGAAGGGACAGGGCGACCCCCCTGTCC Direct Gain NA NA NA 0 0.859639942646027 Functional Gain 0.859639942646027 LIN52 ENSG00000205659 intronic Human protein_coding chr14:74551970 chr14:74551970 . . 0 21 hm7G_associated_SNPs_64202 0 20585627 Common traits (Other) 3e-07 GWAS_Catalog TagSNP rs2239557 GCST000706 Web-based, participant-driven studies yield novel genetic associations for common traits.
247 chr14 100141689 100141689 1 + T C rs7158073 100141689 - 100141669 100141709 41 CGGTGCCCCAGCGTCCGCCCACGAACACCTCCACGCGCCCG CGGTGCCCCAGCGTCCGCCCGCGAACACCTCCACGCGCCCG Direct Gain NA NA NA 0 0.644246816635132 Functional Gain 0.644246816635132 HHIPL1 ENSG00000182218 CDS Human protein_coding chr14:100141689 chr14:100141689 nonsynonymous SNV 0.983 0 21 hm7G_associated_SNPs_64311 0 30578418 Pulse pressure 2e-14 GWAS_Catalog TagSNP rs7158073 GCST007269 Trans-ethnic association study of blood pressure determinants in over 750,000 individuals.
248 chr14 105349388 105349388 1 + A C rs2028414 105349388 - 105349368 105349408 41 AGCTCCCCGTCCTGCTGCACTGGTCCCTTGGGGCGCTCTGG AGCTCCCCGTCCTGCTGCACGGGTCCCTTGGGGCGCTCTGG Direct Gain NA NA NA 0 0.834670782089233 Functional Gain 0.834670782089233 CEP170B ENSG00000099814 CDS Human protein_coding chr14:105349388 chr14:105349388 synonymous SNV . 0 21 hm7G_associated_SNPs_64394 0 23382691 IgG glycosylation 8e-06 GWAS_Catalog TagSNP rs2028414 GCST001848 Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers.
249 chr15 42651900 42651900 1 + G C rs149698681 42651900 - 42651880 42651920 41 AGTTGGAGTAATTCTGTCATCTGAGAGAAAAGTGTCCACAT AGTTGGAGTAATTCTGTCATGTGAGAGAAAAGTGTCCACAT Direct Gain NA NA NA 0 0.513818621635437 Functional Gain 0.513818621635437 CAPN3 ENSG00000258461 ncRNA_intronic Human protein_coding chr15:42651900 chr15:42651900 . . 0 21 hm7G_associated_SNPs_64541 2 27863252 Monocyte count 7e-10 GWAS_Catalog TagSNP rs149698681 GCST004625 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
250 chr15 78792527 78792527 1 + T C rs1062980 78792527 - 78792507 78792547 41 GGATGCCTGTGCCTCTGCCCATAACTATATATAGAGTATGC GGATGCCTGTGCCTCTGCCCGTAACTATATATAGAGTATGC Direct Gain NA NA NA 0 0.639998435974121 Functional Gain 0.639998435974121 IREB2 ENSG00000136381 UTR3 Human protein_coding chr15:78792527 chr15:78792527 . . 0 21 hm7G_associated_SNPs_64774 0 26634245 Post bronchodilator FEV1/FVC ratio 7e-08 GWAS_Catalog TagSNP rs1062980 GCST003264 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
251 chr15 78832832 78832832 1 + T C rs3813570 78832832 - 78832812 78832852 41 TCCACGGAGCCCTTAACTCCACGGAAGAATAAACCACCACC TCCACGGAGCCCTTAACTCCGCGGAAGAATAAACCACCACC Direct Gain NA NA NA 0 0.537402033805847 Functional Gain 0.537402033805847 PSMA4 ENSG00000041357 UTR5 Human protein_coding chr15:78832832 chr15:78832832 . . 0 21 hm7G_associated_SNPs_64775 0 26634245 Post bronchodilator FEV1/FVC ratio 2e-06 GWAS_Catalog TagSNP rs3813570 GCST003264 A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.
252 chr15 89174748 89174748 1 + G C rs2278598 89174748 - 89174728 89174768 41 TACAGATGAGGAAAAAACAGCCTCAAGAGTGAAGTCCCTCG TACAGATGAGGAAAAAACAGGCTCAAGAGTGAAGTCCCTCG Direct Gain NA NA NA 0 0.600155830383301 Functional Gain 0.600155830383301 AEN ENSG00000181026 UTR3 Human protein_coding chr15:89174748 chr15:89174748 . . 0 21 hm7G_associated_SNPs_64844 0 17998437 Alzheimer's disease 0.000149 Johnson and O'Donnell TagSNP rs2278598 . Candidate single-nucleotide polymorphisms from a genomewide association study of Alzheimer disease.
253 chr16 681966 681966 1 + T C rs28455838 681966 - 681946 681986 41 GGAGAGGCAATGACGGGGTGAGAGAAGAGGATGGAAAAAGT GGAGAGGCAATGACGGGGTGGGAGAAGAGGATGGAAAAAGT Direct Gain NA NA NA 0 0.79240345954895 Functional Gain 0.79240345954895 WFIKKN1 ENSG00000127578 intronic Human protein_coding chr16:681966 chr16:681966 . . 0 21 hm7G_associated_SNPs_65012 0 28552196 Height 6e-06 GWAS_Catalog TagSNP rs28455838 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
254 chr16 2259191 2259191 1 + T C rs3160 2259191 - 2259171 2259211 41 GGCAGGGAGGGGCAGAGAACACACTAGCTTGGGGGTGGGCA GGCAGGGAGGGGCAGAGAACGCACTAGCTTGGGGGTGGGCA Direct Gain NA NA NA 0 0.688390076160431 Functional Gain 0.688390076160431 MLST8 ENSG00000167965 UTR3 Human protein_coding chr16:2259191 chr16:2259191 . . 0 21 hm7G_associated_SNPs_65094 0 28552196 Height 7e-07 GWAS_Catalog TagSNP rs3160 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
255 chr16 23200848 23200848 1 + T C rs5735 23200848 - 23200828 23200868 41 TGATCAAAGATCAGCAGCGGAATCCGGTGGGAGAATCTAGG TGATCAAAGATCAGCAGCGGGATCCGGTGGGAGAATCTAGG Direct Gain NA NA NA 0 0.885225892066956 Functional Gain 0.885225892066956 SCNN1G ENSG00000166828 CDS Human protein_coding chr16:23200848 chr16:23200848 synonymous SNV . 0 21 hm7G_associated_SNPs_65277 3 30598549 Heel bone mineral density 1e-19 GWAS_Catalog TagSNP rs5735 GCST006979 An atlas of genetic influences on osteoporosis in humans and mice.
256 chr16 31091209 31091209 1 + T C rs3751855 31091209 - 31091189 31091229 41 GTCTGGCAGCCCTTCTCGGCAGTCTCCAGCCTGGGCTCTAT GTCTGGCAGCCCTTCTCGGCGGTCTCCAGCCTGGGCTCTAT Direct Gain NA NA NA 0 0.646591901779175 Functional Gain 0.646591901779175 ZNF646 ENSG00000167395 CDS Human protein_coding chr16:31091209 chr16:31091209 synonymous SNV . 0 21 hm7G_associated_SNPs_65360 0 29500382 Feeling tense 2e-08 GWAS_Catalog TagSNP rs3751855 GCST006952 Item-level analyses reveal genetic heterogeneity in neuroticism.
257 chr16 50756540 50756540 1 + G C rs2066845 50756540 - 50756520 50756560 41 CTCGTCACCCACTCTGTTGCCCCAGAATCTGAAAAGGCCAA CTCGTCACCCACTCTGTTGCGCCAGAATCTGAAAAGGCCAA Direct Gain NA NA NA 0 0.902686357498169 Functional Gain 0.902686357498169 NOD2 ENSG00000167207 CDS Human protein_coding chr16:50756540 chr16:50756540 nonsynonymous SNV 1.000 4 21 hm7G_associated_SNPs_65402 5 26974007 Chronic inflammatory diseases (ankylosing spondylitis, Crohn's disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy) 6e-94 GWAS_Catalog TagSNP rs2066845 GCST005537 Analysis of five chronic inflammatory diseases identifies 27 new associations and highlights disease-specific patterns at shared loci.
258 chr16 57394393 57394393 1 + T C rs41398344 57394393 - 57394373 57394413 41 GGGCAGACGGTAACGGACGTAATCACGGCAGCAGACGCTGT GGGCAGACGGTAACGGACGTGATCACGGCAGCAGACGCTGT Direct Gain NA NA NA 0 0.630370497703552 Functional Gain 0.630370497703552 CCL22 ENSG00000102962 CDS Human protein_coding chr16:57394393 chr16:57394393 nonsynonymous SNV 0.311 1 21 hm7G_associated_SNPs_65439 0 29875488 Blood protein levels 4e-32 GWAS_Catalog TagSNP rs41398344 GCST005806 Genomic atlas of the human plasma proteome.
259 chr16 67232360 67232360 1 + T C rs9932087 67232360 - 67232340 67232380 41 AGACACTGAGGCTGGCAGGAACAAGACACTGCCCCCTATGG AGACACTGAGGCTGGCAGGAGCAAGACACTGCCCCCTATGG Direct Gain NA NA NA 0 0.885508418083191 Functional Gain 0.885508418083191 E2F4 ENSG00000205250 UTR3 Human protein_coding chr16:67232360 chr16:67232360 . . 0 21 hm7G_associated_SNPs_65482 0 30595370 Mean corpuscular hemoglobin 8e-27 GWAS_Catalog TagSNP rs9932087 GCST007068 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
260 chr16 67911517 67911517 1 + T C rs8060686 67911517 - 67911497 67911537 41 ACTGTTGGGCTGCTCTCCTCACAGCAGTCTTCGCTCTCCTC ACTGTTGGGCTGCTCTCCTCGCAGCAGTCTTCGCTCTCCTC Direct Gain NA NA NA 0 0.694047629833221 Functional Gain 0.694047629833221 EDC4 ENSG00000038358 CDS Human protein_coding chr16:67911517 chr16:67911517 synonymous SNV . 0 21 hm7G_associated_SNPs_65493 0 22399527 Metabolic syndrome 2e-10 GWAS_Catalog TagSNP rs8060686 GCST001436 Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits.
261 chr16 85321483 85321483 1 + T C rs2966858 85321483 - 85321463 85321503 41 TGTGCGCAGGCATTATTCTGAGTCCTAGGGATGCCGCTGTG TGTGCGCAGGCATTATTCTGGGTCCTAGGGATGCCGCTGTG Direct Gain NA NA NA 0 0.606664955615997 Functional Gain 0.606664955615997 LINC00311 ENSG00000179219;ENSG00000266307 intergenic Human other chr16:85321483 chr16:85321483 . . 0 21 hm7G_associated_SNPs_65617 0 30573740 Male-pattern baldness 3e-17 GWAS_Catalog TagSNP rs2966858 GCST007020 Dissection of genetic variation and evidence for pleiotropy in male pattern baldness.
262 chr16 87678144 87678144 1 + T C rs918368 87678144 - 87678124 87678164 41 GACTTGCGCAGCTTCAGCCCACTCAGCAGCGAGCGCCGAAA GACTTGCGCAGCTTCAGCCCGCTCAGCAGCGAGCGCCGAAA Direct Gain NA NA NA 0 0.895759701728821 Functional Gain 0.895759701728821 JPH3 ENSG00000154118 CDS Human protein_coding chr16:87678144 chr16:87678144 synonymous SNV . 0 21 hm7G_associated_SNPs_65634 0 17362836 Amyotrophic Lateral Sclerosis (ALS) 0.000686 Johnson and O'Donnell TagSNP rs918368 . Genome-wide genotyping in amyotrophic lateral sclerosis and neurologically normal controls: first stage analysis and public release of data.
263 chr16 89805261 89805261 1 + A C rs1800359 89805261 - 89805241 89805281 41 AAGATGCCCACCTTGGGCCATGTGGGGGACATGAGAATTGA AAGATGCCCACCTTGGGCCAGGTGGGGGACATGAGAATTGA Direct Gain NA NA NA 0 0.919939160346985 Functional Gain 0.919939160346985 ZNF276 ENSG00000187741 CDS Human protein_coding chr16:89805261 chr16:89805261 unknown . 0 21 hm7G_associated_SNPs_65700 0 17952075 Hair, eye and skin pigmentation 3.5e-22 Johnson and O'Donnell TagSNP rs1800359 . Genetic determinants of hair, eye and skin pigmentation in Europeans.
264 chr16 90066936 90066936 1 + A C rs4785763 90066936 - 90066916 90066956 41 ACTCCTCATAGGTAGACTTCTCCGAGAAGGGCCGGGGGCCC ACTCCTCATAGGTAGACTTCGCCGAGAAGGGCCGGGGGCCC Direct Gain NA NA NA 0 0.883041262626648 Functional Gain 0.883041262626648 AFG3L1P ENSG00000223959 ncRNA_exonic Human transcribed_unitary_pseudogene chr16:90066936 chr16:90066936 . . 0 21 hm7G_associated_SNPs_65721 0 19578364 Melanoma 6e-22 GWAS_Catalog TagSNP rs4785763 GCST000437 Genome-wide association study identifies three loci associated with melanoma risk.
265 chr17 1630395 1630395 1 + T C rs59643265 1630395 - 1630375 1630415 41 AGAAGAATCCTCCCCTCCTCACCCTCCCCAGGGTCTGCCCC AGAAGAATCCTCCCCTCCTCGCCCTCCCCAGGGTCTGCCCC Direct Gain NA NA NA 0 0.752023696899414 Functional Gain 0.752023696899414 WDR81 ENSG00000167716 CDS Human protein_coding chr17:1630395 chr17:1630395 synonymous SNV . 0 21 hm7G_associated_SNPs_65753 1 30595370 Height 1e-24 GWAS_Catalog TagSNP rs59643265 GCST007841 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
266 chr17 17707105 17707105 1 + T C rs3818717 17707105 - 17707085 17707125 41 CATCCTTTGTGGCAGCACCCAATGGTGGCCCCGGCTTCTTG CATCCTTTGTGGCAGCACCCGATGGTGGCCCCGGCTTCTTG Direct Gain NA NA NA 0 0.620802640914917 Functional Gain 0.620802640914917 RAI1 ENSG00000108557 CDS Human protein_coding chr17:17707105 chr17:17707105 synonymous SNV . 0 21 hm7G_associated_SNPs_65933 1 27863252 Lymphocyte counts 1e-12 GWAS_Catalog TagSNP rs3818717 GCST004627 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
267 chr17 19912710 19912710 1 + T C rs8067545 19912710 - 19912690 19912730 41 GCTGGCTCAGCGCCGCCGCAACCCCCAGCGGCCACGGCTCC GCTGGCTCAGCGCCGCCGCAGCCCCCAGCGGCCACGGCTCC Direct Gain NA NA NA 0 0.713734745979309 Functional Gain 0.713734745979309 SPECC1 ENSG00000128487 UTR5 Human protein_coding chr17:19912710 chr17:19912710 . . 0 21 hm7G_associated_SNPs_65981 0 26198764 Schizophrenia 1e-06 GWAS_Catalog TagSNP rs8067545 GCST003048 Genome-wide association study of schizophrenia in Ashkenazi Jews.
268 chr17 29704002 29704002 1 + T C rs1048317 29704002 - 29703982 29704022 41 GGCTGGCACTCTGTCTCCCCAACTAGGACACAGGATAGAAG GGCTGGCACTCTGTCTCCCCGACTAGGACACAGGATAGAAG Direct Gain NA NA NA 0 0.960385799407959 Functional Gain 0.960385799407959 NF1 ENSG00000196712 UTR3 Human protein_coding chr17:29704002 chr17:29704002 . . 0 21 hm7G_associated_SNPs_66050 4 17052657 Parkinson's disease 0.000298283 Johnson and O'Donnell TagSNP rs1048317 . Genome-wide genotyping in Parkinson's disease and neurologically normal controls: first stage analysis and public release of data.
269 chr17 34900836 34900836 1 + G C rs3736166 34900836 - 34900816 34900856 41 AGGCCCGCGTCAGGGCCGGCCTGGGCGGGAGCGCAGCTCCG AGGCCCGCGTCAGGGCCGGCGTGGGCGGGAGCGCAGCTCCG Direct Gain NA NA NA 0 0.812513709068298 Functional Gain 0.812513709068298 GGNBP2 ENSG00000005955 UTR5 Human other chr17:34900836 chr17:34900836 . . 0 21 hm7G_associated_SNPs_66087 0 30038396 Highest math class taken 1e-08 GWAS_Catalog TagSNP rs3736166 GCST006574 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
270 chr17 35306312 35306312 1 + G C rs2306658 35306312 - 35306292 35306332 41 TTGATCCGATTCCCCGACTCCGCCAGAGACCGCGCGGAGGC TTGATCCGATTCCCCGACTCGGCCAGAGACCGCGCGGAGGC Direct Gain NA NA NA 0 0.587780892848969 Functional Gain 0.587780892848969 AATF ENSG00000108270 UTR5 Human other chr17:35306312 chr17:35306312 . . 0 21 hm7G_associated_SNPs_66091 0 23251661 Obesity-related traits 2e-06 GWAS_Catalog TagSNP rs2306658 GCST001762 Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population.
271 chr17 47297297 47297297 1 + T C rs616338 47297297 - 47297277 47297317 41 ACCCGGCCGAGGCCAGGGAAAACGCAGAGGAGGCGGCGGAG ACCCGGCCGAGGCCAGGGAAGACGCAGAGGAGGCGGCGGAG Direct Gain NA NA NA 0 0.758988976478577 Functional Gain 0.758988976478577 ABI3 ENSG00000108798 CDS Human protein_coding chr17:47297297 chr17:47297297 nonsynonymous SNV 0.945 0 21 hm7G_associated_SNPs_66250 0 28714976 Alzheimer's disease (late onset) 5e-10 GWAS_Catalog TagSNP rs616338 GCST005549 Rare coding variants in PLCG2, ABI3, and TREM2 implicate microglial-mediated innate immunity in Alzheimer's disease.
272 chr17 48624523 48624523 1 + A C rs9890200 48624523 - 48624503 48624543 41 GCTGAGGACAGGAAGGGAAGTCAGGAGGCTGCGAGGGGCGG GCTGAGGACAGGAAGGGAAGGCAGGAGGCTGCGAGGGGCGG Direct Gain NA NA NA 0 0.899944722652435 Functional Gain 0.899944722652435 SPATA20 ENSG00000006282 UTR5 Human protein_coding chr17:48624523 chr17:48624523 . . 0 21 hm7G_associated_SNPs_66276 0 29875488 Blood protein levels 9e-24 GWAS_Catalog TagSNP rs9890200 GCST005806 Genomic atlas of the human plasma proteome.
273 chr17 61778689 61778689 1 + A C rs11542436 61778689 - 61778669 61778709 41 CCAGCCTGGGAAACAGCTGGTCGCTGGGGAAGCTGCAGCCT CCAGCCTGGGAAACAGCTGGGCGCTGGGGAAGCTGCAGCCT Direct Gain NA NA NA 0 0.836778283119202 Functional Gain 0.836778283119202 LOC729683 ENSG00000136490 upstream Human protein_coding chr17:61778689 chr17:61778689 . . 0 21 hm7G_associated_SNPs_66349 0 28552196 Height 8e-10 GWAS_Catalog TagSNP rs11542436 GCST008163 Whole-Genome Sequencing Coupled to Imputation Discovers Genetic Signals for Anthropometric Traits.
274 chr17 72946078 72946078 1 + A C rs1994720 72946078 - 72946058 72946098 41 TGAGCCTGAATGCAATCCATTAAACAAATAGGGTTTATGCG TGAGCCTGAATGCAATCCATGAAACAAATAGGGTTTATGCG Direct Gain NA NA NA 0 0.51679140329361 Functional Gain 0.51679140329361 OTOP3 ENSG00000182938 UTR3 Human protein_coding chr17:72946078 chr17:72946078 . . 0 21 hm7G_associated_SNPs_66404 0 17554300 Multiple complex diseases 0.000182643 Johnson and O'Donnell TagSNP rs1994720 . Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls.
275 chr17 75495397 75495397 1 + T C rs9038 75495397 - 75495377 75495417 41 GCCTGTCCCCGCATCTGGCCAAGCAGTCTGCGGATGGCTGA GCCTGTCCCCGCATCTGGCCGAGCAGTCTGCGGATGGCTGA Direct Gain NA NA NA 0 0.517213463783264 Functional Gain 0.517213463783264 SEPT9 ENSG00000184640 UTR3 Human protein_coding chr17:75495397 chr17:75495397 . . 0 21 hm7G_associated_SNPs_66465 1 29617998 Intraocular pressure 2e-23 GWAS_Catalog TagSNP rs9038 GCST005580 Genome-Wide Association Analyses Identify New Loci Influencing Intraocular Pressure.
276 chr17 78262161 78262161 1 + T C rs17857135 78262161 - 78262141 78262181 41 TCTCTCCCGGATGACTCACCATAGAGGCTGAGGCCCCTGCC TCTCTCCCGGATGACTCACCGTAGAGGCTGAGGCCCCTGCC Direct Gain NA NA NA 0 0.895596086978912 Functional Gain 0.895596086978912 RNF213 ENSG00000173821 CDS Human protein_coding chr17:78262161 chr17:78262161 nonsynonymous SNV 0.006 0 21 hm7G_associated_SNPs_66526 0 27322543 Migraine 5e-10 GWAS_Catalog TagSNP rs17857135 GCST003720 Meta-analysis of 375,000 individuals identifies 38 susceptibility loci for migraine.
277 chr17 79974731 79974731 1 + T C rs13087 79974731 - 79974711 79974751 41 ACTTACCTGGCCACCAGCACATCGGCCGCAGATGGGGAGAT ACTTACCTGGCCACCAGCACGTCGGCCGCAGATGGGGAGAT Direct Gain NA NA NA 0 0.734606683254242 Functional Gain 0.734606683254242 ASPSCR1 ENSG00000169696 CDS Human protein_coding chr17:79974731 chr17:79974731 nonsynonymous SNV . 0 21 hm7G_associated_SNPs_66581 0 30595370 Lung function (FEV1/FVC) 2e-08 GWAS_Catalog TagSNP rs13087 GCST007080 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
278 chr18 77156103 77156103 1 + G C rs71359461 77156103 - 77156083 77156123 41 CGGGCTCAGCGCCGCGCGCCCCGGAGGAAAGTCATCGAGGG CGGGCTCAGCGCCGCGCGCCGCGGAGGAAAGTCATCGAGGG Direct Gain NA NA NA 0 0.869766235351562 Functional Gain 0.869766235351562 NFATC1 ENSG00000131196 UTR5 Human protein_coding chr18:77156103 chr18:77156103 . . 0 21 hm7G_associated_SNPs_66842 0 28452372 Glomerular filtration rate (creatinine) 4e-10 GWAS_Catalog TagSNP rs71359461 GCST004292 1000 Genomes-based meta-analysis identifies 10 novel loci for kidney function.
279 chr19 2226772 2226772 1 + G C rs2302061 2226772 - 2226752 2226792 41 GTGGCCATTCTTGAGGTCGACCTCGCGGTCCCGGGCCTTGG GTGGCCATTCTTGAGGTCGAGCTCGCGGTCCCGGGCCTTGG Direct Gain NA NA NA 0 0.633801519870758 Functional Gain 0.633801519870758 DOT1L ENSG00000104885 CDS Human protein_coding chr19:2226772 chr19:2226772 nonsynonymous SNV 0.004 0 21 hm7G_associated_SNPs_66923 0 27618448 Systolic blood pressure 6e-08 GWAS_Catalog TagSNP rs2302061 GCST006228 Meta-analysis identifies common and rare variants influencing blood pressure and overlapping with metabolic trait loci.
280 chr19 3468503 3468503 1 + T C rs4807475 3468503 - 3468483 3468523 41 TTCTCTGTGTGAGAATGCTCAGGGCTGGGTGGGCAGGAAGC TTCTCTGTGTGAGAATGCTCGGGGCTGGGTGGGCAGGAAGC Direct Gain NA NA NA 0 0.758397579193115 Functional Gain 0.758397579193115 NFIC ENSG00000141905 UTR3 Human protein_coding chr19:3468503 chr19:3468503 . . 0 21 hm7G_associated_SNPs_66961 0 30595370 Lung function (FEV1/FVC) 4e-08 GWAS_Catalog TagSNP rs4807475 GCST007080 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
281 chr19 10802792 10802792 1 + A C rs13465 10802792 - 10802772 10802812 41 ACAAGGGGTGTATGTTTCCCTGCCAGGACAGAGGGCAACAC ACAAGGGGTGTATGTTTCCCGGCCAGGACAGAGGGCAACAC Direct Gain NA NA NA 0 0.873242974281311 Functional Gain 0.873242974281311 ILF3 ENSG00000129351 UTR3 Human protein_coding chr19:10802792 chr19:10802792 . . 0 21 hm7G_associated_SNPs_67092 0 17463246 Multiple continuous traits in DGI samples 0.0006368 Johnson and O'Donnell TagSNP rs13465 . Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels.
282 chr19 13002384 13002384 1 + T C rs3745647 13002384 - 13002364 13002404 41 AGTCCACCTGCGGCAGACAGACAGCTGAACAGGGGCAGCAG AGTCCACCTGCGGCAGACAGGCAGCTGAACAGGGGCAGCAG Direct Gain NA NA NA 0 0.659182488918304 Functional Gain 0.659182488918304 GCDH ENSG00000105607 CDS Human protein_coding chr19:13002384 chr19:13002384 nonsynonymous SNV . 0 21 hm7G_associated_SNPs_67125 1 30595370 Red cell distribution width 2e-41 GWAS_Catalog TagSNP rs3745647 GCST007074 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
283 chr19 13207284 13207284 1 + G C rs11555274 13207284 - 13207264 13207304 41 AACTTCCAACAAAAGCCGCCCCTGGAGCCAGCCACCTTGTG AACTTCCAACAAAAGCCGCCGCTGGAGCCAGCCACCTTGTG Direct Gain NA NA NA 0 0.545089960098267 Functional Gain 0.545089960098267 NFIX ENSG00000008441 UTR3 Human protein_coding chr19:13207284 chr19:13207284 . . 0 21 hm7G_associated_SNPs_67131 0 29326435 Intelligence (MTAG) 2e-08 GWAS_Catalog TagSNP rs11555274 GCST005316 A combined analysis of genetically correlated traits identifies 187 loci and a role for neurogenesis and myelination in intelligence.
284 chr19 19467937 19467937 1 + T C rs2285627 19467937 - 19467917 19467957 41 ACACCCAGCCTGGGAGCCCCAAGCAGCTGACCTGAGCAATC ACACCCAGCCTGGGAGCCCCGAGCAGCTGACCTGAGCAATC Direct Gain NA NA NA 0 0.57113516330719 Functional Gain 0.57113516330719 MAU2 ENSG00000129933 UTR3 Human protein_coding chr19:19467937 chr19:19467937 . . 0 21 hm7G_associated_SNPs_67263 0 27863252 White blood cell count (basophil) 1e-09 GWAS_Catalog TagSNP rs2285627 GCST004618 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
285 chr19 19654117 19654117 1 + G C rs7252453 19654117 - 19654097 19654137 41 TGGTCTGGGCGCAGTCCCCGCAGCTCCAGGTGGGCCCCGTA TGGTCTGGGCGCAGTCCCCGGAGCTCCAGGTGGGCCCCGTA Direct Gain NA NA NA 0 0.763121604919434 Functional Gain 0.763121604919434 CILP2 ENSG00000160161 CDS Human protein_coding chr19:19654117 chr19:19654117 synonymous SNV . 0 21 hm7G_associated_SNPs_67269 0 30038396 Self-reported math ability 4e-14 GWAS_Catalog TagSNP rs7252453 GCST006573 Gene discovery and polygenic prediction from a genome-wide association study of educational attainment in 1.1 million individuals.
286 chr19 36033226 36033226 1 + A C rs148474705 36033226 - 36033206 36033246 41 TCCAGGGGATCTGTTTGGGCTCTTTGCTGTGGGGAAGTGGC TCCAGGGGATCTGTTTGGGCGCTTTGCTGTGGGGAAGTGGC Direct Gain NA NA NA 0 0.650794386863708 Functional Gain 0.650794386863708 GAPDHS ENSG00000105679 CDS Human protein_coding chr19:36033226 chr19:36033226 nonsynonymous SNV 0.043 1 21 hm7G_associated_SNPs_67362 0 28234671 Diastolic blood pressure 1e-08 GWAS_Catalog TagSNP rs148474705 GCST007828 Rare coding variants associated with blood pressure variation in 15 914 individuals of African ancestry.
287 chr19 38794895 38794895 1 + T C rs2304176 38794895 - 38794875 38794915 41 AGGTCGAACTCCATGGCGGTAAGAGAAGTTGGGTCCTAAGG AGGTCGAACTCCATGGCGGTGAGAGAAGTTGGGTCCTAAGG Direct Gain NA NA NA 0 0.68278431892395 Functional Gain 0.68278431892395 C19orf33;YIF1B ENSG00000167644 UTR5 Human protein_coding chr19:38794895 chr19:38794895 . . 0 21 hm7G_associated_SNPs_67410 0 27863252 Mean platelet volume 9e-12 GWAS_Catalog TagSNP rs2304176 GCST004599 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
288 chr19 46181392 46181392 1 + G C rs1800437 46181392 - 46181372 46181412 41 CACGGGAGCAAACACCACCTCGTGGACACCCAGCAGGGGCA CACGGGAGCAAACACCACCTGGTGGACACCCAGCAGGGGCA Direct Gain NA NA NA 0 0.755722522735596 Functional Gain 0.755722522735596 GIPR ENSG00000010310 CDS Human protein_coding chr19:46181392 chr19:46181392 nonsynonymous SNV 1.000 4 21 hm7G_associated_SNPs_67558 0 29093273 GIP levels in response to oral glucose tolerance test (fasting) 4e-15 GWAS_Catalog TagSNP rs1800437 GCST005167 Genetic determinants of circulating GIP and GLP-1 concentrations.
289 chr19 54080067 54080067 1 + T C rs61744130 54080067 - 54080047 54080087 41 TCTTTCAAGCGTACCTTCACATATCCAGTTACGGCCAAGGG TCTTTCAAGCGTACCTTCACGTATCCAGTTACGGCCAAGGG Direct Gain NA NA NA 0 0.730545461177826 Functional Gain 0.730545461177826 ZNF331 ENSG00000130844 CDS Human protein_coding chr19:54080067 chr19:54080067 nonsynonymous SNV 0.112 1 21 hm7G_associated_SNPs_67764 0 30595370 Menarche (age at onset) 2e-09 GWAS_Catalog TagSNP rs61744130 GCST007078 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
290 chr19 55148031 55148031 1 + T C rs41308746 55148031 - 55148011 55148051 41 AATTCCCCAGACAGTGGGGAAGGAGGAGAGGCCATTTCTCT AATTCCCCAGACAGTGGGGAGGGAGGAGAGGCCATTTCTCT Direct Gain NA NA NA 0 0.528149604797363 Functional Gain 0.528149604797363 LILRB1 ENSG00000104972 CDS Human protein_coding chr19:55148031 chr19:55148031 synonymous SNV . 0 21 hm7G_associated_SNPs_67809 0 29875488 Blood protein levels 6e-37 GWAS_Catalog TagSNP rs41308746 GCST005806 Genomic atlas of the human plasma proteome.
291 chr19 55324635 55324635 1 + T C rs649216 55324635 - 55324615 55324655 41 AGAAAGAAGGGAAGGATGGTAAAGAGGATGATGGCCACTGA AGAAAGAAGGGAAGGATGGTGAAGAGGATGATGGCCACTGA Direct Gain NA NA NA 0 0.961101531982422 Functional Gain 0.961101531982422 KIR2DL4 ENSG00000189013 CDS Human protein_coding chr19:55324635 chr19:55324635 synonymous SNV . 0 21 hm7G_associated_SNPs_67822 0 29875488 Blood protein levels 3e-102 GWAS_Catalog TagSNP rs649216 GCST005806 Genomic atlas of the human plasma proteome.
292 chr20 33574765 33574765 1 + T C rs3746446 33574765 - 33574745 33574785 41 GCGATGAGCTCCTCCCCATCATTCATGTTGTCCACGGTGAT GCGATGAGCTCCTCCCCATCGTTCATGTTGTCCACGGTGAT Direct Gain NA NA NA 0 0.782490968704224 Functional Gain 0.782490968704224 MYH7B ENSG00000078814 CDS Human protein_coding chr20:33574765 chr20:33574765 synonymous SNV . 0 21 hm7G_associated_SNPs_68127 0 26965164 Congenital left-sided heart lesions 1e-08 GWAS_Catalog TagSNP rs3746446 GCST003419 A genome-wide association study of congenital cardiovascular left-sided lesions shows association with a locus on chromosome 20.
293 chr20 39797465 39797465 1 + T C rs753381 39797465 - 39797445 39797485 41 TCTGGATGATGGCGCTCTTGATGAAGGTCAGCTCGTCCTCC TCTGGATGATGGCGCTCTTGGTGAAGGTCAGCTCGTCCTCC Direct Gain NA NA NA 0 0.538982093334198 Functional Gain 0.538982093334198 PLCG1 ENSG00000124181 CDS Human protein_coding chr20:39797465 chr20:39797465 nonsynonymous SNV 0.998 0 21 hm7G_associated_SNPs_68173 0 27863252 Hemoglobin concentration 8e-09 GWAS_Catalog TagSNP rs753381 GCST004615 The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
294 chr20 57597970 57597970 1 + A C rs463312 57597970 - 57597950 57597990 41 ACACGCTGATTCTCTCCAGCTGCAAGGCCGAGGCCCCGCGG ACACGCTGATTCTCTCCAGCGGCAAGGCCGAGGCCCCGCGG Direct Gain NA NA NA 0 0.799010634422302 Functional Gain 0.799010634422302 TUBB1 ENSG00000101162 CDS Human protein_coding chr20:57597970 chr20:57597970 nonsynonymous SNV 0.895 4 21 hm7G_associated_SNPs_68292 0 30595370 Red blood cell count 2e-18 GWAS_Catalog TagSNP rs463312 GCST007069 Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
295 chr20 62320968 62320968 1 + T C rs6062302 62320968 - 62320948 62320988 41 CCACCCTGGCCCTTCATCTCATCCAGGAACTGCATCTTGAG CCACCCTGGCCCTTCATCTCGTCCAGGAACTGCATCTTGAG Direct Gain NA NA NA 0 0.878488302230835 Functional Gain 0.878488302230835 RTEL1 ENSG00000026036;ENSG00000258366 CDS Human other chr20:62320968 chr20:62320968 synonymous SNV . 0 21 hm7G_associated_SNPs_68367 1 26424050 Glioblastoma 1e-13 GWAS_Catalog TagSNP rs6062302 GCST003220 Genome-wide association study identifies multiple susceptibility loci for glioma.
296 chr21 45107562 45107562 1 + T C rs9306160 45107562 - 45107542 45107582 41 CACGTGCCTTCAGGGCTTTCAGCCCAGAGGCCTCGGGCTCC CACGTGCCTTCAGGGCTTTCGGCCCAGAGGCCTCGGGCTCC Direct Gain NA NA NA 0 0.764325797557831 Functional Gain 0.764325797557831 RRP1B ENSG00000160208 CDS Human protein_coding chr21:45107562 chr21:45107562 nonsynonymous SNV 0.000 0 21 hm7G_associated_SNPs_68495 0 27618447 Diastolic blood pressure 9e-10 GWAS_Catalog TagSNP rs9306160 GCST006020 Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.
297 chr22 21976934 21976934 1 + T C rs7444 21976934 - 21976914 21976954 41 GGGAGGGCTGTGGCAGGGCCACTGCACGGAGGAAGTGGAGA GGGAGGGCTGTGGCAGGGCCGCTGCACGGAGGAAGTGGAGA Direct Gain NA NA NA 0 0.713214218616486 Functional Gain 0.713214218616486 UBE2L3 ENSG00000185651 UTR3 Human protein_coding chr22:21976934 chr22:21976934 . . 0 21 hm7G_associated_SNPs_68680 0 27399966 Systemic lupus erythematosus 1e-13 GWAS_Catalog TagSNP rs7444 GCST003622 Genome-wide association meta-analysis in Chinese and European individuals identifies ten new loci associated with systemic lupus erythematosus.